Mapoly0030s0141



Description

(UnKnown)

Reference DB

Database ID Description
PANTHER PTHR16223 FAMILY NOT NAMED
PANTHER PTHR16223:SF10

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH22 transcription factor, bHLH Mapoly0030s0141.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0030s0141.1 scaffold_30:1578351..1582279  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0030s0141.2 scaffold_30:1578351..1582279  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0030s0141.1  

Gene structure:

mRNA scaffold_30:1578351..1582279  ( - strand )
three_prime_UTR scaffold_30:1578351..1578688  ( - strand )
CDS scaffold_30:1578689..1578799  ( - strand )
CDS scaffold_30:1578921..1578989  ( - strand )
CDS scaffold_30:1579124..1579186  ( - strand )
CDS scaffold_30:1579341..1580351  ( - strand )
CDS scaffold_30:1580432..1580587  ( - strand )
five_prime_UTR scaffold_30:1580588..1580633  ( - strand )
five_prime_UTR scaffold_30:1581768..1582279  ( - strand )

Sequences:

Gene

>Mapoly0030s0141.1
AGATCTGTCTCTGATGTCTCAGGTGAAATCCTATTTCTGCAAAGCCCTTTCGGATTTAGACAGCTACCTCTAGAGTAGCCTGATCACCATGTCTATGTTGAAACTCGATGTGATAGCCATGGTTCTTTCTATTCTTTCCCAGCCGATCGTGTGATCTATAGATCAGACGATCAATAGATCTGGTTGATCTTACATAGATCGCAATGTTTTCGAAGTGGAAAATGTCTATTACCAGCAGATTTGTATTTGCAGATTCCGAAGCAAATAGATTCCCTGCATGCTTTGGTTTTAGTATTTGTACCATTCTCCAGTTTTGGTACTTAGAAGCTGGAAGCTTTCATGAAGCCATTGAGTGGGTCCATCTCGAAGTGGAACCCATGTGGTGGTGGTTCGCCTATAGGCTGATGGTGATGGACAACAACGTGCCCATCGATACGATGTTTCGTTACAATTTTTAGATCTCCATATTGAGAGTTGGACACCCAAATATTTACGGAGAAGGCTTTTGAATGGTATGGATAACGGTTATTCTCGGCTTCTCCGAAGTTCGCTCGATTGCCTCGCTTTCGAACTTGATGTTAAACATCTCAACAACAATTGCAATCAAATACAAGTGTTAAGTTTCGTGTTTCTGTGATTGGCTGTATCCGATTAGTCTTATGATTCGATAGTGGGTTCGTGATTGATTATTCGTAGCTTTTTGTCCGACGATCACTTTCCATTTCATTTATTTAAGTAAAGCTGAAGAACTACAAAAAAAACTCCTATGATGAAGGTTTAGACCTGCTACGCTGTCAAATCTAAATTGCGTTTCTCGAGTCCTTTTTCAATGTCATGGTGGCACTCATCATTTCATGACTTTTAACTTGTAAGTTCATCTGTCTGCTACGTCTTAATTGAAATAAAAATATTGCAACTGCTGCAAGAAGAAACAAGTATTTTTAGTTTCTTTCTTACTTTCTCAGTCGATTGTTTAATCACATGCTTTTGATTTCGATGGTGAATCTTACACCAATATCTTCTTCTTGATGTCTGTAAGTGCATCGTTACTTTCTTGGTTTAGTCAGATTCATGTTAGAGAAATACAACTTAGGAAGAAATCTACTCTTACGAATCACCTTTGATCTCTTCAAATTGCACAACATGATCTTCATAAGATCTAGCATATGGATCGATCAATCAAGTTTCTTTTCCAATTCGATCTTTTGCCAGGGCACGCTGGAAGAACAATTTCGTTGTAGTTATGTGAATCCAATCGATTTGTACTTGGATACTACTTTCAAACGCACATTTACTTGAAGAATTTGTCGTCCCAGTCACACCAAAATGACATGTGGTAGTTGCAATACAGCCTTAGTTGAGTTACACTTAATCATATACTCCATTATAGATCAATAGAAGTTTACGAAAATCAATTAAAAGTCATCAATTTTAAATAGACTGATGGTAGTAATTATCAAAACTAGAATCTAAAATGGTTCAAACTTTTGTATCATATCAACAGTTTTAGGTCTTTTCTCTTCCCGGTTGAAGTTGAGTAGCGAACTGATTTCTTCGCCGCTTCATTTCCTACATTTCATGTAGCTGGAACCACTTTCTTCTCCATAAACTTAACCTTGTACTGACATATTCTTGTCGATTTCCAGGTATCGACAGTGTTCTCAGGCGAAGATTGTAGAACATTCAGGGACTATGGAACTTTCAAATATGTCCTCAATTCTCGAACAGCACAAGGAAAACGTTGATTGTGAGATGACAGAATCTCTAGTCAATCTTGATCATTACATGGCGTTATCTGCGATTCAACAAGTCTCCTACAACTGCTCAAGCCTTTCAGCCCTAGTAAAGGTAATAACCATACATTCGAGTATTATGCAAAGTATTGATGCTCCCAGACAACTCATGTGGACTTTCTGTATGCTCTACAGGACCATAACTATTCTCCGACGTCAAATTTGGAGAGTATAGATGTGAATCAACTATCACCTGACAGTGACAACTCAGATTACTTGGAGCCATCCAACATGAGCAGTAGCATGTTGATGGAAATGCAAGAATTATGGCCAAATTATGGAAATTTTTCAACCGGACTTTCTGTCCAGTCACCGCAGTGTCTGGCTCCATGGGAGCCAATATTCAATCCAGCACCACCTCAGGAACTCGTAAGTGAGAATTTAGTTCATTTAACAAACGTGAGTCAGACAGTGCCAACCCTATCATTCGATGGGAAGATGGGTACCAGCGAAAACCTTCTCCAAACGGGGAATGATGTCATAATTCAAAACTCATCATTTCCAACAGCATCACAGGCGAACTTGGTTGGGACTGCTATCAGGATACCAGATGAGAACAGGTTTGTGAGGAGCTCCACAATCCTACCAGCAGCAGCATCGTTGGTAGAAAATCGAGGCAGCAACACGTTTCCTGAAGCGTCAGATTTGAGACCGCTGAGTAAGCAGACTCGCACGTCACCTTATCCATCATCAGAGGAGAAGAGGGCTGTGCATTTGGTCCAACTTGTAAATGCTAACCAATCAAAGATGCACACTCCACCATCACATAGTGCGGGGTGGAAAAGGCCTCAACACGTATACTCTTCTCTTGGCCTCGACGGAACTTCAACCCCAAGTTCAGAAATGATGGATTCCGCCTCACCCTTTTTGCTTCCGAACCCGAAGATCCGTGGTGATTTTTCAAAAGGAACTCTGGGACAAGCACCATGCATGAGTGGCGAGAAGGGGAAGGAAGCCACCTCTTCGTCCAAACCAACTAAACCTCCGGAATATCTGGTAGGGAATATGGACGGATACGGCAATCCGATGGCGAAGAATAACAAACTGAAGGAGAAGACCACGCAAAAGAAACCAGATGCTTCGATTAAATGCAGATCCCGTTCACGACCCGGCGTTTACACAAATCCACGGAGCATCATAGAGAAGGTAAATATACAGCTTATCTTTGTACTTGTATGCATAATCACCCAGATTTATGACCATAGCCTTCCAGCATGATGGCATCAGAACATGGTATTATTTACTCTGGATTTATATCGTCTATTTCGAACAAGTTTTGAAAATAGAGTTTTGTGTCCAGACCAGAAGGCAGCGCATCACCGAGAAGTTGAGAGAACTCCAGGAACTGGTACATTCAGTAAAAGTAAGTTGTCCGGCTTTCGATAAATTGGTTGAAGTGGACATGAGAAATCAGAGTACTTAGTTCCAGCACTTGCCTCCAAGTTTGTTTCTGTTCAATGTGAGGACTGATATCTATCATGATATATGTCTCTACAGCCAGACAATACTGTCTACATGTTGGACCAGGTTATAAATTACGTTGAGGGCCTCGAAAATCAGATACAGGTAAAATGAACTTTCTTTGAACTTTGATTGCTGCTTCAGTAGGTTATCAAACTGAAAGAATATTTAGCGTAAATTTTTCCAAAATCCAGCTTATTCCTCTAACGCTGATCTTTGTTTGAAGGTTCTATTAATTCAAAAGGGTGAATATTGGAATATGGACTTCAGTTCCATGTTTCAAAGCGCTTCTGATGAAAGTGAGCTGCTGAAGTCTGGCTCGTTCGAACGTGGATAACATTATAAAAAAGTTCTTCTCTAGGATAGAAGTTGCGTTGTTGATCTGGTTCCTTAGAATGGGCCAGGTTGCAGGAATTCATGATGAGGCAGTTACTTATGCAGGGATAGACGAGGCTACTAGATATTTTCAGACATTACAGGAAAATTATATATTGAGATTTCGTGAAATTATGACTTCGTTTTCAGCAAATGCAGCCCAAGTGAAGGTGCAAATAGATGTGGAAACTGCAGTTGAAGACAGACTGCAATTTCCTTCCAAGTGCAATATGCACTATGTTTTCGAGTTGTTATTGGGCTTTGAGCCCTCATTCCAATAGAGTCCAAATTAATATCAAA

