Mapoly0030s0125



Description

RETINOBLASTOMA BINDING PROTEIN-RELATED

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0005515 Protein binding
GO GO:0005622 Intracellular
GO GO:0005634 Nucleus
GO GO:0016706 Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors
GO GO:0055114 Oxidation-reduction process
KOG KOG1246 DNA-binding protein jumonji/RBP2/SMCY, contains JmjC domain
OrthoMCL OG5_127370
PFAM PF00628 PHD-finger
PFAM PF01388 ARID/BRIGHT DNA binding domain
PFAM PF02373 JmjC domain, hydroxylase
PFAM PF02375 JmjN domain
PFAM PF02928 C5HC2 zinc finger
PFAM PF08429 PLU-1-like protein
PANTHER PTHR10694 JUMONJI DOMAIN CONTAINING PROTEIN
PANTHER PTHR10694:SF8 RETINOBLASTOMA BINDING PROTEIN-RELATED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpARID2 transcription factor, ARID Mapoly0030s0125.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0030s0125.1 scaffold_30:1410160..1433508  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0030s0125.1  

Gene structure:

mRNA scaffold_30:1410160..1433508  ( - strand )
three_prime_UTR scaffold_30:1410160..1410517  ( - strand )
CDS scaffold_30:1410518..1410833  ( - strand )
CDS scaffold_30:1411025..1411296  ( - strand )
CDS scaffold_30:1411629..1411724  ( - strand )
CDS scaffold_30:1416741..1416836  ( - strand )
CDS scaffold_30:1417261..1417407  ( - strand )
CDS scaffold_30:1417674..1417818  ( - strand )
CDS scaffold_30:1418073..1418146  ( - strand )
CDS scaffold_30:1418247..1418370  ( - strand )
CDS scaffold_30:1418654..1418793  ( - strand )
CDS scaffold_30:1418976..1419128  ( - strand )
CDS scaffold_30:1420738..1420813  ( - strand )
CDS scaffold_30:1421261..1421322  ( - strand )
CDS scaffold_30:1421532..1421717  ( - strand )
CDS scaffold_30:1421973..1422377  ( - strand )
CDS scaffold_30:1422600..1422759  ( - strand )
CDS scaffold_30:1423428..1423559  ( - strand )
CDS scaffold_30:1424150..1424208  ( - strand )
CDS scaffold_30:1425510..1425577  ( - strand )
CDS scaffold_30:1425761..1425968  ( - strand )
CDS scaffold_30:1426280..1426393  ( - strand )
CDS scaffold_30:1426543..1426653  ( - strand )
CDS scaffold_30:1426774..1426869  ( - strand )
CDS scaffold_30:1426994..1427065  ( - strand )
CDS scaffold_30:1427158..1427349  ( - strand )
CDS scaffold_30:1427508..1427660  ( - strand )
CDS scaffold_30:1427921..1428133  ( - strand )
CDS scaffold_30:1428339..1428425  ( - strand )
CDS scaffold_30:1428603..1428761  ( - strand )
CDS scaffold_30:1429013..1429149  ( - strand )
CDS scaffold_30:1429991..1430048  ( - strand )
CDS scaffold_30:1430302..1430424  ( - strand )
CDS scaffold_30:1430646..1430703  ( - strand )
CDS scaffold_30:1431105..1432774  ( - strand )
five_prime_UTR scaffold_30:1432775..1433508  ( - strand )

Sequences:

Gene

>Mapoly0030s0125.1
GGAAGGGGAAGGGGAGAGTGGAGGGGAGGGAGGGCGGACAGGAGACGACAGACGCCAGAGGAGAGAAAGCGAGCTTTTGCATCGTTGGTTCGTTCGTTCACCTCCACCTCCTTTGCGATTCATTATCCATCATGTGATCTTTCTCGGCTTGTGCTGGGGACTTGTCTTACTTCCGCAGGCTCGGCGAGCAGGGGACATGGACTGGCGGAGCGCGACGCTGCAGCTTTGATCGAGGCGCGGAAAGGACGGGCTTTTTTTTCTTGGGCGTGCGTCGGAAGCAGGAAGCAGGAAGCAGGAAGCAGGGGAGCAGGGGAGCGAGCGAGCACTCGCGCGTAGGTTTTCGATCGCGCAGCGACTTTCCGGTTCCGCACTCGGTCGGAGGCAGGGGAGAAGTGTCGACAGGTTGATCGCGGTGCGAGGGAGGCGGGCGAGGCGCGTCTTTCACGCGAGGATTGCGAAGCAGGGGAGCAGGGCAGCTGTGTTCGCGGGAGGACGGCCGGATCGATTGGAATTGAGGAAAAACAGAGATGCGCGACGGGGGGAGTAGTTAATTCGGGTATGGTAGGCTGTGCTGCGTCGGGGTGTGGTAGGCAGAATGCGCTTGAATTCGACCGGGGTGTCCTCTACTCAATGCGCGTTGCGAACCCTGGAATTTCATCCGACGTTGCGGGGCTTCGATTTGGGGGATTTTATTTTGGTTCTGTGTGATAATTCGGTGGAATTGGAGGACAGGAATGGGCAGGGGAAGGCGGAGATCTGAACCTCTGCCACAGGGGCAGGAGAGTGTAGGCACCACGAGCGCGAAGGCTGAGGTGAAGTTAGAAGTTGACGGTGGTGGTGGTGTAGGCGCCTTTGGCTTGCAGGAAGCTCCGGTGTTTTATCCCACTGACGAGGAATTTCAGCATCCATTACGTTACATTGCTCAAATTCGTCCACTCGCCGAAGCCTATGGTATATGCCGCATTGTTCCGCCGAATTCGTGGAATCCTCCGCTCGGGCTTGATACTGTGAAGTTTACATTCCCCACCAAACTCCAGGCTATCCATCAATTACAGGAGAGGCCTGCAGCGTGCGATGCCGACACTTTCAAGCTGGAATATGGCAGGTTTTTGCGGAAACAGGGGGAAATTCTGGAAAGCTGGCCCATGTGGGATGGAGAGGAACTTGACTTGTGCAAATTTTATAACTCCGTGAAGCGACACGGTGGTTATGACAAAGTCACTTCCGAGAACAAGTGGGGGGAGGTTGTACGTCTGGTACAGTCTGACGATACAGGAGCAGCCAATTCCAGCTCTCAAACTCCGACCGTGCGCCAGCTGCACGAGAAACTCCTTCGCGAGCTTTATGAGAAGCATTTGCACACTTTCGAGGTTTACCAGACCAAGGTTGGTTCTGGCAAGCGGTGGCGTGTTGCCAGGAAGCAGGAGACTCCCGGCAAGCAGGTTGTGAAGCCTAAGAAAGGAGTTAGGAGACGTCAGGCAAGTGCTGACGTAGATCTCGATGAATTTCTGGAGCCGAAGAAAAGTGACAACGATTTGGATGCCGATGGCGAGCTCGTGGCAGCGGATGTCGAGAGTCGGCTTACCGGAAAGCGGACTACCAGGGGTCGTCCTCGAGCAGCAGGAGCCTCAGACGACGCAGCATGTGATAACAAGAAGCGTCAGCCTGTTGAGACCGATGCAGGTGGCGAAGGCTCTCGTTCTGTCGGGGAGGTTGATCATCGGTCTCCAGCAAATCCTTCCTCTTCGCGGAAGCGAAGGAAGATGGAGAAGTTTCCAGTTCCAGAGGTTGGGGGTCGGAATGACCAAATCTGTGAGCAATGCCACAGTGGAGCACATGCTCAGTTGATGTTGCTATGTGATCGATGTGACCGAGGTTGGCATTTGTACTGCCTTTCACCTCCTCTATCTTCAGTCCCAGTGGGCAACTGGTACTGTCTCGATTGCATCGGTTCTGAAAGTGAGAGTTTCGGCTTCGGCCAGGGCCAAGAATACTCCTTCGATTCCTTCCGTCGGATGGCTGACCGTTTTAAGCGCAAGTGGTTTGGAACTAGACCCTCGACGTATGCTGACATCGAGAAGGAGTTTTGGCGTGTGGTTGAAAGAGGTACGGGGCCTGTGGAGGTTCTGTATGGCAGCGATCTTGATACTGGGAAGTATGGTAGCGGTTTTCCTAGGGCTTCGGACCCTGTGCCACCATGGTCTAACGCCGAAGCGTGGGACGCTGGTGCAAACAGTCCGTGGAACGTCAATAATTTCCCCAAGCTTGAGGGTTCTGTCCTGCGGCTTGTGCATGAAAACATACCTGGTGTGATGGTTCCTTGGCTTTACATCGGGATGCTATTTTCTTCCTTTTGCTGGCACTACGAGGACCATTGCTTCTACTCCGTCAACTACCTGCACTGGTTAGTTACGTATACCTGTAGGTTCTGCGTATTGGTTTTATTTTTGTCCATTGTCAAGTGAGTTCTTGATTGTTTGTTCCAGTCTATTTGTTCACTTCACTACTGCCGCAAATTGGATGCGTTTTCTGTTCAAAGATCTGTGTAGGAAAGACTCGGATCTTCTAGGTTTCGTTCTTCCAAGTCGTAAGCGTGCTCGATGTTTGACGCGGCCGCCTTAATGCTTTTCTGCGATGGCTAGGAGGAATTGTGGGAAGGCTTCTAGCCTCTCTACATCCCTCCTTATGTGTCAGTCTGACGCGGGTGTCTCGCTCCTGTTCTTTCCTGATGCAATCGTTTCAAGTTTACGAGAAAATACTTCGCTTCCAGTGTTTATTAATCTCGGACGCCTTTGATGTTGACAGCGGAGAGCCGAAATCTTGGTACAGCGTCCCAGGCCATGCCTCGGATGCATTCGAAAAGGTACGTCTAGGCAGATATTAATTTAGTGGAAAACGTTCGCTTGCAGTTGCCATTCCGTGCCTTTGGTGAATGTTCTTACTACCCCCGGGTATAGTGTGCCTATATCATTCGTAGCAGTGGCTGGACAAATCGGGGCCGTTTGAACTCTGATGATCGAGTCTTAGGGTGCATGTCGTAACGGGGCTTGGCCGTGACACTTGGTGATGTTTTTCGTTGTCCAGGTCATGCAAAAAGCTTTTCCTGACCTCTTCGAAGCGCAGCCAGATCTCCTTTTCCAGCTTGTTACGATGTTGAACCCGACAGTCCTGCGCGACAACGGTGTTCCTGTGTGTACCACAGTACAGGTTTGCAACTACTGCCAGTCTTATCAGACCCACGAAATTGATTACTTTGTGATATCGCGCAGCGGCAATTCTTCCAAGTAAGAGCGGTGATTGCTACATCGAACAGTAGGTCTTAAGGAAGTGAAAATGTCTTATACTGGCCTATGTCAAGGAGATCAATTTTGGCGCGTATTAGCTAGGGTATGCCTGTTTTGCACTGTTATTATTCGACATAGAGATGCACTGAGTAACTGTTTCGCGTTTGGAATGTCAGGAACCTCACAATTTCGTGATAACGTTTCCAAGATCGTATCATGGTGGTTTTAATCATGGTAAATTGCACCAAACTTATTGATTTGACTGATTTCAACATTCTCACTCGAGTGAATATCTGTAGTCATTTTGTATGAGTATTTTGATGATTCTACCGTTTATTGGTTTCATCTTATGCGTCGTTTCGAGCTGTAATTATATCTCTGTTACTCTCTGAGTTCTTCGTTATTCATGGGGACGTGTTGTAGATACATATTTTTGGTTAAGATTTATATTCAAGCTGACTGGTATCGATTACGTAGTTGTGGGGCCTTCAACAATTGACCTTCGTTTACTGTAGACATTGAAGGGGTGTTCACGAGTCTTTAGCTTGCAGAGGCCACCAGCTGCAAAACCAGAAGTTTTCGTCTTATGTTCGGTCTTATGTTCGGTCTTCTTGAACTACAGGCTGGAAAGTGCAAGAAGTATTAGTTTTAGTCTGACAACATCACTTTTGAACATGTGTCTTCTTGAAATTACAATCAATGGAAATTCACGCATGCAAATTGCTTCACTCTTGAGAGTATTTTTCGAGATTGGGATCGTGAAAGACAGCAATTTTCAACTTTACAGCTGGTTTTAATCTTAGAGGGCTTTTTGTAGATAATTAGGAACTGTGTCCAGCATTAATTTATCTTGGTACGCATGACCTCATTTGATATTAAGGGCTACTAGAGGTTATGGTCAACTTTTCTTGAGAGTTTGTGGTCTGTTTTATCTTCTGGGGACAAGTAGTCATCTGGGGTCGTCTGATATGTATGATCATTTTTTTTTGTCAACTTTAAACGAAAGTACTGTCGCATACGCGTCCGGTCGGGTATAGTCTTACGCTCAGTCATTATGGTGATCTGTCGTATCCAGGATTCAACTGTGCAGAGGCGGTAAATTTTGCTCCCACAGATTGGCTGCCTTTTGGTGGCTTCGGTGTGGAACGCTATCGACTTTACCATAAACCTGCAGTATTGTCCCATGATGAGTTGCTTTGTGTCGTCGCAAAGGTTCTCACTCATCCATTTTTGTGCAGTTTTCTTGTTTTAGCGACAAGCTAAAGTTTGAATAATTTTGTATAGAACGAGACTTAGGTAACTGCTTATTTTAAGTAGGAACAATTGTGATTTGACTTATCTCTCTTTTATATATTTTAATGGAATGCATTGTTTCAACAAAATCGAAGCTGATACAGCACTGCTAACCAGACAATCATGCAGTTGCTCTGAACTTATTATTTCCGTTTCATTTGAACCAATAGAACGATGAAAGCTGTGGAAAATCGCCGTGGTTGCAACAAGAGCTTGTGCGAGTTATTGCCAAGGAACGGCATCAAAGAGAGTTTCTCTGGAGTATGGGGATGGTCAAAAGCTCACGGATGACACCCCGTGATTGTCAGGACTTCATCGGTGCCGAGGAAGTAAGCTCACTCTGTTCTATGTATAGGTGAACGATGTGGCGACGGGATGCCTGTTAGATTGGTAACATGACTGAGGATGATATACCTCATTACTAGGCATGACCATCATACCTTGTACCCCTGCTAATATCTGCTCTTGGCCTAATATTGTATTGACTCCACTCACTTCTTGCACAGGACGCTGAATGTATAATTTGCCGGTATTATCTGCACTTGTCTTCAGTGGTCTGCCGTTGCCGGCCCGGAAAGGCCGTGTGCTTGCAGGTGATCTTCCCTCGCCGATTTGCTAGCTCGCACAGCATGTTGGTATCTGTTTCTTAGACTTTAATGCATGCTTGAGTTGACTCTACTGGCACCCTTGTGACGTGCCACCTAAACTTGATATGCTTTGGTCCTCTTGCATGCTAATCCCCTGCGGTTGTCCATGTACTATGTTATCTAAATCTTAAACTGTGTTCCTGGCATGTAGCATGCAAGGCAGCTTTGTGAGTGCAGTGCGGATCAACAATGTCTCCAGTATCGCTTTTCTCTCGCAGAGCTGGATGACCTACTTTCCCATGAGGACCAATCGTCGGAGGATTCCAAGGTTGGAGATCTAGCTGCAGTACCTAGCATTACTAAACGCAGGTTGCGTCGTGGGCAGTATGGAGCGTCTTCCTTAACCAGTCCGTTAATGAAAAAGGTGCTGATTTGATTGGCTTGTCGCAACGAGGGAGATGATGAGGCTTTCATGATTTGACGATATAGTTAGCGGTTATTATGTTGCGCCATCGGTATTTTGTTATCATACGGTTTATGAAGATGGTCGCATGTTAGATTAGAGCTTGTTCGGAGTAAAGATCCTTACGGTGTCATCTGTCGCTTTCATGTTCAAGATTATGCTTCATGTACATATTGACTTTCAGCTATAAGACTCTCTTTATCAAAAATTCTTCATTGCAGGTAAAAGGGCGTCATTACAAGCATGCCGAGCTTGCTGAAGCGTGGCTAAGTCAAGCACGTGCCGCAGGTCGAAGCCATTCACGGTCTCCTGTGTTGGAAGAATTGCTCAGTCAATCTGAGCAGTTTCTGTGGGGAGGACATGAAATGGATCAGGTATGTGCTTGGCTCTTCTAGGTTTTCATTTCTCTAAACACTGGAAGTACCTAAGGGGATTCTATATGGGCAATATTATGGGTAACCTATTTTTGACTATTCCAGCTAAGAAGCACTATGAAGTAGGTCAGATATTAACAATACATGTCGTGGACCAGGTAAGAACGATGGTGGAGCAGCTTACAGTTGCACACAAATGGGTGCAAGATGTTGCAGCTTGCTCGACAATTGTGGACAGACATTCAATGGCTAGTAGCGGAAAGGCAGTCAAGGTTCCTCTGGCAACAATTCAACAGCTCGTAGCTGTCGATCCCATTCCGTGGGTGGAGCCTCATTCTTTCAAACTGAAGGTCAGTCGTTGTCGTCAAGGCGGGAATGTACAGTTCATGCCTGTAAAATTTTTACGAGTCTGGTTTAACACAGTATTTTTGTTAATTTTCAGGCATTATTGGAGCCTGCCTGCAGTCTTCAACAGAAGATTATAGATGCCCTTACTGCTTCGTCTCCACTAGAGGTAAATCTACGACAAATTGTACTTTCCTCAGTTACGTTTTGTGAGACTAATTGAAGCTGAGACTGCATGTGCTATGTCAGATCTGCTTTCGTGTTCCTTGATGCGAAATTACTGGCTGAAACAGATCAAAGCTTTACAATCGCTCCAGCAAGAAGCTGGCCACTCGCCTTTCGAACTTCCAGAGTGCCAGCAGCTCAAGGATGTCATTACACTAGCTCAGGTGAGATCTAGAGTGAACCTCTTGTACGAAGACTCGAACAAGTTCTTTTCTCATGTAAATGCCACACAAGCTCTGCTGCCATCTGCTTTTATTGAAGGCCATAGTATGGGACATTTGCAGGCTTGGAGTGAACGGGTGAAAAAATTGTTACCTACGTGTGCAAAGTCTCTACGTAACCGCGTTCGCAATGAGTGGGCAGATTTGCAGCAATTCAAGGCCTTGCATGAAGAGGTTGGTTTTTGCCCGTCTAAGACTGGAGTCTTCGTTCTCTCATTTGTTAGTCGGTCACGAAAAAAATTGAAGTTTTAGATTCTTGATTGGTCTTACCCACCGAATAGTATTCAAACACTAGTGGAATGTGCAAACTGGTCTGGACACAGGGTTCGAAGATACCTGTGATGGTAGGCGAAAAGAAGTCGTTGGAGACTATCATCAATTTAACCGAAGCTTGGCAGGAGCGTGCATCTTCATTACTTATCTCCTCCACTTTCCAGGTCAGATCGCTGTTAGCAATTGGAACGTGTACCCTTTCGCTGTGTGTAGGTAAACAAGGATGTAGTTGAGTGGCAGATGCTTTTGGACATCCTGCATTTTTGTAGGGGTCGGGAACTTTCGTGTTGGGAAGCTATAATTTCGCCTGTACATGTTCTCTCGTCTTTTGCGCCTTCACATTGATCTGTTCGTCGCTGCGGAATAGAACTTGGTACAATTCGAAGCTTCTCTGATAAGTGGAGTGTGTCGTAAAAGTACTCATGTACTCCTAGTCCAAGATTTTGAGGTTGGTGGATTGTTTTTTGTATAATAGGAACTAGTTGAAGCACTGAAGGACAGCGAGGCGATACCAGTCCGTTTGATGGAAGTGGACCTGATAGAAGAGAGGTTACAGAAAGCCCGAATTTGGATTCAGGATACAGCAGCTGTTTTGACCCTGTGTCGAGATCCGGTAGACTATGCTGAGGTGACCAGACTTTTGGAGAATCTTCTGCAGGCAGGGCAAAAGCTCAAAGTCAATGGTAATTTGGTTTAGAATATTTGAAGTACATAAGCCTTCCAACTGAATTTCTTGTATTAATTTTGTGCCGTTTTTGAACAGTTTTTTTCGTCTTGCAAAACTGTTCTTAGAGTCACCATGTGGATCCTATTTTTGTTATCATGGACATTCCTGTTGTCTTCATACTTCATGCTCTGGTTTACAGGCATATCAGAAATGGATACGCTACTGGTCGAGCTAGACAAAATACGTTGGATGCAAAACTCTTCTCAGGTACATTCAACCAGTCTTGTATTGCCCCTCGTGTTGCTTATCAATCTCAGTACTTCTATACATCATATCGGACAGTTGATGTTCTGCAGGGAATGAGTAGAGATGCAATTCATTATCCGACCAAGTCTCGGCCTTTGCTTTGACACTTGCCTGAGGATTTCTGGATGCAATTGATGGATTTATCATCTGACCAACTTCTCCCTTTTTTCTCGTGTCTAAACTTATCAAACCCACACATTCACACCTAAGATTCCAAAAGAAGTAAATGCCTGTTTTCGTATAATCTAATTGTTTTGAAAATTTATGGATTGATGTTTCACCGTACTTTTTGTATTCAGTTTTAGCTATTTTCTGCACCATATAATCCACCAAGTCTCGGTATTTGCGTTGAGTATAGTCTCAGAATTTCCATAGTATCCATAGGCTTCATTATTACACATCCCTCTTCTAGGATACCTTGATGATAGCAGTTTACAGTTCTCTTTCACTTTCTAGATTGACTGTAGCCTCTGGACTTTCACTTCAGTATCCTTAGGATCCAGGCTTGTGCATCTCTTTCTGGATACGTTCGTGGTACATTGTAACAATTATCCACATCCACGTTTGCTGTAACGTCATCTTTACTCGACTTGCGCGTGCTCTGAAATACGGTCAACCAGCTTCGCCCTTCATGACAGTGATTGTTTTCAGGCTGCATTCAAGTCGTACACGCGTTTGCAATGATAATTGTTCTCATAGTTTGCTAAGCTGCTAGCCCAAGCGGAACTTTCCTGTACTATAGCCTCTGGATATCTATTTAGTGTCCATAGAATGCAAGCTTGCACATCTCTTCCTGGGCATCTTCATGGTACCCTGTTAACACTTCCCTCTCACCTTCTTAGTTACCTTTTCCTTACTTTCATCTTTGCTTCATCGTCATGTGGACTGGACTCGCGTTTGCTCTCGCCTACGTTCTACCAGCATCGGACTGGACTGCATGACCGTTTTCTTCAAGCGGCATTATAGTAGGTTACAGTATGTCTATTTCGGCATGTGAAGTATTTTGATCCTAATCATGTTACGAAGGTGCAGGTTGCCACGGAACTTCACTGTATTGAGTACCGCCGCTTTATCGCTGCTCGTATTGATTACTCGTACTCGGTCTTTGCTACATTGTTATATCATGAGAATAAAATTCATGCAGATAGTGATGCCCGTCACTTGCTGCCACGAACAGCGCATAGCTGTTCTTCTAGACCTCCCACAGCAGTATGAACTATTGGGTCTCACCAATGATATTTTACTCGTCTCGAGTTTTGCAGCTGCTAAAACAGAGACCAACAGTTGACTCTCTCAAAGCTCTTGCCGCAGATATCGAAAGGTGTGTTACGTAAAAGTTATGCATCCATGTCAATTACGATCTAAACATGGAACTTTATTTTGACCCAGCTCAACTGGCCTTATTTTTGGTCCTGTTGTGAACACTCATGTCACATTTTTTTGCATGCCTGGCATATACTTCGTTTGGATGCCTGTATTTTTACACTTCTTGTTCAGGTGTCCGTTTCTGAGCAAGTTGTCCATAATTGCTGCAATTTTGATACAACTATTTATATCACATCATGTTTTGATCACCTTTTTCTTGACATGTACAATTTGTGTTTCCCTTAAGCTGTTTACGTAAACTAGACTTGTCTTGGAATGCTTATGCTGCTTGAACTGCTGTACATCACAGACAATTCTGATTCCCTTCGTTAAGCGTTCCCTTGGCTTTTGCTTGATTGTATCCACTCCTGTCTATGGTGTTAAGCATTCACTACCAATCACGTTCGTTCTTTGCAGCTAACTTTCATTTCATTTCTTGAGCGTACCTTTTAAATTCATGATGCCCCTCCCACTGCTTGCATTGAGTACTTGTACTCGGTCTTGCTAAACGTATATAACCAATCATGTCGTTTATGATCTACGCAGACTGCAAGTATCTGATGGGAGTTTAGTGCGTCAAATTCGTTCCACTCTGTCGGATGCGTTGGCATGGGAAAGCGAAGCAGAAAAGTTGTTACATTCCGGTGGATCACTCTTCCAATTTGTTGATCTTGCCAGGTACGTGTGAAATGATATTGTACAGTTCCTCATCGTTGACAGTCACTTAGGAGTTTTCACTGTCACAGGGGGAAAGTCTATTTTCTGCTTGTGTATTAATATGCAAGTAAATCTCAAATATCCCTACTGTCGAGCCTCTATACGGTGGTGTTGCGGATTTGATCTTCCTTGAGTAGGACATGTGTCCATCGATCGCTACCACTGTAGGACGGTGGTGAAGTTACACATTTTTTTGATATTTAGAGGTCAATTTAGTAATTGCCTTATATTTGACCTTTCTTTTCAATTCTTTTTCCACATCTGGAAAGTTCTCAAAGACCTGTTCTTGCCCCTTCTCGGAACCATTCTCGGATGTTGTAAACGACCCGCTCTCACATCGTTGAAATTAATTTCTACAGTATATTTTCTTTTCCCATTTGCACCTAGTATTGATGCTATGACAGGCACATATTAGAATTACGGAATGCGCACCTAGCCTTGTAATAAAGGTTCTGACCTTTGTCTGTTTTGAGAGTTCATTTAGCCTCAGAATTTAAACTACGATAATCTCTTTGGTACCTTGCATGTTACATGAGCGGTTGATCATGTACTGTGATATCTATTGTATTATAATTTTTTTATGTCCATGGTTGAGGAATGTTCTAACCATAAGTACTGGCGGGTCACAGCGCTGCAGGATGTTTAAACGTTCGATTATCAGCCTTGGATCTTGTGGAAAAAGCTTTAGCAGATGCCGATACCTGGCTCGATCGGGCAAAACCGTTTTGTTCTACTTTTCTCCAGTGCGAGGAAGATCAATCTTCTTCTCTTGATCTGGCCACCCTTGCAGTAAGTCCTTTCTGATGTTCAATGTGCAAATTGGACGTATCGAAAGTTTTCAAACCTGAAGTGTGGTGGAATGAGCTACTTATGATGGACACATGTTTTTTGAATGAAAATACGAATGATTTTTTCAATTGGAAACTCCTTCGATGATACTTAAATTTCTTTGATGATGTATAACGTTTTTTTCGAGCATCTTACATTATATTGTTTACATTATATTGTCAGGGAGTGGTCGACGATGCAAACAAACTCTTAGTGAGTTTGGATGAAGTGAGTGTACTGTCAACAGCTCTCAATTCTGCACAAGAATGGGTTGTAGAGGCAACAAAGTTGAAAAGTTCAGTTTTGGTTAGTGAAGGTAGAGAAGATTCGAGCGGGTTTACTTCCACCGTCACATCAGGAGAGTGCAAGACATTGCAGCCAAATAGCTCAGAATTCACTATTACGACAGTCGGTCAAGAAATGAAGAGCAGGCTGCAAGAAGACTTGTTAGCACTGGAAACAGCCGTAGCTCGTGGTCTGTCATTCGGCCTCCAAATTCCAGAAATTCTGGAGCTGCAAGGTCTTCGTGATGCCACCAATTGGAGTTTGAAAGCTCTTAAGCTAGCCGAGTGTTGCCCGACAGTGAAGGTAAGTCATGTGTGGTGTTTATCGAAACTCCTCCTTCATTAACTAGCTTCATTGAGGCCCAACTTTCAATAGAACTATTGCTCCTCCAGTTGGAGTTGGACCCGGCGGCTAACGCACATGTTTATTGATTCTTTCATACCAGGTATGTGCCAGTGATCATGCATGGTTTTGTTTTAAGGTTGCCACCTTTCTTTGTTGTTGATGCCAGGTAAAGTTGAAATTGAATTGGTTTTGTTTTGTTTAACTTTGTTTTAGGAGGTGGAAAGGCACTTGGCCGAGGCTGCGAGCTTACCCGTGAAGGTGTCTCAAGTATCTTTACTTCATAAGATTCTTCATGATGCCAAGTCATGGCTCCAAGCTGCAGCCACATTTCTACCTGGCATTGGCGTGAAAGGTAGCTGCACTGAAGAGCAGTTGGAACAGCTGATTTCTGATGCTAAGGTAATGTGCTTTGACGCTGTACCTGTTTTGGATTATTTATTGTTTTTTTTAACAATATGACGAATTTTATTATATTATGAATTAGATGACATTTGCTTCAACTAAGTTACGCTCATGGTTTGTGCTACAGAACTTGAACGTTGGCCGTTTTCTTGTAAGATATTGGTATTACTTACAACCTAATTACACCTACATTGTCGATGTTACAGAATTTGCCCGTGTCTGTGGTGTCAGAGGCAGGGTGTTTGTTAGACATACTGGCTTCACACAGGTTTGTACTTTCTACTTCTAAAGCATGAGGTTTCAGATGTGCCTAGCTCTTTCCAGCTGTCGAAGTCCTCAAATTCTCACGATCATGTGTACTCGAAAGCATACGCAGTCTGAATTCAAGTAGTCAAATGCTTCATTTTTGGAAGAAACAGCTCTGCTAGTCAAGGCATGTAAAACACGCTATGGAAAGGTCTCCTGATTAGCACTTTCACCTTTGACGAGAAGCCAACGAAATTTCCCGCTCTAAAATCGACCATCTTCACTCGCGAGAAGTCTTCTCTTCTTCGCATCCTCCTTGTCTCCTACTCTCTCCTCGTCGTTTACTTAAGAAAATTTTTCATACTAGCACCGCTTTCTGCGTGCGTAATTTCTGTCCTCAGGCTATTACACGCACATGTTACCAGCAGTCAGTTTGTTATGACTTGATTTGTCTATGTTTTGGTTGTAGGACATGGAAGAGGAAGGTTCAACAAGCTTTGGCTGGCACTTCATGTTTGACGTGGAGGGACCTTTCCGACCTTCAGGTTAGTTCTTCATACCATATAACGAGTTTTCAAGTATTCAGATTGTTTCACCTTAAAGATGTTTACAATCAAGACGTTTAGGACTGTAAGCACAACCAAGGATCCTCATCTCCTTGTCCTCAGTCTGCGGAAAGGCAGCCATGCCAAGGGCGAAAGTGTTATTGAGGTAGCTGTTTTACAATGGAAATAGGCTGTTGGAGACGCGTCTACTTTAGAATAGGATACAGTATGTTTGGAGTTGCTTGTAGTAATACGTGAGGGTGTCCCGCTCATTAAATAGTTCTTATCTGACCTCCCTCTGCTGAAAAGCTCCTATCGGTTGTTTAAACCCGCATCCTTGAACAATCACACTTATTGTATCAGATAAAAATGAGGAAGAGAGAAGTAAGTAGGTAGCAAGTAGGAGTGTTAGAATATAGATTACTCTCCATTACATCGGACTTGTACATTATTGTCCTAGTTGTTAGGATTGAGATTACTAGTACTTAGGATGGATAACAACTGGGGAGATTCAATGGGATGCAACCCATTCAAGGGTTGCATCCCTTGAATGGGTGCGTCCCATGACAGGGGTATGTCCCACTGTCAGGGGCATATCCCTCCTGGGAGGTGCGATCCGTGTGCTTCTTTCAGGTATCACAGAGATGGTTTATAGCGAGAAGCTTCCTCCTGGATTTCTGGATTCAAGCGTCCTTGAATCAGAATGGAACCTGCTCTGATACCATATTAGATCATATTAGCAAGTGAGAGTGAGAGATCACGCACAGTTGAGGAAGGGTTGAAATTTGATTGATGGATGAACACAGGTGTCCCGGATTTGGTTAAGTACCCAATCCGGATATGACCAAAGACTGAAAGAGGCACACGGATCGCACTTCCCAGGAGGGATATGCCCCTGACAGTGGGACACACCCCTGTCATGGACGCAACCATTCAAGGGTCGCATCCCCAGTTGTTATCCATCCTAAGTACTAGTAATCTCAGTTCTAACAACTAGGACAGTAATGTACAAGTCCGAAGTAATAGGGAGTAATCTGTATTCTAACATTTTGTTGACCCAACAACCTGCTCATGGACCTAGCCCTGTTCTATACACGCACGGATATCCCTAACCTGTACACACTCGGATATCAGAAAATACATTTCCGCAGTCCAGTGTATTTGGCTGGACACCGTGTCGGACCTCCGAGTACGTATTCTTAAGTAGCTGCTCTACAATGCGAATAGGCTGCTGGAGACGCTTTGATTAGATAGAAATATACTGCCAATATGCTACGTGATCAGATCAGCCATTTCCTGCTTGGTGTCGCCCACCTTGTATTGCCATGTGTCATCGGAAATCTATTTATACATACCATCCGCTTCCATGCACTTACTAACAATTTCAAGTGGTTCTTTCGAACAAAGTAGACTGACTGATTACGATCTTATATCAGACTTCTATGTATGTGACCACATTAGAGAAGATTATTACTCATTGTATAGTTTGGTTGGTAGTTCATCCTTCGTTTTGGCTTGCCATATTCAAGCGTTAAAGAAGTTTATTTGAAGTGTTAATGCACGACGAACGTGTAAGATATTTGTTTCCCTCCGGGTGCTTTCTCTGCAGGTAGCTGGAGAAACAAATATGGTACAGAATGACGAAGAGGGTTTACTGAACCAGGAAGCCGTCAATGTCGGGTCATGGGTGTTGAAGTGCTACGAAGCTATCATTTGTCAACCTTCAACTACATCCTATACTCTTGAAGAGCTTTTGGTGAAGGTAAACATCCATGTTGACAAATGGATGAAGGCAGTGGTTGGCTCAATCATGTTGAGAGATTTTGTTCATTCACTTTCTGTTTGATGAACTTGCTTTTGACATGAGACATAATCAGCTTTTAAACTGGAGTTTTTCTACGTCATGAAGCAAAACAGCCACTGACATTACACGGTTGGTTGCAGATGCGAGAGTCTGTAGAGTACGGCATACAACAATTGGAGTCCGAGGAGAGAAAGACCAAAATGGAGTCTTTATGCATTTGTCGACGAGTTGTAGAAAAGGCCGACACCAGCGTGCTTTCCTGTGACAGTTGTCAGGAACGGTACGTTGCTTGAAAGCTTACTAGTCTACTATATACCGGTTGCATCCGAAGTAGTTATGTGTTCGACAATATCTTGCTTCCGATACTTGGATCCATATATGTTCACCAGAGCTTGACAGAAACTTCGCCTCACCGTTTGGCTTTTTACTCTTTTAAGCATTACTTTCTTGTATCTTCCAGTTTCTCCGATACGGGAATTTTCTGTTAAATTGTTTCAAGGTTTTTGGTTAAGAAAATCTTTCTTAGGACTCTAACCAGGATCAGGATCTTAACGTATAAACAGGTATCATGCTTCCTGTTTGGGCGTAACATCCGCTCAAACAAGAGGACAGAAACAGAATATGTGTACTTTCTGCAGCGTATTATCAAGTGGCGCTTTGACGTTACATGAAGACCTTTCTACCAAGGTGAACTTCCAGTTAATTGCAAGAGATGCTTGATATAAATGGCATGAAGTAACTTTCCTTTACCACGTACGGATGGTAATGAACCTTTACGTGCTTGTAGGTTCATCTTACCCGGCGTCCGAAACTGAAAACGCTTTTGGAGCTTCAGCGGTTTGCTAGAGACCAGCAGTGCAGGTAATTATTTACACGCACATGAATGTATGCCCCTTTTTCTGTGCCATCTGTTTTGTGTATGAGTATGTTATTTCCAGTCTATGACGGGTTAGAGTTAAGCACAATTTTTGCTTGGAAATCTGAACTACTTTTAGCTCAGTTCCCGTTTATATCAGATTGATAGCTGTACTCTATGCATGGTTAGATTGTGTGCGCCACCGACATCTTTAACTTTGTCATATATACTTCTCTTTGATGATGATCTCCCTGTGCAGGATGAGGGAGAAGGAACTGCTCGATGTCTTGGTGAAGTTGGTACAGTTGTGGCAAAAAAAGTTATTAGTCATAGTCGAGCGAGCTTTGGTTTGTCGGGAGGAGAAAATGGCCGTCAGTCACAGCTCGCTAGTGGGCCTTTTGAAGGTCAATAGCCATTTTCTTTCTTAACTTGTTCACTGCCTACGACAAGAAGCTTCGGGGATGCAGTTCTTGTTTTCTGCTCTTGAAATATATCACTGTACGACAGTCAAAACAGTACTCCAAAGTCTATGTACTCGTTTTTAGCCTGACAATTTATCCTCTGTTTCTCATGGATGCCCTCGCCGACACCCTTGGTACTTTCTTGAACTAACTCCCCCGCAAAGCATAAAATTTGGAAACACTTCTGATAGTAGAAGGTTTTGTTGCAGGCCCTGGAAGTTATGGAGGTGGAAGCCGAAGAGATTATTTTGATGAAGAAAGCCATAGCTGCCAGTGCCTGGCGGAGCCGAAGTACAAAACTGCTAACTGGGACCTCCAAACCTATCCTTCGTCCTATAACGCGTGCCATCAAAGAAGTACGGTCCATCATCAGATTGAGTTGATGTTTTTTCAAGCACCTTTTCCTTAACAGTCATGAGGATATGCTAGTCGATGGTCAGTTGTATCATATCTGTGGCTTTCCAGATTTCGTAATCAAGAACTTCCTGTGTTCACTGGGTTTGTATAAACAATTTTTGCTTTTTTATATTTAATCTATCTAAACAAAACCAGGATAATCAAGAGCATTGAAGTTTATTCTATTTTTTGGTCAAAACCTCCCCGTGCGCCAGAAAGCTTTTTCCACTTTGCTTTTAGAGCAACCTTAGTCAAGGTTTACATTCCTATCCGGGTAAATTCTAGTATTTTTCTGTTTAATATTTTACCCTTGCAGTCAAATTGGTTCAAAGTTCAGTTGGATATACTACTGACTCATTCTTCTATCCTGTTTCGTCGCTCCAGGCTCACGCCCTATCAATATCTGGAGAGGACTGTGTTCTACAGGAGCTGAAGCAGAGAGAAGGATGCGCAATTCAGTGGGCAACACGTGCCAAACAGGTCCCGTCCAGTCCATCAGACCATTAAGTCGATTGTGTAACCATTATGCTCGTTCATCGCGGAAAACAAGAAAGCCTGAAATGAGCGTACAGAATGGCTGAAACATTCGAGTGAGGGGGAGGAGAAGATTTGGGAACCCTTGTGATGGATGGTTTTTTTGTTGACTTCTTGACAAGGATATCAACTAGCGGATTTATACTTGTCTTTTCATTCCATCATTCCAGTTCCTTTAACAATCGCTTCTTCCACATATTATTATTATCTTTCTTTCATCCCGATCCTTTTTTCCCCAAATACTCCCTAATACAATTACTCTCATCTTTCTACAGATAACCCTCCGCCTTCATACCATAGAAATTTTGATTGACGTGTTGTTCTACTTTCGGATTCATCATGTGCGCATGCTAGTCAGCTGGGTTGGAAGGTAGAGGATGTAAATGAATGAACTGAGCCATCTAACAGCTTGGGTGGAGTTTGCTATGGCTACTCATGTTTAATATCTCACTAGAAAACAAGCAGGTGCTCATCATTGGACGACTGCGTAGTGAATGCATTGAAAATACACGCTTTACATGTCCATTTGTGCTTAAACATCGTTGCACTCAGTCGACAATTTGTCAGTAAGTGTTTTTTAGGCCTTAGATCGTCCCTTTCACTCAATTGTCCCTTATCTCTATAGATGTTACAAATTCGACGGCCCTTGCTTATACGTCGATTAATATTCTGCAATTGCCATATCTGTTTATGAGACGTTATGAGCAATCTTAGTTCTGCAATATCAATTCTTGGCCATCTCTATCCTGTTTGTAGATATTCATCCCCAGTGTGGAAATCTTTTATCTCTTCAATTTTTTTTCTTCAGTGGTGGAACAGCCCTCTTATGCTATAAACTACTTTGCATAATTTACTGAATACACGTGTAGCCTGTTGAGCTGAACTCAGAGCCTGTTGGTTAAATGTTTAAACATGTATAGAGGTCAAACTATGACGTGCTCAAGTAATATTTAGCTTAGCTTTCCGTTCCTCCCCTCGCATTAACTTTTGAGGGGTGAATCCTACACTAGTTCGAGAAACACATCTACTCGGGTTAGAGCCTAAGCTAGTGCTGCTTTCGGTTACTGGACTTTCACCATCTAGGGTGCAGGACTCAACTGCTTCGCCTAGCAACACAACACTTATTTAGCTCCCCCACAACCCCGTTTTCACGGTTTAGGCTGTTCCCATTTCGCTCGCCGCTACTACGAGAATCGCTTTTGCTTTCTTTTCCTCTGGCTACTAAGATGTTTCAGTTCGCCAGGTTGTCTCTTGTCTGCCTATGAATTCAGCAGCAGTTTCAAAGGTTAACCTATTCGGGAATCTCCGGATCTATACTTATTTTCAGCTCCCCGAAGCATTTCGTCGCTTGCTACGCCCTTCCTCGTCTCTGGGTGCCTAGGTATCCACCGTAAGCCCTTTTTCGTTTGAACCTCGCCATTAATTAAAGGCTATGCCATTATAAAGTGCTAAAAAAAAGATCTTATCAACGTCCATAAATAATAAGAAATTAGATCAACTTGGTTATAAAGATGAAAATTTTTTTTATTATATCCAAGGCAAGTATATTGTCTTCATTCCGATCATCAACTGGAGATAAGCGGACTCGAACCGCTGACATCCGCCACAGGGTAAGCCATCGTCTCTTAGACTTTATTGATTTATTTTACCATAGAGGCCTTTGATAGACAATAACTCCCCCCCAAACACAGCTTACAACTTTCATCGTACTGTGCTCTCCAAAGAGCTACTTAACTCAAAAGGCGTCGAATTGAAGAATGATAGGAACTTTTGTAATTTGAAAATATCTAACTACACAAGAATTTAAAATTCTTTTTTTTTCCACCTGACTAATTAGTCTTAATATTGAGTTGTTACCCTTCTCCGACCCTTCTTACCAATAAGAACAAAAGAGCTTAATCCGTTTGCCTTATTGAATTAAGTTTATGGTCGGTCTGTGACCCCTGGATGCCTTATTCGACATCCTTGGGGGCGATCTCGTAGTTCCTACGGGGTGGAAACGATGGGGTCAGTCCATGGCTTTTCGTTCCTTTTGCCACATTTGGCTTGAAGGGTTAAAGAGAGATAGTGCATCAAGCTGTTCGCAAGGGCCAACTTGATTCTCTTCCCCAGGGATTCTAGATGAGGTAACCCTAGGAGAGCCGCCGACTCCAACTATCGTCCATGTACGATCCATATTAGATCTAACCAACTACCCATCCTACCTTTTTTTTACTTTTAACAACTCATCTTTGTCTTAGTAAAACTTTTCAGTGGCATGTTCCAGTCCTCTTTCTCATTCCTAAGAAAAAGTTAGCCACCGGTTTAGGTAAGAGATACTATCATTACCGCCTAGACAATTAGGCATCCAACCCGTAAGCGCAACGACCCAATTGCAAGGGCGGCGCTCTACCAACTGAGCTATATCCCCTATACCCAGGCCAAAGAAAGCAAGGAAAGCATGCAAAAATAAATCATTATGCTTTTTTTATTTATCTTGGCGCAGCTGGGCTATCCTGGACTTGAACCAGAGACCTCGCCCGTGAAGTAAATCATCGCACCTACAATTTCAATAAAAAAAATCTATAAATTCTTTTTTTTTTAGGAACGATTCATCCTTCCCGAACGCAGCATACAACTTTCCGTTGTACTGCGCTCTCCAAGTGTATTTATTTTCTTGCCATTAACAAGTTTTTGGAAGAAAATTTTGATGAAAAGAGAAAAGAAAACATTAGAAAATCCACTCTCTTAACTCAACTAAACACTCTAAGATCCTTTTTCGAACCTGCATCCATCATTAAAGAATAGAGAAAAAAACATTTTGAAACAATTTAATATCCTTCTCTAATCCTAAACTAACCTAAAAAAAATATTGATTGCTGCTTTCTCCGAACCTCCAAGAAAAGCAGAAAAAGGCTCGAATAATATGATCCCTCCGTCACCCTAGAATAAAAATCTCTATAGGTGATCTCGTAGTTCTTGGTCTGTGAAGATGCGTTATTAGGTGCTCCATTTTTCACATCTAGGTTGAACTTCAACCTGTGCTCGAAAGATAGTCATCCATACACTGATAAGGCATGTATTGATTTTTTCGAGAAGAGAGGAGCTCAATGGGTCCTCCCTGGACCGCCCAGGATTCTAGATGAGGTAACCCTAGGAGAGCCGCCGACTCCAACTATCGTCCATGTACGATCCATATTAGATCTAACCAACTACCCATCCTACCTTTTTTTTACTTTTAACAACTCATCTTTGTCTTAGTAAAACTTTTCAGTGGCATGTTCCAGTCCTCTTTCTCATTCCTAAGAAAAAGTTAGCCACCGGTTTAGGTAAGAGATACTATCATTACCGCCTAGACAATTAGGCATCCAACCCGTAAGCGCAACGACCCAATTGCAAGGGCGGCGCTCTACCAACTGAGCTATATCCCCTATACCCAGGCCAAAGAAAGCAAGGAAAGCATGCAAAAATAAATCATTATGCTTTTTTTATTTATCTTGGCGCAGCTGGGCTATCCTGGACTTGAACCAGAGACCTCGCCCGTGAAGTAAATCATCGCACCTACAATTTCAATAAAAAAAATCTATAAATTCTTTTTTTTTTTAGGAACGATTCATCCTTCCCGAACGCAGCATACAACTTTCCGTTGTACTGCGCTCTCCAAGTGTATTTATTTTCTTGCCATTAACAAGTTTTTGGAAGAAAATTTTGATGAAAAGAGAAAAGAAAACATTAGAAAATCCACTCTCTTAACTCAACTAAACACTCTAAGATCCTTTTTCGAACCTGCATCCATCATTAAAGAATAGAGAAAGACGTGCCATCGATGGTCAGAACGTGAGTTCCAGTGCTCGTCGACCCTGGATTAGATGAGGTCTCAGTTTTTGGTAGGCTATGTTCATATATCTGTACTCTTAAGGTAATTACGCTCTTCCTCTGGTCAAGTGCTATCCAGGACTGCATCTCTCAGAGTTGAGCTAGTCAGTCATTGTGAATTTATTCAAGATGTACATAATTTTGAACACGGTAGTTACTGGACCTAGTATTACTGAACTGGTAGTTACTGAACACTGGTAGTTACCGTATCCTTGTATGTAGGCATTATAACGTTTTTTATAGCTACTTAGTGCGATTTATAAGATAAAGGTTATTAAATTGTACTGTCCATATACTAAACCTTTATTTCCACTCAAAGCCCACAAGGGCCGTATCGAGTACTTGTACTTAGCCTTACTATATGCACGTACTATTGTCTATGCGGTTTTCATTTTTCATGTCTCTTCGTCCCTGCAACGCAAGTACTACATTGCGTTCAAGCTAATGTCTCTTCTTGCTCAATAATGCATTCTGATGGGACTGTTACCACTGAAGCCTGTGCTGGGAATATGTCGAAGAAGATTATCTCCATTGGGTCATATGTTCCCCCTCTGTTTTGTCATCTTAATCGCTTAATCTTCCCAGTAAACTTTTAATCACAGTTTAGTGAAACATCCTTGGCCAAATGCACCTACACGCCCTCACGGTACAGGGTCTTTATGTTGCTAGGAAACTACCATATGACTCCCGAAGTTACTTCTAAAAGTAAAATGTGCCACTGAAAGGGAAATTGATAAGATATTGAGGCTTCAAGTCTCTATCAAGATTTGGAACGTAAAAACTTTACCACTTTAAGTTTAAGCCTCTATCGGAATTTGAAAGGCTCAGTTTTCGTGCAGATTATTTCTCGGGAAGGCTGGTGTAGAGCATATTTCTTTCTTTAGTTGAATTTTGAAATCAGTGAACTTTGCTTCTGCTTTAGGAATAAGCAATGACACTATGAAGTGTCTTAGTATGTCACACTCTAAACCGCACATATGTATCTCGAGTATTTGACATCTTGCTTGGTATCACGTTATGCCCTCACTCGAAATGTCGAAATCGTCATTAGGGGAGAAATATTAGAGCACTGGACTGATCTTCGTATGCAATATCACCTAAACATAGGTTGTCAACGATCACGGACGGATGCCTTTACCGGATGTTCTGGACCTTTATGCGGAAGGGGAGATGTTGCCAGTGTCGCTACCGAAGGAACTTGCGGTGAGCATGTCATAAAACTCGATTACGTTTCTGCTTAACCTAAGCATAAGATTGTATGCCAGAGAAGTAAATGTTAGCTTAAATTGTTGCCTAATTAGTTTTACTGTAATGCAGGTACCTAACTGAAGCATGTTTACCTTTCTAATGATACTAGCATAAGGTGCAAGTTCCTAGAGATACGTTAGACAATGTGATGAGGAGAAGAAGTTTGATGAACAATCATATATAAAGATGAGTCGTTTGTTAGAGAAGTGACAGTGATGTCTGCTCAGATAATTGCTTTGATGGTTGTGTAAGGCATGTACCAACGAATTGGATGTTGTTTTAATCAGGCACTGAAAGCCAGGAGTGTGCTTTATTGTCTTTGTCAAAAGCCGTATGATGAGGATCGAGCCATGATAGCATGCGATCGTTGCGGGGAATGGTATCATTTTAGTTGCATCAACCTTCCAGAACCTCCTAGTAGTGATGAAGATACGGACGATGTGATAAGGCAAGAGTGTGAGCAGTCTGGAGACTTTATCTGCCCGAAGTGCAAAGAGTTAGTGAACAAAAGGGATCCTCAAAAGGTGACGGGAGCAACAGGTTCCAAAACCTCATACAGGTTAGTAGATTTTTCTACCTGTTTAGGCATCCTGTTGCTCTGTTTGAAAATCTATGGGCGGACGAGTATTGCATGCACTTTTCGAGATCGGTGCTCTCAGTGATTTTTACACTGTTTGAAGGCATTTTCTCTCTTCATAGGAGGATTGTGTGGAAGAAGAATTTTGTCGACTTACACTATCATGTGTGCAGGAATCAAGCACTACCACAAGAAATTGAGAGCGGTCAGAAGACAGTTGAAGGTAACCCTTTGGGCAAACCATTTTATGGTCTTGTACGAGGAAAGAGGAGCCATCGAAGTAGTAGCAGGGCAAGAGGGGAAGTACCACATAAGTGGCAAAGTCCCCTATTCCAACCAGGTAAGTTACTATGGCACACACAGAGAAGAAGGAAACAGAATGAGCAACAACCTGAGGAGTGTGTAAGCGCAAGTGGAAGGCCTTGTCGTCGCACTGCAGGACGGCACAGCGGCTTTGAAAGCTTCATCTTGCTGATGCGGTCCCGATAGTTAGTCTTTAGAGCTGTAGAAATGAAAATTCTTTTGTTAAACTGGAATAAATTCTCAAGCATGGAGCAACGCGAGTTCATAGTTGTGTCGGTTTATGATTCTTGTTGATTTCACGTCTCTTCAGCTTTCGTTCAGTAGGTGAATGGCCTAACGTTCGTTCCAAATTTTGGATTGCATGTTTGAAGAGATTGAGAATCTAGTCTAGAATCCGATCCTTGGGGCCCATAGACATGCGCTGACTTATTTTCTCAAAGAAGAATACAGAGCCAGACCTTTTGTGTGCATAATAGATCTTTTCATCTTGACAATTTCCATCGGTATTGCCAATATGAGTTTGCCAATACCTTTGGATCCCGAA