mRNA

>Mapoly0030s0141.1
AGATCTGTCTCTGATGTCTCAGGTGAAATCCTATTTCTGCAAAGCCCTTTCGGATTTAGACAGCTACCTCTAGAGTAGCCTGATCACCATGTCTATGTTGAAACTCGATGTGATAGCCATGGTTCTTTCTATTCTTTCCCAGCCGATCGTGTGATCTATAGATCAGACGATCAATAGATCTGGTTGATCTTACATAGATCGCAATGTTTTCGAAGTGGAAAATGTCTATTACCAGCAGATTTGTATTTGCAGATTCCGAAGCAAATAGATTCCCTGCATGCTTTGGTTTTAGTATTTGTACCATTCTCCAGTTTTGGTACTTAGAAGCTGGAAGCTTTCATGAAGCCATTGAGTGGGTCCATCTCGAAGTGGAACCCATGTGGTGGTGGTTCGCCTATAGGCTGATGGTGATGGACAACAACGTGCCCATCGATACGATGTTTCGTTACAATTTTTAGATCTCCATATTGAGAGTTGGACACCCAAATATTTACGGAGAAGGCTTTTGAATGGTATCGACAGTGTTCTCAGGCGAAGATTGTAGAACATTCAGGGACTATGGAACTTTCAAATATGTCCTCAATTCTCGAACAGCACAAGGAAAACGTTGATTGTGAGATGACAGAATCTCTAGTCAATCTTGATCATTACATGGCGTTATCTGCGATTCAACAAGTCTCCTACAACTGCTCAAGCCTTTCAGCCCTAGTAAAGGACCATAACTATTCTCCGACGTCAAATTTGGAGAGTATAGATGTGAATCAACTATCACCTGACAGTGACAACTCAGATTACTTGGAGCCATCCAACATGAGCAGTAGCATGTTGATGGAAATGCAAGAATTATGGCCAAATTATGGAAATTTTTCAACCGGACTTTCTGTCCAGTCACCGCAGTGTCTGGCTCCATGGGAGCCAATATTCAATCCAGCACCACCTCAGGAACTCGTAAGTGAGAATTTAGTTCATTTAACAAACGTGAGTCAGACAGTGCCAACCCTATCATTCGATGGGAAGATGGGTACCAGCGAAAACCTTCTCCAAACGGGGAATGATGTCATAATTCAAAACTCATCATTTCCAACAGCATCACAGGCGAACTTGGTTGGGACTGCTATCAGGATACCAGATGAGAACAGGTTTGTGAGGAGCTCCACAATCCTACCAGCAGCAGCATCGTTGGTAGAAAATCGAGGCAGCAACACGTTTCCTGAAGCGTCAGATTTGAGACCGCTGAGTAAGCAGACTCGCACGTCACCTTATCCATCATCAGAGGAGAAGAGGGCTGTGCATTTGGTCCAACTTGTAAATGCTAACCAATCAAAGATGCACACTCCACCATCACATAGTGCGGGGTGGAAAAGGCCTCAACACGTATACTCTTCTCTTGGCCTCGACGGAACTTCAACCCCAAGTTCAGAAATGATGGATTCCGCCTCACCCTTTTTGCTTCCGAACCCGAAGATCCGTGGTGATTTTTCAAAAGGAACTCTGGGACAAGCACCATGCATGAGTGGCGAGAAGGGGAAGGAAGCCACCTCTTCGTCCAAACCAACTAAACCTCCGGAATATCTGGTAGGGAATATGGACGGATACGGCAATCCGATGGCGAAGAATAACAAACTGAAGGAGAAGACCACGCAAAAGAAACCAGATGCTTCGATTAAATGCAGATCCCGTTCACGACCCGGCGTTTACACAAATCCACGGAGCATCATAGAGAAGACCAGAAGGCAGCGCATCACCGAGAAGTTGAGAGAACTCCAGGAACTGGTACATTCAGTAAAACCAGACAATACTGTCTACATGTTGGACCAGGTTATAAATTACGTTGAGGGCCTCGAAAATCAGATACAGGTTCTATTAATTCAAAAGGGTGAATATTGGAATATGGACTTCAGTTCCATGTTTCAAAGCGCTTCTGATGAAAGTGAGCTGCTGAAGTCTGGCTCGTTCGAACGTGGATAACATTATAAAAAAGTTCTTCTCTAGGATAGAAGTTGCGTTGTTGATCTGGTTCCTTAGAATGGGCCAGGTTGCAGGAATTCATGATGAGGCAGTTACTTATGCAGGGATAGACGAGGCTACTAGATATTTTCAGACATTACAGGAAAATTATATATTGAGATTTCGTGAAATTATGACTTCGTTTTCAGCAAATGCAGCCCAAGTGAAGGTGCAAATAGATGTGGAAACTGCAGTTGAAGACAGACTGCAATTTCCTTCCAAGTGCAATATGCACTATGTTTTCGAGTTGTTATTGGGCTTTGAGCCCTCATTCCAATAGAGTCCAAATTAATATCAAA

CDS

>Mapoly0030s0141.1
ATGGAACTTTCAAATATGTCCTCAATTCTCGAACAGCACAAGGAAAACGTTGATTGTGAGATGACAGAATCTCTAGTCAATCTTGATCATTACATGGCGTTATCTGCGATTCAACAAGTCTCCTACAACTGCTCAAGCCTTTCAGCCCTAGTAAAGGACCATAACTATTCTCCGACGTCAAATTTGGAGAGTATAGATGTGAATCAACTATCACCTGACAGTGACAACTCAGATTACTTGGAGCCATCCAACATGAGCAGTAGCATGTTGATGGAAATGCAAGAATTATGGCCAAATTATGGAAATTTTTCAACCGGACTTTCTGTCCAGTCACCGCAGTGTCTGGCTCCATGGGAGCCAATATTCAATCCAGCACCACCTCAGGAACTCGTAAGTGAGAATTTAGTTCATTTAACAAACGTGAGTCAGACAGTGCCAACCCTATCATTCGATGGGAAGATGGGTACCAGCGAAAACCTTCTCCAAACGGGGAATGATGTCATAATTCAAAACTCATCATTTCCAACAGCATCACAGGCGAACTTGGTTGGGACTGCTATCAGGATACCAGATGAGAACAGGTTTGTGAGGAGCTCCACAATCCTACCAGCAGCAGCATCGTTGGTAGAAAATCGAGGCAGCAACACGTTTCCTGAAGCGTCAGATTTGAGACCGCTGAGTAAGCAGACTCGCACGTCACCTTATCCATCATCAGAGGAGAAGAGGGCTGTGCATTTGGTCCAACTTGTAAATGCTAACCAATCAAAGATGCACACTCCACCATCACATAGTGCGGGGTGGAAAAGGCCTCAACACGTATACTCTTCTCTTGGCCTCGACGGAACTTCAACCCCAAGTTCAGAAATGATGGATTCCGCCTCACCCTTTTTGCTTCCGAACCCGAAGATCCGTGGTGATTTTTCAAAAGGAACTCTGGGACAAGCACCATGCATGAGTGGCGAGAAGGGGAAGGAAGCCACCTCTTCGTCCAAACCAACTAAACCTCCGGAATATCTGGTAGGGAATATGGACGGATACGGCAATCCGATGGCGAAGAATAACAAACTGAAGGAGAAGACCACGCAAAAGAAACCAGATGCTTCGATTAAATGCAGATCCCGTTCACGACCCGGCGTTTACACAAATCCACGGAGCATCATAGAGAAGACCAGAAGGCAGCGCATCACCGAGAAGTTGAGAGAACTCCAGGAACTGGTACATTCAGTAAAACCAGACAATACTGTCTACATGTTGGACCAGGTTATAAATTACGTTGAGGGCCTCGAAAATCAGATACAGGTTCTATTAATTCAAAAGGGTGAATATTGGAATATGGACTTCAGTTCCATGTTTCAAAGCGCTTCTGATGAAAGTGAGCTGCTGAAGTCTGGCTCGTTCGAACGTGGATAA

Protein

>Mapoly0030s0141.1
MELSNMSSILEQHKENVDCEMTESLVNLDHYMALSAIQQVSYNCSSLSALVKDHNYSPTSNLESIDVNQLSPDSDNSDYLEPSNMSSSMLMEMQELWPNYGNFSTGLSVQSPQCLAPWEPIFNPAPPQELVSENLVHLTNVSQTVPTLSFDGKMGTSENLLQTGNDVIIQNSSFPTASQANLVGTAIRIPDENRFVRSSTILPAAASLVENRGSNTFPEASDLRPLSKQTRTSPYPSSEEKRAVHLVQLVNANQSKMHTPPSHSAGWKRPQHVYSSLGLDGTSTPSSEMMDSASPFLLPNPKIRGDFSKGTLGQAPCMSGEKGKEATSSSKPTKPPEYLVGNMDGYGNPMAKNNKLKEKTTQKKPDASIKCRSRSRPGVYTNPRSIIEKTRRQRITEKLRELQELVHSVKPDNTVYMLDQVINYVEGLENQIQVLLIQKGEYWNMDFSSMFQSASDESELLKSGSFERG