mRNA

>Mapoly0030s0125.1
GGAAGGGGAAGGGGAGAGTGGAGGGGAGGGAGGGCGGACAGGAGACGACAGACGCCAGAGGAGAGAAAGCGAGCTTTTGCATCGTTGGTTCGTTCGTTCACCTCCACCTCCTTTGCGATTCATTATCCATCATGTGATCTTTCTCGGCTTGTGCTGGGGACTTGTCTTACTTCCGCAGGCTCGGCGAGCAGGGGACATGGACTGGCGGAGCGCGACGCTGCAGCTTTGATCGAGGCGCGGAAAGGACGGGCTTTTTTTTCTTGGGCGTGCGTCGGAAGCAGGAAGCAGGAAGCAGGAAGCAGGGGAGCAGGGGAGCGAGCGAGCACTCGCGCGTAGGTTTTCGATCGCGCAGCGACTTTCCGGTTCCGCACTCGGTCGGAGGCAGGGGAGAAGTGTCGACAGGTTGATCGCGGTGCGAGGGAGGCGGGCGAGGCGCGTCTTTCACGCGAGGATTGCGAAGCAGGGGAGCAGGGCAGCTGTGTTCGCGGGAGGACGGCCGGATCGATTGGAATTGAGGAAAAACAGAGATGCGCGACGGGGGGAGTAGTTAATTCGGGTATGGTAGGCTGTGCTGCGTCGGGGTGTGGTAGGCAGAATGCGCTTGAATTCGACCGGGGTGTCCTCTACTCAATGCGCGTTGCGAACCCTGGAATTTCATCCGACGTTGCGGGGCTTCGATTTGGGGGATTTTATTTTGGTTCTGTGTGATAATTCGGTGGAATTGGAGGACAGGAATGGGCAGGGGAAGGCGGAGATCTGAACCTCTGCCACAGGGGCAGGAGAGTGTAGGCACCACGAGCGCGAAGGCTGAGGTGAAGTTAGAAGTTGACGGTGGTGGTGGTGTAGGCGCCTTTGGCTTGCAGGAAGCTCCGGTGTTTTATCCCACTGACGAGGAATTTCAGCATCCATTACGTTACATTGCTCAAATTCGTCCACTCGCCGAAGCCTATGGTATATGCCGCATTGTTCCGCCGAATTCGTGGAATCCTCCGCTCGGGCTTGATACTGTGAAGTTTACATTCCCCACCAAACTCCAGGCTATCCATCAATTACAGGAGAGGCCTGCAGCGTGCGATGCCGACACTTTCAAGCTGGAATATGGCAGGTTTTTGCGGAAACAGGGGGAAATTCTGGAAAGCTGGCCCATGTGGGATGGAGAGGAACTTGACTTGTGCAAATTTTATAACTCCGTGAAGCGACACGGTGGTTATGACAAAGTCACTTCCGAGAACAAGTGGGGGGAGGTTGTACGTCTGGTACAGTCTGACGATACAGGAGCAGCCAATTCCAGCTCTCAAACTCCGACCGTGCGCCAGCTGCACGAGAAACTCCTTCGCGAGCTTTATGAGAAGCATTTGCACACTTTCGAGGTTTACCAGACCAAGGTTGGTTCTGGCAAGCGGTGGCGTGTTGCCAGGAAGCAGGAGACTCCCGGCAAGCAGGTTGTGAAGCCTAAGAAAGGAGTTAGGAGACGTCAGGCAAGTGCTGACGTAGATCTCGATGAATTTCTGGAGCCGAAGAAAAGTGACAACGATTTGGATGCCGATGGCGAGCTCGTGGCAGCGGATGTCGAGAGTCGGCTTACCGGAAAGCGGACTACCAGGGGTCGTCCTCGAGCAGCAGGAGCCTCAGACGACGCAGCATGTGATAACAAGAAGCGTCAGCCTGTTGAGACCGATGCAGGTGGCGAAGGCTCTCGTTCTGTCGGGGAGGTTGATCATCGGTCTCCAGCAAATCCTTCCTCTTCGCGGAAGCGAAGGAAGATGGAGAAGTTTCCAGTTCCAGAGGTTGGGGGTCGGAATGACCAAATCTGTGAGCAATGCCACAGTGGAGCACATGCTCAGTTGATGTTGCTATGTGATCGATGTGACCGAGGTTGGCATTTGTACTGCCTTTCACCTCCTCTATCTTCAGTCCCAGTGGGCAACTGGTACTGTCTCGATTGCATCGGTTCTGAAAGTGAGAGTTTCGGCTTCGGCCAGGGCCAAGAATACTCCTTCGATTCCTTCCGTCGGATGGCTGACCGTTTTAAGCGCAAGTGGTTTGGAACTAGACCCTCGACGTATGCTGACATCGAGAAGGAGTTTTGGCGTGTGGTTGAAAGAGGTACGGGGCCTGTGGAGGTTCTGTATGGCAGCGATCTTGATACTGGGAAGTATGGTAGCGGTTTTCCTAGGGCTTCGGACCCTGTGCCACCATGGTCTAACGCCGAAGCGTGGGACGCTGGTGCAAACAGTCCGTGGAACGTCAATAATTTCCCCAAGCTTGAGGGTTCTGTCCTGCGGCTTGTGCATGAAAACATACCTGGTGTGATGGTTCCTTGGCTTTACATCGGGATGCTATTTTCTTCCTTTTGCTGGCACTACGAGGACCATTGCTTCTACTCCGTCAACTACCTGCACTGCGGAGAGCCGAAATCTTGGTACAGCGTCCCAGGCCATGCCTCGGATGCATTCGAAAAGGTCATGCAAAAAGCTTTTCCTGACCTCTTCGAAGCGCAGCCAGATCTCCTTTTCCAGCTTGTTACGATGTTGAACCCGACAGTCCTGCGCGACAACGGTGTTCCTGTGTGTACCACAGTACAGGAACCTCACAATTTCGTGATAACGTTTCCAAGATCGTATCATGGTGGTTTTAATCATGGATTCAACTGTGCAGAGGCGGTAAATTTTGCTCCCACAGATTGGCTGCCTTTTGGTGGCTTCGGTGTGGAACGCTATCGACTTTACCATAAACCTGCAGTATTGTCCCATGATGAGTTGCTTTGTGTCGTCGCAAAGAACGATGAAAGCTGTGGAAAATCGCCGTGGTTGCAACAAGAGCTTGTGCGAGTTATTGCCAAGGAACGGCATCAAAGAGAGTTTCTCTGGAGTATGGGGATGGTCAAAAGCTCACGGATGACACCCCGTGATTGTCAGGACTTCATCGGTGCCGAGGAAGACGCTGAATGTATAATTTGCCGGTATTATCTGCACTTGTCTTCAGTGGTCTGCCGTTGCCGGCCCGGAAAGGCCGTGTGCTTGCAGCATGCAAGGCAGCTTTGTGAGTGCAGTGCGGATCAACAATGTCTCCAGTATCGCTTTTCTCTCGCAGAGCTGGATGACCTACTTTCCCATGAGGACCAATCGTCGGAGGATTCCAAGGTTGGAGATCTAGCTGCAGTACCTAGCATTACTAAACGCAGGTTGCGTCGTGGGCAGTATGGAGCGTCTTCCTTAACCAGTCCGTTAATGAAAAAGGTAAAAGGGCGTCATTACAAGCATGCCGAGCTTGCTGAAGCGTGGCTAAGTCAAGCACGTGCCGCAGGTCGAAGCCATTCACGGTCTCCTGTGTTGGAAGAATTGCTCAGTCAATCTGAGCAGTTTCTGTGGGGAGGACATGAAATGGATCAGGTAAGAACGATGGTGGAGCAGCTTACAGTTGCACACAAATGGGTGCAAGATGTTGCAGCTTGCTCGACAATTGTGGACAGACATTCAATGGCTAGTAGCGGAAAGGCAGTCAAGGTTCCTCTGGCAACAATTCAACAGCTCGTAGCTGTCGATCCCATTCCGTGGGTGGAGCCTCATTCTTTCAAACTGAAGGCATTATTGGAGCCTGCCTGCAGTCTTCAACAGAAGATTATAGATGCCCTTACTGCTTCGTCTCCACTAGAGATCAAAGCTTTACAATCGCTCCAGCAAGAAGCTGGCCACTCGCCTTTCGAACTTCCAGAGTGCCAGCAGCTCAAGGATGTCATTACACTAGCTCAGGCTTGGAGTGAACGGGTGAAAAAATTGTTACCTACGTGTGCAAAGTCTCTACGTAACCGCGTTCGCAATGAGTGGGCAGATTTGCAGCAATTCAAGGCCTTGCATGAAGAGGGTTCGAAGATACCTGTGATGGTAGGCGAAAAGAAGTCGTTGGAGACTATCATCAATTTAACCGAAGCTTGGCAGGAGCGTGCATCTTCATTACTTATCTCCTCCACTTTCCAGGAACTAGTTGAAGCACTGAAGGACAGCGAGGCGATACCAGTCCGTTTGATGGAAGTGGACCTGATAGAAGAGAGGTTACAGAAAGCCCGAATTTGGATTCAGGATACAGCAGCTGTTTTGACCCTGTGTCGAGATCCGGTAGACTATGCTGAGGTGACCAGACTTTTGGAGAATCTTCTGCAGGCAGGGCAAAAGCTCAAAGTCAATGGCATATCAGAAATGGATACGCTACTGGTCGAGCTAGACAAAATACGTTGGATGCAAAACTCTTCTCAGCTGCTAAAACAGAGACCAACAGTTGACTCTCTCAAAGCTCTTGCCGCAGATATCGAAAGACTGCAAGTATCTGATGGGAGTTTAGTGCGTCAAATTCGTTCCACTCTGTCGGATGCGTTGGCATGGGAAAGCGAAGCAGAAAAGTTGTTACATTCCGGTGGATCACTCTTCCAATTTGTTGATCTTGCCAGCGCTGCAGGATGTTTAAACGTTCGATTATCAGCCTTGGATCTTGTGGAAAAAGCTTTAGCAGATGCCGATACCTGGCTCGATCGGGCAAAACCGTTTTGTTCTACTTTTCTCCAGTGCGAGGAAGATCAATCTTCTTCTCTTGATCTGGCCACCCTTGCAGGAGTGGTCGACGATGCAAACAAACTCTTAGTGAGTTTGGATGAAGTGAGTGTACTGTCAACAGCTCTCAATTCTGCACAAGAATGGGTTGTAGAGGCAACAAAGTTGAAAAGTTCAGTTTTGGTTAGTGAAGGTAGAGAAGATTCGAGCGGGTTTACTTCCACCGTCACATCAGGAGAGTGCAAGACATTGCAGCCAAATAGCTCAGAATTCACTATTACGACAGTCGGTCAAGAAATGAAGAGCAGGCTGCAAGAAGACTTGTTAGCACTGGAAACAGCCGTAGCTCGTGGTCTGTCATTCGGCCTCCAAATTCCAGAAATTCTGGAGCTGCAAGGTCTTCGTGATGCCACCAATTGGAGTTTGAAAGCTCTTAAGCTAGCCGAGTGTTGCCCGACAGTGAAGGAGGTGGAAAGGCACTTGGCCGAGGCTGCGAGCTTACCCGTGAAGGTGTCTCAAGTATCTTTACTTCATAAGATTCTTCATGATGCCAAGTCATGGCTCCAAGCTGCAGCCACATTTCTACCTGGCATTGGCGTGAAAGGTAGCTGCACTGAAGAGCAGTTGGAACAGCTGATTTCTGATGCTAAGAATTTGCCCGTGTCTGTGGTGTCAGAGGCAGGGTGTTTGTTAGACATACTGGCTTCACACAGGACATGGAAGAGGAAGGTTCAACAAGCTTTGGCTGGCACTTCATGTTTGACGTGGAGGGACCTTTCCGACCTTCAGGTAGCTGGAGAAACAAATATGGTACAGAATGACGAAGAGGGTTTACTGAACCAGGAAGCCGTCAATGTCGGGTCATGGGTGTTGAAGTGCTACGAAGCTATCATTTGTCAACCTTCAACTACATCCTATACTCTTGAAGAGCTTTTGGTGAAGATGCGAGAGTCTGTAGAGTACGGCATACAACAATTGGAGTCCGAGGAGAGAAAGACCAAAATGGAGTCTTTATGCATTTGTCGACGAGTTGTAGAAAAGGCCGACACCAGCGTGCTTTCCTGTGACAGTTGTCAGGAACGGTATCATGCTTCCTGTTTGGGCGTAACATCCGCTCAAACAAGAGGACAGAAACAGAATATGTGTACTTTCTGCAGCGTATTATCAAGTGGCGCTTTGACGTTACATGAAGACCTTTCTACCAAGGTTCATCTTACCCGGCGTCCGAAACTGAAAACGCTTTTGGAGCTTCAGCGGTTTGCTAGAGACCAGCAGTGCAGGATGAGGGAGAAGGAACTGCTCGATGTCTTGGTGAAGTTGGTACAGTTGTGGCAAAAAAAGTTATTAGTCATAGTCGAGCGAGCTTTGGTTTGTCGGGAGGAGAAAATGGCCGTCAGTCACAGCTCGCTAGTGGGCCTTTTGAAGGCCCTGGAAGTTATGGAGGTGGAAGCCGAAGAGATTATTTTGATGAAGAAAGCCATAGCTGCCAGTGCCTGGCGGAGCCGAAGTACAAAACTGCTAACTGGGACCTCCAAACCTATCCTTCGTCCTATAACGCGTGCCATCAAAGAAGCTCACGCCCTATCAATATCTGGAGAGGACTGTGTTCTACAGGAGCTGAAGCAGAGAGAAGGATGCGCAATTCAGTGGGCAACACGTGCCAAACAGGTTGTCAACGATCACGGACGGATGCCTTTACCGGATGTTCTGGACCTTTATGCGGAAGGGGAGATGTTGCCAGTGTCGCTACCGAAGGAACTTGCGGCACTGAAAGCCAGGAGTGTGCTTTATTGTCTTTGTCAAAAGCCGTATGATGAGGATCGAGCCATGATAGCATGCGATCGTTGCGGGGAATGGTATCATTTTAGTTGCATCAACCTTCCAGAACCTCCTAGTAGTGATGAAGATACGGACGATGTGATAAGGCAAGAGTGTGAGCAGTCTGGAGACTTTATCTGCCCGAAGTGCAAAGAGTTAGTGAACAAAAGGGATCCTCAAAAGGTGACGGGAGCAACAGGTTCCAAAACCTCATACAGGAATCAAGCACTACCACAAGAAATTGAGAGCGGTCAGAAGACAGTTGAAGGTAACCCTTTGGGCAAACCATTTTATGGTCTTGTACGAGGAAAGAGGAGCCATCGAAGTAGTAGCAGGGCAAGAGGGGAAGTACCACATAAGTGGCAAAGTCCCCTATTCCAACCAGGTAAGTTACTATGGCACACACAGAGAAGAAGGAAACAGAATGAGCAACAACCTGAGGAGTGTGTAAGCGCAAGTGGAAGGCCTTGTCGTCGCACTGCAGGACGGCACAGCGGCTTTGAAAGCTTCATCTTGCTGATGCGGTCCCGATAGTTAGTCTTTAGAGCTGTAGAAATGAAAATTCTTTTGTTAAACTGGAATAAATTCTCAAGCATGGAGCAACGCGAGTTCATAGTTGTGTCGGTTTATGATTCTTGTTGATTTCACGTCTCTTCAGCTTTCGTTCAGTAGGTGAATGGCCTAACGTTCGTTCCAAATTTTGGATTGCATGTTTGAAGAGATTGAGAATCTAGTCTAGAATCCGATCCTTGGGGCCCATAGACATGCGCTGACTTATTTTCTCAAAGAAGAATACAGAGCCAGACCTTTTGTGTGCATAATAGATCTTTTCATCTTGACAATTTCCATCGGTATTGCCAATATGAGTTTGCCAATACCTTTGGATCCCGAA

CDS

>Mapoly0030s0125.1
ATGGGCAGGGGAAGGCGGAGATCTGAACCTCTGCCACAGGGGCAGGAGAGTGTAGGCACCACGAGCGCGAAGGCTGAGGTGAAGTTAGAAGTTGACGGTGGTGGTGGTGTAGGCGCCTTTGGCTTGCAGGAAGCTCCGGTGTTTTATCCCACTGACGAGGAATTTCAGCATCCATTACGTTACATTGCTCAAATTCGTCCACTCGCCGAAGCCTATGGTATATGCCGCATTGTTCCGCCGAATTCGTGGAATCCTCCGCTCGGGCTTGATACTGTGAAGTTTACATTCCCCACCAAACTCCAGGCTATCCATCAATTACAGGAGAGGCCTGCAGCGTGCGATGCCGACACTTTCAAGCTGGAATATGGCAGGTTTTTGCGGAAACAGGGGGAAATTCTGGAAAGCTGGCCCATGTGGGATGGAGAGGAACTTGACTTGTGCAAATTTTATAACTCCGTGAAGCGACACGGTGGTTATGACAAAGTCACTTCCGAGAACAAGTGGGGGGAGGTTGTACGTCTGGTACAGTCTGACGATACAGGAGCAGCCAATTCCAGCTCTCAAACTCCGACCGTGCGCCAGCTGCACGAGAAACTCCTTCGCGAGCTTTATGAGAAGCATTTGCACACTTTCGAGGTTTACCAGACCAAGGTTGGTTCTGGCAAGCGGTGGCGTGTTGCCAGGAAGCAGGAGACTCCCGGCAAGCAGGTTGTGAAGCCTAAGAAAGGAGTTAGGAGACGTCAGGCAAGTGCTGACGTAGATCTCGATGAATTTCTGGAGCCGAAGAAAAGTGACAACGATTTGGATGCCGATGGCGAGCTCGTGGCAGCGGATGTCGAGAGTCGGCTTACCGGAAAGCGGACTACCAGGGGTCGTCCTCGAGCAGCAGGAGCCTCAGACGACGCAGCATGTGATAACAAGAAGCGTCAGCCTGTTGAGACCGATGCAGGTGGCGAAGGCTCTCGTTCTGTCGGGGAGGTTGATCATCGGTCTCCAGCAAATCCTTCCTCTTCGCGGAAGCGAAGGAAGATGGAGAAGTTTCCAGTTCCAGAGGTTGGGGGTCGGAATGACCAAATCTGTGAGCAATGCCACAGTGGAGCACATGCTCAGTTGATGTTGCTATGTGATCGATGTGACCGAGGTTGGCATTTGTACTGCCTTTCACCTCCTCTATCTTCAGTCCCAGTGGGCAACTGGTACTGTCTCGATTGCATCGGTTCTGAAAGTGAGAGTTTCGGCTTCGGCCAGGGCCAAGAATACTCCTTCGATTCCTTCCGTCGGATGGCTGACCGTTTTAAGCGCAAGTGGTTTGGAACTAGACCCTCGACGTATGCTGACATCGAGAAGGAGTTTTGGCGTGTGGTTGAAAGAGGTACGGGGCCTGTGGAGGTTCTGTATGGCAGCGATCTTGATACTGGGAAGTATGGTAGCGGTTTTCCTAGGGCTTCGGACCCTGTGCCACCATGGTCTAACGCCGAAGCGTGGGACGCTGGTGCAAACAGTCCGTGGAACGTCAATAATTTCCCCAAGCTTGAGGGTTCTGTCCTGCGGCTTGTGCATGAAAACATACCTGGTGTGATGGTTCCTTGGCTTTACATCGGGATGCTATTTTCTTCCTTTTGCTGGCACTACGAGGACCATTGCTTCTACTCCGTCAACTACCTGCACTGCGGAGAGCCGAAATCTTGGTACAGCGTCCCAGGCCATGCCTCGGATGCATTCGAAAAGGTCATGCAAAAAGCTTTTCCTGACCTCTTCGAAGCGCAGCCAGATCTCCTTTTCCAGCTTGTTACGATGTTGAACCCGACAGTCCTGCGCGACAACGGTGTTCCTGTGTGTACCACAGTACAGGAACCTCACAATTTCGTGATAACGTTTCCAAGATCGTATCATGGTGGTTTTAATCATGGATTCAACTGTGCAGAGGCGGTAAATTTTGCTCCCACAGATTGGCTGCCTTTTGGTGGCTTCGGTGTGGAACGCTATCGACTTTACCATAAACCTGCAGTATTGTCCCATGATGAGTTGCTTTGTGTCGTCGCAAAGAACGATGAAAGCTGTGGAAAATCGCCGTGGTTGCAACAAGAGCTTGTGCGAGTTATTGCCAAGGAACGGCATCAAAGAGAGTTTCTCTGGAGTATGGGGATGGTCAAAAGCTCACGGATGACACCCCGTGATTGTCAGGACTTCATCGGTGCCGAGGAAGACGCTGAATGTATAATTTGCCGGTATTATCTGCACTTGTCTTCAGTGGTCTGCCGTTGCCGGCCCGGAAAGGCCGTGTGCTTGCAGCATGCAAGGCAGCTTTGTGAGTGCAGTGCGGATCAACAATGTCTCCAGTATCGCTTTTCTCTCGCAGAGCTGGATGACCTACTTTCCCATGAGGACCAATCGTCGGAGGATTCCAAGGTTGGAGATCTAGCTGCAGTACCTAGCATTACTAAACGCAGGTTGCGTCGTGGGCAGTATGGAGCGTCTTCCTTAACCAGTCCGTTAATGAAAAAGGTAAAAGGGCGTCATTACAAGCATGCCGAGCTTGCTGAAGCGTGGCTAAGTCAAGCACGTGCCGCAGGTCGAAGCCATTCACGGTCTCCTGTGTTGGAAGAATTGCTCAGTCAATCTGAGCAGTTTCTGTGGGGAGGACATGAAATGGATCAGGTAAGAACGATGGTGGAGCAGCTTACAGTTGCACACAAATGGGTGCAAGATGTTGCAGCTTGCTCGACAATTGTGGACAGACATTCAATGGCTAGTAGCGGAAAGGCAGTCAAGGTTCCTCTGGCAACAATTCAACAGCTCGTAGCTGTCGATCCCATTCCGTGGGTGGAGCCTCATTCTTTCAAACTGAAGGCATTATTGGAGCCTGCCTGCAGTCTTCAACAGAAGATTATAGATGCCCTTACTGCTTCGTCTCCACTAGAGATCAAAGCTTTACAATCGCTCCAGCAAGAAGCTGGCCACTCGCCTTTCGAACTTCCAGAGTGCCAGCAGCTCAAGGATGTCATTACACTAGCTCAGGCTTGGAGTGAACGGGTGAAAAAATTGTTACCTACGTGTGCAAAGTCTCTACGTAACCGCGTTCGCAATGAGTGGGCAGATTTGCAGCAATTCAAGGCCTTGCATGAAGAGGGTTCGAAGATACCTGTGATGGTAGGCGAAAAGAAGTCGTTGGAGACTATCATCAATTTAACCGAAGCTTGGCAGGAGCGTGCATCTTCATTACTTATCTCCTCCACTTTCCAGGAACTAGTTGAAGCACTGAAGGACAGCGAGGCGATACCAGTCCGTTTGATGGAAGTGGACCTGATAGAAGAGAGGTTACAGAAAGCCCGAATTTGGATTCAGGATACAGCAGCTGTTTTGACCCTGTGTCGAGATCCGGTAGACTATGCTGAGGTGACCAGACTTTTGGAGAATCTTCTGCAGGCAGGGCAAAAGCTCAAAGTCAATGGCATATCAGAAATGGATACGCTACTGGTCGAGCTAGACAAAATACGTTGGATGCAAAACTCTTCTCAGCTGCTAAAACAGAGACCAACAGTTGACTCTCTCAAAGCTCTTGCCGCAGATATCGAAAGACTGCAAGTATCTGATGGGAGTTTAGTGCGTCAAATTCGTTCCACTCTGTCGGATGCGTTGGCATGGGAAAGCGAAGCAGAAAAGTTGTTACATTCCGGTGGATCACTCTTCCAATTTGTTGATCTTGCCAGCGCTGCAGGATGTTTAAACGTTCGATTATCAGCCTTGGATCTTGTGGAAAAAGCTTTAGCAGATGCCGATACCTGGCTCGATCGGGCAAAACCGTTTTGTTCTACTTTTCTCCAGTGCGAGGAAGATCAATCTTCTTCTCTTGATCTGGCCACCCTTGCAGGAGTGGTCGACGATGCAAACAAACTCTTAGTGAGTTTGGATGAAGTGAGTGTACTGTCAACAGCTCTCAATTCTGCACAAGAATGGGTTGTAGAGGCAACAAAGTTGAAAAGTTCAGTTTTGGTTAGTGAAGGTAGAGAAGATTCGAGCGGGTTTACTTCCACCGTCACATCAGGAGAGTGCAAGACATTGCAGCCAAATAGCTCAGAATTCACTATTACGACAGTCGGTCAAGAAATGAAGAGCAGGCTGCAAGAAGACTTGTTAGCACTGGAAACAGCCGTAGCTCGTGGTCTGTCATTCGGCCTCCAAATTCCAGAAATTCTGGAGCTGCAAGGTCTTCGTGATGCCACCAATTGGAGTTTGAAAGCTCTTAAGCTAGCCGAGTGTTGCCCGACAGTGAAGGAGGTGGAAAGGCACTTGGCCGAGGCTGCGAGCTTACCCGTGAAGGTGTCTCAAGTATCTTTACTTCATAAGATTCTTCATGATGCCAAGTCATGGCTCCAAGCTGCAGCCACATTTCTACCTGGCATTGGCGTGAAAGGTAGCTGCACTGAAGAGCAGTTGGAACAGCTGATTTCTGATGCTAAGAATTTGCCCGTGTCTGTGGTGTCAGAGGCAGGGTGTTTGTTAGACATACTGGCTTCACACAGGACATGGAAGAGGAAGGTTCAACAAGCTTTGGCTGGCACTTCATGTTTGACGTGGAGGGACCTTTCCGACCTTCAGGTAGCTGGAGAAACAAATATGGTACAGAATGACGAAGAGGGTTTACTGAACCAGGAAGCCGTCAATGTCGGGTCATGGGTGTTGAAGTGCTACGAAGCTATCATTTGTCAACCTTCAACTACATCCTATACTCTTGAAGAGCTTTTGGTGAAGATGCGAGAGTCTGTAGAGTACGGCATACAACAATTGGAGTCCGAGGAGAGAAAGACCAAAATGGAGTCTTTATGCATTTGTCGACGAGTTGTAGAAAAGGCCGACACCAGCGTGCTTTCCTGTGACAGTTGTCAGGAACGGTATCATGCTTCCTGTTTGGGCGTAACATCCGCTCAAACAAGAGGACAGAAACAGAATATGTGTACTTTCTGCAGCGTATTATCAAGTGGCGCTTTGACGTTACATGAAGACCTTTCTACCAAGGTTCATCTTACCCGGCGTCCGAAACTGAAAACGCTTTTGGAGCTTCAGCGGTTTGCTAGAGACCAGCAGTGCAGGATGAGGGAGAAGGAACTGCTCGATGTCTTGGTGAAGTTGGTACAGTTGTGGCAAAAAAAGTTATTAGTCATAGTCGAGCGAGCTTTGGTTTGTCGGGAGGAGAAAATGGCCGTCAGTCACAGCTCGCTAGTGGGCCTTTTGAAGGCCCTGGAAGTTATGGAGGTGGAAGCCGAAGAGATTATTTTGATGAAGAAAGCCATAGCTGCCAGTGCCTGGCGGAGCCGAAGTACAAAACTGCTAACTGGGACCTCCAAACCTATCCTTCGTCCTATAACGCGTGCCATCAAAGAAGCTCACGCCCTATCAATATCTGGAGAGGACTGTGTTCTACAGGAGCTGAAGCAGAGAGAAGGATGCGCAATTCAGTGGGCAACACGTGCCAAACAGGTTGTCAACGATCACGGACGGATGCCTTTACCGGATGTTCTGGACCTTTATGCGGAAGGGGAGATGTTGCCAGTGTCGCTACCGAAGGAACTTGCGGCACTGAAAGCCAGGAGTGTGCTTTATTGTCTTTGTCAAAAGCCGTATGATGAGGATCGAGCCATGATAGCATGCGATCGTTGCGGGGAATGGTATCATTTTAGTTGCATCAACCTTCCAGAACCTCCTAGTAGTGATGAAGATACGGACGATGTGATAAGGCAAGAGTGTGAGCAGTCTGGAGACTTTATCTGCCCGAAGTGCAAAGAGTTAGTGAACAAAAGGGATCCTCAAAAGGTGACGGGAGCAACAGGTTCCAAAACCTCATACAGGAATCAAGCACTACCACAAGAAATTGAGAGCGGTCAGAAGACAGTTGAAGGTAACCCTTTGGGCAAACCATTTTATGGTCTTGTACGAGGAAAGAGGAGCCATCGAAGTAGTAGCAGGGCAAGAGGGGAAGTACCACATAAGTGGCAAAGTCCCCTATTCCAACCAGGTAAGTTACTATGGCACACACAGAGAAGAAGGAAACAGAATGAGCAACAACCTGAGGAGTGTGTAAGCGCAAGTGGAAGGCCTTGTCGTCGCACTGCAGGACGGCACAGCGGCTTTGAAAGCTTCATCTTGCTGATGCGGTCCCGATAG

Protein

>Mapoly0030s0125.1
MGRGRRRSEPLPQGQESVGTTSAKAEVKLEVDGGGGVGAFGLQEAPVFYPTDEEFQHPLRYIAQIRPLAEAYGICRIVPPNSWNPPLGLDTVKFTFPTKLQAIHQLQERPAACDADTFKLEYGRFLRKQGEILESWPMWDGEELDLCKFYNSVKRHGGYDKVTSENKWGEVVRLVQSDDTGAANSSSQTPTVRQLHEKLLRELYEKHLHTFEVYQTKVGSGKRWRVARKQETPGKQVVKPKKGVRRRQASADVDLDEFLEPKKSDNDLDADGELVAADVESRLTGKRTTRGRPRAAGASDDAACDNKKRQPVETDAGGEGSRSVGEVDHRSPANPSSSRKRRKMEKFPVPEVGGRNDQICEQCHSGAHAQLMLLCDRCDRGWHLYCLSPPLSSVPVGNWYCLDCIGSESESFGFGQGQEYSFDSFRRMADRFKRKWFGTRPSTYADIEKEFWRVVERGTGPVEVLYGSDLDTGKYGSGFPRASDPVPPWSNAEAWDAGANSPWNVNNFPKLEGSVLRLVHENIPGVMVPWLYIGMLFSSFCWHYEDHCFYSVNYLHCGEPKSWYSVPGHASDAFEKVMQKAFPDLFEAQPDLLFQLVTMLNPTVLRDNGVPVCTTVQEPHNFVITFPRSYHGGFNHGFNCAEAVNFAPTDWLPFGGFGVERYRLYHKPAVLSHDELLCVVAKNDESCGKSPWLQQELVRVIAKERHQREFLWSMGMVKSSRMTPRDCQDFIGAEEDAECIICRYYLHLSSVVCRCRPGKAVCLQHARQLCECSADQQCLQYRFSLAELDDLLSHEDQSSEDSKVGDLAAVPSITKRRLRRGQYGASSLTSPLMKKVKGRHYKHAELAEAWLSQARAAGRSHSRSPVLEELLSQSEQFLWGGHEMDQVRTMVEQLTVAHKWVQDVAACSTIVDRHSMASSGKAVKVPLATIQQLVAVDPIPWVEPHSFKLKALLEPACSLQQKIIDALTASSPLEIKALQSLQQEAGHSPFELPECQQLKDVITLAQAWSERVKKLLPTCAKSLRNRVRNEWADLQQFKALHEEGSKIPVMVGEKKSLETIINLTEAWQERASSLLISSTFQELVEALKDSEAIPVRLMEVDLIEERLQKARIWIQDTAAVLTLCRDPVDYAEVTRLLENLLQAGQKLKVNGISEMDTLLVELDKIRWMQNSSQLLKQRPTVDSLKALAADIERLQVSDGSLVRQIRSTLSDALAWESEAEKLLHSGGSLFQFVDLASAAGCLNVRLSALDLVEKALADADTWLDRAKPFCSTFLQCEEDQSSSLDLATLAGVVDDANKLLVSLDEVSVLSTALNSAQEWVVEATKLKSSVLVSEGREDSSGFTSTVTSGECKTLQPNSSEFTITTVGQEMKSRLQEDLLALETAVARGLSFGLQIPEILELQGLRDATNWSLKALKLAECCPTVKEVERHLAEAASLPVKVSQVSLLHKILHDAKSWLQAAATFLPGIGVKGSCTEEQLEQLISDAKNLPVSVVSEAGCLLDILASHRTWKRKVQQALAGTSCLTWRDLSDLQVAGETNMVQNDEEGLLNQEAVNVGSWVLKCYEAIICQPSTTSYTLEELLVKMRESVEYGIQQLESEERKTKMESLCICRRVVEKADTSVLSCDSCQERYHASCLGVTSAQTRGQKQNMCTFCSVLSSGALTLHEDLSTKVHLTRRPKLKTLLELQRFARDQQCRMREKELLDVLVKLVQLWQKKLLVIVERALVCREEKMAVSHSSLVGLLKALEVMEVEAEEIILMKKAIAASAWRSRSTKLLTGTSKPILRPITRAIKEAHALSISGEDCVLQELKQREGCAIQWATRAKQVVNDHGRMPLPDVLDLYAEGEMLPVSLPKELAALKARSVLYCLCQKPYDEDRAMIACDRCGEWYHFSCINLPEPPSSDEDTDDVIRQECEQSGDFICPKCKELVNKRDPQKVTGATGSKTSYRNQALPQEIESGQKTVEGNPLGKPFYGLVRGKRSHRSSSRARGEVPHKWQSPLFQPGKLLWHTQRRRKQNEQQPEECVSASGRPCRRTAGRHSGFESFILLMRSR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>