Mapoly0030s0141.2  

Gene structure:

mRNA scaffold_30:1578351..1582279  ( - strand )
three_prime_UTR scaffold_30:1578351..1578799  ( - strand )
three_prime_UTR scaffold_30:1578921..1578942  ( - strand )
CDS scaffold_30:1578943..1578989  ( - strand )
CDS scaffold_30:1579124..1579181  ( - strand )
CDS scaffold_30:1579341..1580351  ( - strand )
CDS scaffold_30:1580432..1580587  ( - strand )
five_prime_UTR scaffold_30:1580588..1580633  ( - strand )
five_prime_UTR scaffold_30:1581768..1582279  ( - strand )

Sequences:

Gene

>Mapoly0030s0141.2
AGATCTGTCTCTGATGTCTCAGGTGAAATCCTATTTCTGCAAAGCCCTTTCGGATTTAGACAGCTACCTCTAGAGTAGCCTGATCACCATGTCTATGTTGAAACTCGATGTGATAGCCATGGTTCTTTCTATTCTTTCCCAGCCGATCGTGTGATCTATAGATCAGACGATCAATAGATCTGGTTGATCTTACATAGATCGCAATGTTTTCGAAGTGGAAAATGTCTATTACCAGCAGATTTGTATTTGCAGATTCCGAAGCAAATAGATTCCCTGCATGCTTTGGTTTTAGTATTTGTACCATTCTCCAGTTTTGGTACTTAGAAGCTGGAAGCTTTCATGAAGCCATTGAGTGGGTCCATCTCGAAGTGGAACCCATGTGGTGGTGGTTCGCCTATAGGCTGATGGTGATGGACAACAACGTGCCCATCGATACGATGTTTCGTTACAATTTTTAGATCTCCATATTGAGAGTTGGACACCCAAATATTTACGGAGAAGGCTTTTGAATGGTATGGATAACGGTTATTCTCGGCTTCTCCGAAGTTCGCTCGATTGCCTCGCTTTCGAACTTGATGTTAAACATCTCAACAACAATTGCAATCAAATACAAGTGTTAAGTTTCGTGTTTCTGTGATTGGCTGTATCCGATTAGTCTTATGATTCGATAGTGGGTTCGTGATTGATTATTCGTAGCTTTTTGTCCGACGATCACTTTCCATTTCATTTATTTAAGTAAAGCTGAAGAACTACAAAAAAAACTCCTATGATGAAGGTTTAGACCTGCTACGCTGTCAAATCTAAATTGCGTTTCTCGAGTCCTTTTTCAATGTCATGGTGGCACTCATCATTTCATGACTTTTAACTTGTAAGTTCATCTGTCTGCTACGTCTTAATTGAAATAAAAATATTGCAACTGCTGCAAGAAGAAACAAGTATTTTTAGTTTCTTTCTTACTTTCTCAGTCGATTGTTTAATCACATGCTTTTGATTTCGATGGTGAATCTTACACCAATATCTTCTTCTTGATGTCTGTAAGTGCATCGTTACTTTCTTGGTTTAGTCAGATTCATGTTAGAGAAATACAACTTAGGAAGAAATCTACTCTTACGAATCACCTTTGATCTCTTCAAATTGCACAACATGATCTTCATAAGATCTAGCATATGGATCGATCAATCAAGTTTCTTTTCCAATTCGATCTTTTGCCAGGGCACGCTGGAAGAACAATTTCGTTGTAGTTATGTGAATCCAATCGATTTGTACTTGGATACTACTTTCAAACGCACATTTACTTGAAGAATTTGTCGTCCCAGTCACACCAAAATGACATGTGGTAGTTGCAATACAGCCTTAGTTGAGTTACACTTAATCATATACTCCATTATAGATCAATAGAAGTTTACGAAAATCAATTAAAAGTCATCAATTTTAAATAGACTGATGGTAGTAATTATCAAAACTAGAATCTAAAATGGTTCAAACTTTTGTATCATATCAACAGTTTTAGGTCTTTTCTCTTCCCGGTTGAAGTTGAGTAGCGAACTGATTTCTTCGCCGCTTCATTTCCTACATTTCATGTAGCTGGAACCACTTTCTTCTCCATAAACTTAACCTTGTACTGACATATTCTTGTCGATTTCCAGGTATCGACAGTGTTCTCAGGCGAAGATTGTAGAACATTCAGGGACTATGGAACTTTCAAATATGTCCTCAATTCTCGAACAGCACAAGGAAAACGTTGATTGTGAGATGACAGAATCTCTAGTCAATCTTGATCATTACATGGCGTTATCTGCGATTCAACAAGTCTCCTACAACTGCTCAAGCCTTTCAGCCCTAGTAAAGGTAATAACCATACATTCGAGTATTATGCAAAGTATTGATGCTCCCAGACAACTCATGTGGACTTTCTGTATGCTCTACAGGACCATAACTATTCTCCGACGTCAAATTTGGAGAGTATAGATGTGAATCAACTATCACCTGACAGTGACAACTCAGATTACTTGGAGCCATCCAACATGAGCAGTAGCATGTTGATGGAAATGCAAGAATTATGGCCAAATTATGGAAATTTTTCAACCGGACTTTCTGTCCAGTCACCGCAGTGTCTGGCTCCATGGGAGCCAATATTCAATCCAGCACCACCTCAGGAACTCGTAAGTGAGAATTTAGTTCATTTAACAAACGTGAGTCAGACAGTGCCAACCCTATCATTCGATGGGAAGATGGGTACCAGCGAAAACCTTCTCCAAACGGGGAATGATGTCATAATTCAAAACTCATCATTTCCAACAGCATCACAGGCGAACTTGGTTGGGACTGCTATCAGGATACCAGATGAGAACAGGTTTGTGAGGAGCTCCACAATCCTACCAGCAGCAGCATCGTTGGTAGAAAATCGAGGCAGCAACACGTTTCCTGAAGCGTCAGATTTGAGACCGCTGAGTAAGCAGACTCGCACGTCACCTTATCCATCATCAGAGGAGAAGAGGGCTGTGCATTTGGTCCAACTTGTAAATGCTAACCAATCAAAGATGCACACTCCACCATCACATAGTGCGGGGTGGAAAAGGCCTCAACACGTATACTCTTCTCTTGGCCTCGACGGAACTTCAACCCCAAGTTCAGAAATGATGGATTCCGCCTCACCCTTTTTGCTTCCGAACCCGAAGATCCGTGGTGATTTTTCAAAAGGAACTCTGGGACAAGCACCATGCATGAGTGGCGAGAAGGGGAAGGAAGCCACCTCTTCGTCCAAACCAACTAAACCTCCGGAATATCTGGTAGGGAATATGGACGGATACGGCAATCCGATGGCGAAGAATAACAAACTGAAGGAGAAGACCACGCAAAAGAAACCAGATGCTTCGATTAAATGCAGATCCCGTTCACGACCCGGCGTTTACACAAATCCACGGAGCATCATAGAGAAGGTAAATATACAGCTTATCTTTGTACTTGTATGCATAATCACCCAGATTTATGACCATAGCCTTCCAGCATGATGGCATCAGAACATGGTATTATTTACTCTGGATTTATATCGTCTATTTCGAACAAGTTTTGAAAATAGAGTTTTGTGTCCAGACCAGAAGGCAGCGCATCACCGAGAAGTTGAGAGAACTCCAGGAACTGGTACATTCAGTAAAAGTAAGTTGTCCGGCTTTCGATAAATTGGTTGAAGTGGACATGAGAAATCAGAGTACTTAGTTCCAGCACTTGCCTCCAAGTTTGTTTCTGTTCAATGTGAGGACTGATATCTATCATGATATATGTCTCTACAGCCAGACAATACTGTCTACATGTTGGACCAGGTTATAAATTACGTTGAGGGCCTCGAAAATCAGATACAGGTAAAATGAACTTTCTTTGAACTTTGATTGCTGCTTCAGTAGGTTATCAAACTGAAAGAATATTTAGCGTAAATTTTTCCAAAATCCAGCTTATTCCTCTAACGCTGATCTTTGTTTGAAGGTTCTATTAATTCAAAAGGGTGAATATTGGAATATGGACTTCAGTTCCATGTTTCAAAGCGCTTCTGATGAAAGTGAGCTGCTGAAGTCTGGCTCGTTCGAACGTGGATAACATTATAAAAAAGTTCTTCTCTAGGATAGAAGTTGCGTTGTTGATCTGGTTCCTTAGAATGGGCCAGGTTGCAGGAATTCATGATGAGGCAGTTACTTATGCAGGGATAGACGAGGCTACTAGATATTTTCAGACATTACAGGAAAATTATATATTGAGATTTCGTGAAATTATGACTTCGTTTTCAGCAAATGCAGCCCAAGTGAAGGTGCAAATAGATGTGGAAACTGCAGTTGAAGACAGACTGCAATTTCCTTCCAAGTGCAATATGCACTATGTTTTCGAGTTGTTATTGGGCTTTGAGCCCTCATTCCAATAGAGTCCAAATTAATATCAAA

mRNA

>Mapoly0030s0141.2
AGATCTGTCTCTGATGTCTCAGGTGAAATCCTATTTCTGCAAAGCCCTTTCGGATTTAGACAGCTACCTCTAGAGTAGCCTGATCACCATGTCTATGTTGAAACTCGATGTGATAGCCATGGTTCTTTCTATTCTTTCCCAGCCGATCGTGTGATCTATAGATCAGACGATCAATAGATCTGGTTGATCTTACATAGATCGCAATGTTTTCGAAGTGGAAAATGTCTATTACCAGCAGATTTGTATTTGCAGATTCCGAAGCAAATAGATTCCCTGCATGCTTTGGTTTTAGTATTTGTACCATTCTCCAGTTTTGGTACTTAGAAGCTGGAAGCTTTCATGAAGCCATTGAGTGGGTCCATCTCGAAGTGGAACCCATGTGGTGGTGGTTCGCCTATAGGCTGATGGTGATGGACAACAACGTGCCCATCGATACGATGTTTCGTTACAATTTTTAGATCTCCATATTGAGAGTTGGACACCCAAATATTTACGGAGAAGGCTTTTGAATGGTATCGACAGTGTTCTCAGGCGAAGATTGTAGAACATTCAGGGACTATGGAACTTTCAAATATGTCCTCAATTCTCGAACAGCACAAGGAAAACGTTGATTGTGAGATGACAGAATCTCTAGTCAATCTTGATCATTACATGGCGTTATCTGCGATTCAACAAGTCTCCTACAACTGCTCAAGCCTTTCAGCCCTAGTAAAGGACCATAACTATTCTCCGACGTCAAATTTGGAGAGTATAGATGTGAATCAACTATCACCTGACAGTGACAACTCAGATTACTTGGAGCCATCCAACATGAGCAGTAGCATGTTGATGGAAATGCAAGAATTATGGCCAAATTATGGAAATTTTTCAACCGGACTTTCTGTCCAGTCACCGCAGTGTCTGGCTCCATGGGAGCCAATATTCAATCCAGCACCACCTCAGGAACTCGTAAGTGAGAATTTAGTTCATTTAACAAACGTGAGTCAGACAGTGCCAACCCTATCATTCGATGGGAAGATGGGTACCAGCGAAAACCTTCTCCAAACGGGGAATGATGTCATAATTCAAAACTCATCATTTCCAACAGCATCACAGGCGAACTTGGTTGGGACTGCTATCAGGATACCAGATGAGAACAGGTTTGTGAGGAGCTCCACAATCCTACCAGCAGCAGCATCGTTGGTAGAAAATCGAGGCAGCAACACGTTTCCTGAAGCGTCAGATTTGAGACCGCTGAGTAAGCAGACTCGCACGTCACCTTATCCATCATCAGAGGAGAAGAGGGCTGTGCATTTGGTCCAACTTGTAAATGCTAACCAATCAAAGATGCACACTCCACCATCACATAGTGCGGGGTGGAAAAGGCCTCAACACGTATACTCTTCTCTTGGCCTCGACGGAACTTCAACCCCAAGTTCAGAAATGATGGATTCCGCCTCACCCTTTTTGCTTCCGAACCCGAAGATCCGTGGTGATTTTTCAAAAGGAACTCTGGGACAAGCACCATGCATGAGTGGCGAGAAGGGGAAGGAAGCCACCTCTTCGTCCAAACCAACTAAACCTCCGGAATATCTGGTAGGGAATATGGACGGATACGGCAATCCGATGGCGAAGAATAACAAACTGAAGGAGAAGACCACGCAAAAGAAACCAGATGCTTCGATTAAATGCAGATCCCGTTCACGACCCGGCGTTTACACAAATCCACGGAGCATCATAGAGAAGAAGGCAGCGCATCACCGAGAAGTTGAGAGAACTCCAGGAACTGGTACATTCAGTAAAACCAGACAATACTGTCTACATGTTGGACCAGGTTATAAATTACGTTGAGGGCCTCGAAAATCAGATACAGGTTCTATTAATTCAAAAGGGTGAATATTGGAATATGGACTTCAGTTCCATGTTTCAAAGCGCTTCTGATGAAAGTGAGCTGCTGAAGTCTGGCTCGTTCGAACGTGGATAACATTATAAAAAAGTTCTTCTCTAGGATAGAAGTTGCGTTGTTGATCTGGTTCCTTAGAATGGGCCAGGTTGCAGGAATTCATGATGAGGCAGTTACTTATGCAGGGATAGACGAGGCTACTAGATATTTTCAGACATTACAGGAAAATTATATATTGAGATTTCGTGAAATTATGACTTCGTTTTCAGCAAATGCAGCCCAAGTGAAGGTGCAAATAGATGTGGAAACTGCAGTTGAAGACAGACTGCAATTTCCTTCCAAGTGCAATATGCACTATGTTTTCGAGTTGTTATTGGGCTTTGAGCCCTCATTCCAATAGAGTCCAAATTAATATCAAA

CDS

>Mapoly0030s0141.2
ATGGAACTTTCAAATATGTCCTCAATTCTCGAACAGCACAAGGAAAACGTTGATTGTGAGATGACAGAATCTCTAGTCAATCTTGATCATTACATGGCGTTATCTGCGATTCAACAAGTCTCCTACAACTGCTCAAGCCTTTCAGCCCTAGTAAAGGACCATAACTATTCTCCGACGTCAAATTTGGAGAGTATAGATGTGAATCAACTATCACCTGACAGTGACAACTCAGATTACTTGGAGCCATCCAACATGAGCAGTAGCATGTTGATGGAAATGCAAGAATTATGGCCAAATTATGGAAATTTTTCAACCGGACTTTCTGTCCAGTCACCGCAGTGTCTGGCTCCATGGGAGCCAATATTCAATCCAGCACCACCTCAGGAACTCGTAAGTGAGAATTTAGTTCATTTAACAAACGTGAGTCAGACAGTGCCAACCCTATCATTCGATGGGAAGATGGGTACCAGCGAAAACCTTCTCCAAACGGGGAATGATGTCATAATTCAAAACTCATCATTTCCAACAGCATCACAGGCGAACTTGGTTGGGACTGCTATCAGGATACCAGATGAGAACAGGTTTGTGAGGAGCTCCACAATCCTACCAGCAGCAGCATCGTTGGTAGAAAATCGAGGCAGCAACACGTTTCCTGAAGCGTCAGATTTGAGACCGCTGAGTAAGCAGACTCGCACGTCACCTTATCCATCATCAGAGGAGAAGAGGGCTGTGCATTTGGTCCAACTTGTAAATGCTAACCAATCAAAGATGCACACTCCACCATCACATAGTGCGGGGTGGAAAAGGCCTCAACACGTATACTCTTCTCTTGGCCTCGACGGAACTTCAACCCCAAGTTCAGAAATGATGGATTCCGCCTCACCCTTTTTGCTTCCGAACCCGAAGATCCGTGGTGATTTTTCAAAAGGAACTCTGGGACAAGCACCATGCATGAGTGGCGAGAAGGGGAAGGAAGCCACCTCTTCGTCCAAACCAACTAAACCTCCGGAATATCTGGTAGGGAATATGGACGGATACGGCAATCCGATGGCGAAGAATAACAAACTGAAGGAGAAGACCACGCAAAAGAAACCAGATGCTTCGATTAAATGCAGATCCCGTTCACGACCCGGCGTTTACACAAATCCACGGAGCATCATAGAGAAGAAGGCAGCGCATCACCGAGAAGTTGAGAGAACTCCAGGAACTGGTACATTCAGTAAAACCAGACAATACTGTCTACATGTTGGACCAGGTTATAAATTACGTTGA

Protein

>Mapoly0030s0141.2
MELSNMSSILEQHKENVDCEMTESLVNLDHYMALSAIQQVSYNCSSLSALVKDHNYSPTSNLESIDVNQLSPDSDNSDYLEPSNMSSSMLMEMQELWPNYGNFSTGLSVQSPQCLAPWEPIFNPAPPQELVSENLVHLTNVSQTVPTLSFDGKMGTSENLLQTGNDVIIQNSSFPTASQANLVGTAIRIPDENRFVRSSTILPAAASLVENRGSNTFPEASDLRPLSKQTRTSPYPSSEEKRAVHLVQLVNANQSKMHTPPSHSAGWKRPQHVYSSLGLDGTSTPSSEMMDSASPFLLPNPKIRGDFSKGTLGQAPCMSGEKGKEATSSSKPTKPPEYLVGNMDGYGNPMAKNNKLKEKTTQKKPDASIKCRSRSRPGVYTNPRSIIEKKAAHHREVERTPGTGTFSKTRQYCLHVGPGYKLR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>