Mapoly0031s0072



Description

MYC

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_150277
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR11514 MYC
PANTHER PTHR11514:SF33

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH35 transcription factor, bHLH Mapoly0031s0072.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0031s0072.1 scaffold_31:521313..532525  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0031s0072.1  

Gene structure:

mRNA scaffold_31:521313..532525  ( + strand )
five_prime_UTR scaffold_31:521313..521509  ( + strand )
five_prime_UTR scaffold_31:523856..523889  ( + strand )
five_prime_UTR scaffold_31:524722..524771  ( + strand )
five_prime_UTR scaffold_31:527714..527805  ( + strand )
five_prime_UTR scaffold_31:529250..529320  ( + strand )
five_prime_UTR scaffold_31:529535..529731  ( + strand )
five_prime_UTR scaffold_31:529890..530016  ( + strand )
CDS scaffold_31:530017..530055  ( + strand )
CDS scaffold_31:530390..531250  ( + strand )
CDS scaffold_31:531559..531987  ( + strand )
CDS scaffold_31:532211..532294  ( + strand )
three_prime_UTR scaffold_31:532295..532525  ( + strand )

Sequences:

Gene

>Mapoly0031s0072.1
CGGGCGAGGAGATGGGAAGGTACAAAACACAAGAATTAGAGCGACAGGAGGAAACACCGTGGGTCTGGTTCATTCACTTCGTCTTCTCTCAGTGAGTGAAGGGAGAAGAGAGCGAATTGGAGCGGTTTGCCTGATATCGGAGAATTCATCGTTGCGAGTTCGTCTGCATACGATCAATTCGACTTTTTAGAAAGCTTGTAAGTATTAATTTACCCCGTCTTGACCTAGATCTGTGATATTCATTTATTCATTTGTATTACTTAATTGTTTACATGGATGTTCCTTGAAGATAGCGAAAGTGGATCTGAGTCGAAAGATCATAAAATTCCTGGAATCCCAGATACTGCTTCCACTGTCACTTTTCAGACGTGAAAAGAGGAATATTACTCCGTTGGAAAGTGGGATGGAAGGAAAGCATGAAAATTCCTGCTAGGTTGACCCATCACAGGTCAGATATTGGATTAGGGTTTAAGAGCTTTGGTTGTGGAGTTCTAGAATCGATTACAATAATTTGGCAGACTCTAGGGGGATTCTGCTCGATGATGTGAAGCCATCTCGTATTTTTCTTGTTTTATATCGATAATTTGTGGACCTGTGCTGCTATTAGGACCTTCATAATTTATTTGGGTATCATATATAGTATATGTGGGTCATCTCAAATGAAACAGACATTGTTATAAGAATACACGATCATAAGCCTTCTGGTTTTGTGGATATAAAATTTTCCATTAACATGTTTGAAGCCAGTTGGCTTGTCAGATAGTTCCACTGCGCAACGATGAACTTTGACTAGGAGAGAGGATGCTCATCAGGGCGGCCATCTCATCTTGAAAATGATGCACACACGAACATGACCAGTTAGTCTATAATCCTTGAGACGTTTCCTTTTCTTATCCTTTCTATTTCTTAGAGCATGATGTTAATTTGGGTCAAATATCTTCATTTGTCATCAGGAGTGGTTTTCAAGGATTTCAAAGGATTCGCCTTTGTCGATGATTCCGATAGGTCCACTTCTCACCCCACTAAAAAGAATGCTCAATAAATGTGTCCTGAATCTACAGAAGTAGATGCCTTGCATATGGCTATTGCATGTACATGTAGGACAATTCACTAGAAAGGTTACAGAGTCTTTACCATTACCATCTTTAACAGGGTCTTGCTCGTAGAGGGAGCACTGTCGATTTTCTGATCTTTTCGATGAATTATAAAACTTTCACAGGATACCTATATATTTTAGGATTGGATTGAGAATAGACTTCCTGTCATCTAATATTCTAGTTATTAAAGCTCCCAATTTTCAGTGTATAACAATCACCGACATTTAAGCCTATGCTTTGCCAAGAAGGCCTATCTAATATAATTGTCTCGGTATATTATCGTCGAGGATTGCTGTGATTTTATTACGACTAGCCTTCTAATGATCTTCAAGGAAATTGTGCTCAACACGTAAACATCGATGTTGAATATTCAGAGTGGGCGAATTCAGATAGTAAGATCTTTGCCATCATCATGTCACTGGTGGTTCATACTAGTGCAGCCTGTGTTCAGATGAACTGACGAACTTAAAGAGTTCGCATTCACAAATGTAACTATTCTTAACAACTCTCACAGTGACACACTTACATTTTGACATTGTTTTCTCATCCTCGCGAAAGAACTTTCACTCTATTCGTGACGCCGTGGAGAGTCATGCATATGTGATAGCTGCAAACGTCTAGACATATCGGGAGGGGATTCAAGTCTTAAGTCTTGACCCTTTGGCTCTAAAATATTAGGTACGCATCCTCGTTTCGGGCAAATACAGGCTTCAACGAGAATAGAGCAAAATCTCTAACAGGATTTGTCGTTCAAGGCCAGCCTACCTCCTACGAAAGTAGAAATTAGTTTGCTTAGATTGATCAAATCAGCCACCCTTTGAAAATATACCAATGGTGTTATTAAAACAGGGTCACGGATGAATGTTTGACGTGAAATTATTTTGAGTAGTCATTTCTCCCTTCTCGAAAGGCCTCCCTCTTTAAGATATATAAGCTTCTTTATACTTCAAGGTATACCGCACGCGAATCTTGTCAAATTTGAGGCCGATCGACGTCTCACAGTTAACAGGATCCCACGCAGAGGATGTTCCGGATGTAAATTGGGTATGCCCTTTAAGGATGTATGCGATTATCTGCTCTTTAAATAGATATGGTGAAAGAGGTTGAATCGACTGTTCATATTTTCAGTTTATTTTGGACTATATCTTGGAAATACAAATATGTGTTTGGCTCACCACTCCTTCTGAACATGTTTTCTTCTTTATCATCCGTTATCATCTGCTATTCACTTTGCATATGATACTTGCTTATGTTTGGGTCATTTGCAGGCTCAGTGTGATAACCCACCATGTCTGAAGTGGCGTGTATTGCCTCCCGGAACGGTCAAGAAATTAATTCGTGACTTGCTCAGCTCTTCTTGTGCTTGTAAAATGTATCATTAAGAAAAAGATACCAATTTCAACTTATTCAGATCAACCCATTAACACTCATGACTTTCCTGAACAGAAAAAATCTGGTACCTCCTTCACTCACGGTGCAGGTCAGTGCTCTGAGCTCGAAGAATCAGTATAAAGAATAGAGCTTACTAGCAAGATCTTAGAATGCAAGGTGTGAAACAAAATAATCTATTCTGTAGCACAAAGCCAGTAACCCGAACACCCGTATTTTCATATCTCTCTTTGCTAGATGAAGCATGAACGTTACTTTAAGATTATAATGCATCATATACAACCATCAAAATACGAATCAGATTTGATGTTGTTCCAAGATAGTAAATAAAAGTGAAAACTTTTCATGGAGACTGCAGAGAGATTTAAACCAGTAAAAAAGAAACTATAAGAAGTAAAGATGATCAACAAATATTATAAGTTATTCTACTTTCAAGTTGACGATAGCAAATAACCTAGTCTAGATGAAAAACTAAACTATTCCAACGAACAATCTTAAGAACAATCGAGTTTGCTTGTATGCACATAACCATAAAAAGTCAAGCATTCAAATCTTTAGATGCCTATAAACTGGTCACATAGGCTTTTGCTATGTCATAAAAATCATAGATTTCATGTCATCTTTACATTGATGTATATTTGTTTAATTGTTCGATCACAAGGTCTCTTGATGAGTGAGTGGATACAAAGTGTCAAAATGAGTCAGAAATGAACCGGAATAAACGATTGAAGCTCATGTCATCTAAATCATGCTATTATCAAGTTAAGCAATATCAAGTGGGTCCTGAGGCTTAAATTGTACGCAGTGGTTTCTTGGAGGCTTAATTTGGCTTACACCTCTTTATTTCAACTGGAAAGCACTAATATCTAGCAATATATTTCCTCTTATAGTTTCATCTCGATCCGGTGCTTTGATGTGGACAGTTATCTGCAGAGGGAAATGACATTCATATAACGTCGCACGCTTTGCAAAGGTAATTTCTCCATCATGACAAATGGTTGTAAGTCAGGTACATCATGCTCATGGTTGGCGACTTCCAATATAAAACTATTAGTTGTAAATGTCGACCCTAATATAAACACAACGAGTGGAACTTATATCACTAAATGCGTGCTCAGTGTGTTTAATATTAGTTTGCCAACTATTTAAAAGTTTCAGCTGCATGCCCGCGAAATTCTTGACTAGTGGTAAGTCGATCCTTTACCCAATGTGAAGGTTGTACATCACACGTATTTCACTGAATATGGAAGGTTCTAGAATAAATTTTCAAGTGTCCCTGGGGCAACCATATTGTACAACACGAAGAACCCAACGCAAACCACCGGTGGAAGATATTGCATTTGAATAAAAGATCTCCAATCCACGATATATGACCATATTTTCTATCGGAGGTCTAATTTATAGACGGCTCCTAGAGAGTGAAGCTTTTGAGCCTCAGTTTAACATTGAAAACTTTCGTGTTCGATATCTCTCAACTACAAGATTGAAATAAAATACGCTTTCCAGACCACAGTGGGATTTTTCTATCCCACCCTACCATCATATATTAGGGGTACTCTACACCTCGTACTTGTGCTCCACACATTGGTCATCACTCTTCAAACCGTAGAAAAGTTATATTTTTGCAATCCCATCGACTTGAGATAGAGATCCTGTTCGCAGATTGCAATGTGGTAATTGGACCATTGACGGGATACTTTCAACGAGGATATTCCAATCCAGACGCCGCAATAACAGTGGTTGAAAAGTGAGGGGTTGGCAGAGTTATTCCATTCATTGTCAAGACAAGAGATTTGCACATCTGGCGTTCATGACGATGATGTCTTGTTCTGATCATCACTCGTCCTTCGATTCCAGCGTATAGTTGGACTTTGCATCGGCCCTTGAAAGTCGGCCTTCTGCGGTAGCATGAGATGACCAGCCAACTGGAGAGGAAGACAGGTCCACTCAAAGTTTCTCTTTCACCGAAGGAACCTACATCGTGTACGCAACTAGATCTCCAGGACTTGTTTCGTTATCGATTGCAAGCCAGGTGAAAAAAATCATGCCGTGTAAAACCAATTAAAAACCTGGGCCGTTAAACGAGATCAGTGCCAATGCCATGCGCAATCTACCCAAACCTACTGAAGGTGGTTCGTTGTCTGGCAGAACACCGACTTGTCTGTACCGTAAAGCAACAGATTCTCTGCATGGTCTGTTCCAGTTTGCTCTGATCAGCTCTCCTAGTTGCAACTGTCGTCATCGACGCGGAGGTAGAAATGGCAGACTCCCTCTAGTTCCGCAGAGACGCACAGGGACATCGACAGAGATGTACCTCCTTCAAAGTGCTGGTCGAAGCCAGTCTTGTCACCGTTTCTTCTACGAAGTGTGCGAGCCATTGCATTTCGCTTGCTTCAAACGTTACGTTGCACCGACATGCAGACCCATTATCGATCCCTGTTGTACTAGCGCTCGTACATAGGTCCTTGATTGACTGCCCCATTCTCCTTTGAAGCTCTCTTCTTATCGCCTCCCTTCTTTTTGTTGTACTCTTCCTTCCCCTTTTTCTCAGTCGGTAAAACCGTATCACCAGACCAACATAAGACAAATCTACGACCTGGCAATCTTGTTCAGGAGCCCTGTGTGTCTCTTTGTCACTCTTAGAGTTTACTTCAGCCCCCAAATATGATTTAGCACTGGGAAATAATCATTCTCAGGTGTTTTCCCATACAAGAATTTGTTTTCGTCAGCTCGGCTCCTTCGTTTTTGGAAAAGACTCACTTTGGAGATTTGATCAGAGCTCTAGATCCTGAACCTTTTTCTATTTGAGCTTTGATGTAATCTGAGCTGATAATTTGAGCAAGTGGTGCGGTAATGATTTTATGTTGTGATGTTGTACCTTCTGATGTCCTTCATGGTTTATGGCGTACTGTACTATCTCGTGAGTCATTTTTGTACTCCCGCTAGAACAGCGAAGACACTGCATGTACTGACGGTACGTATGGTCACTGACCATCTTATCATTCTATGTTGACGACTCAGAGACGTAGAAATTTTCTTTCATAAAGCTCAAGTTGCAAACATGTCAGTCCTCGATTTGGGCCTGTCACTGTTTAATTTATTTGCCCTTAGGATCCGCCTACATGAATGACATCATAACTATCTTTGTAGAAAACATCATAAGACGATGGGTCTATGGTCTAAAATTAGAACTTACAGTAAGTTGATTTATTCCCTAAGATGCATTGAAGCATTATACGTGGATACCTATAAATAAGATAAAACACAGCACGTATATTTTCTCTGTTATTGGTTATCCTGGAATTGTAGAATAGTCATGGATGGTGAATCTCCTCATTGAAGTCAAGGAATGCTGCAGCAATTATCCGCTAATTGATCTCTTTTGCATACGCAATCACATCTTTGCCACTATTTTGATCATCAATTTGACGATCAAAAAAAGATCTGAAACTTTGTTCCTCATAAATCCTAATCTAAGCCCCAAACTCAGCTTTTCTCTTCAGACGAGACAATTACGAGGTCACAGCTATACCTTCTTTAGATGCAATGAAGGGTGAATTGAATACTCAGCTGCTTTTTATTTAATAAGCAAGTATATAATCTATGTTAGATTCATTCAAAAGAGTTACGCTTTGCTACTATTTGTTTTCATTCTCTCTATGACTTTTCAAGTCGACATCGTATCAATTAAGAAGACTGAAATAACTAAAGACTTACTGCGTTTTTTATGCGTCAGCAAGAATTCCAGCTACCATATGATTTAAGATTCAAAGCACTTTTATTCGCTTGTTTCATTTGAGAAATTTTACGATCATGTGTTATTTACTTCCTTATCATGACGTGCTCATCTGTATTATTATTGCTGAATTCACGCAAGTAAAGGACTAACGTGTGTGCTACGCTTGATTTCTACAGTATTTTTGGACAGCAAGTTCATTCTGAAGTTTGGCGCAGTACTTTGACCTCGGAAGATTGTTTTATGAATCCAACATCAAATATTTCAATAGGTGATTTTATCATTACTGTCATTCCCCTCGTCCAAATATTTTCCAGTGTAAAGATTCAGGATTGATTATTGCAAGATACACTGTAGAAAGTATATAAACCGGAATATTCATGTGATTTTCCTCCCTAATTCAGTACATGTTAACTTGTTGTTAAAAGTCACATAGATTGATGCTGTAATGTGATATGAGACTTGAGGATTTCCATTTCTCTCACTCCGAATTTAAACGATAGACCCCAGCTCGACTGTTAATCAGCAAGTATCTAAGACGCTATTCCTACAGAAATCAGTAGTCACTGGAAAGATTAAATGTGTTCACTAGATCGCTCAATAATCAATCCCATATATCAGAAAATGACCCCATACAATTTATATATATGCACTCGCTAGAAATTTGAAGCAAAGTGTCTCGAAGAACAAAGCAATGAAAACTACGTTCAGGAATAGTATTTACATCAAAAGTGCCTCAGTTTGAAAAAAATATCAGTCCTACATGTTAAAAATAATCGACATCAAAATACTCCAAATGCCAACGTTTTAACAAGTTATTTACATCTCACGTTTTTCTTTAAATCACTGTATTCATTGATCTTATTTTTCTGACATTAGTTTCAGAACGGTCATGGCTGATTACGTAGTATGGATCTGGAATATGTATTTCATATCGTAGTAAGCCTTCATAATCATTTAATGATTCGAATCAGACATGGTGTTCTGAATAGTATTCAACTCAATGTTGCAGAACCACATAAATTGAGATTAGATATTTCTCCAGCATATGAACTTTCACCGTATTCATCACCTTATTCTTTACATACGACACAATCAAATAGTGACAACTTTGACTTCTCCTTTGATAGGTTCTGAAGAATTTTAGCATATAGAAGATACCATCACATCACCGGAGGATAGTAAAGTAAGATAGTAAGAGACAGCTCAAAAATTCATATCCTCTGTTGCACAATCATCTTGAGCTCGACAAGATACAACTACTTCCGCACAGTCATCATCAGGTCGGACCAACGAATCATGTATAGTGATGTAGACATGTTCACTTACGATATGTTTTCTTCATTGAGGTTTAAAGAACAATTTCATGTCTATCTAGAGTTGCAAGGTTGCAAGGTTATGTAAAATACAGACATAGGAAAAAAACCACTATTATAGGTATAATGCCAGCCGAGATTTATTAAGTTTTCTTATCTCTTGGCTGGCTAAACCCTTATGGAACATGTCCATTATCTGAAGCCCATGCAACACGACATTGCAAGATTTCGGTTATTTCATTAATGTCAGGGGAAGCATTAAACCTGGGCGGGAACAGAGAGTTTCATTTGTTTCGTAGAAATGTCGAGCAATTCTGCTGCCGCGCCATGCGCCACGTCCAGTTCCTAGGAAGTAGACAATGGTCGATCAGCTACTGATTCCACTCTTATATTACTTAGGAGGTCAATTGGTCTCCTAGTCCTCGCATAGTGCTCGTCACGGCAGCTCTTCGGGATTCAAGCTCGCAAAGGTAATGCCCCCTCTTATTCAGTTCATTTTCAAGAAATTACTACCATGGAACATTGAAATCTTACAGGAACTTGTTGGATGAGAAATGATTCGAGCTTATTTTGCTATGTGTGAGTGAGAGTAGGCCTGCAGAGAGCCTCAGTTTCAAAGTTTCATCTGGAACCAAGTTTTGCTTGCTGACTGCGGGATATCTGTGACCATATGACCAAGGAAAGAGCTCCTTATGCTAAAATGTGAGCTTGCTGTAAAGTCGAGGGCAATAATATGGAAACCGAATCTCAGTAATTGCTGCTCATCAACACCCGTTCGAATTCCAGCGTTGTACTTGTTGAAGTCTTCTAGCTCAGTCACCAAATGCTCATCAGTCAGAACATGTAGTAAGTTGTGAACAGCATATCTAAACATTCACAGGGTATGATTCTCAGCCCCATATATTGTAACATTGTGCTCGTGGAATGCGTTAGTTCATATGACCAATGGAAAGCGCGGTCTGACGGGATGAGTCCAATATTCTCATACTGAATCTGTGTACATTCTTCTCATCTTCACCATTTACAACGATGTTCACAGGTGTAGTTTCGAAAATTCGCTCCTCGATAATGCATGAGGTACAATGTGAATGTCGGTGATAAGAGTATCTTAATCTGCCCCCCTGAAGTTCAAGTCATGCAGTAAGATACTGGTCCAATCGCTTCGGATGGACGGTGTTGTTCTGGACGATGGTTTGCTACAATCGGTACGCTTTCCTCTTGTACCTTAAATTTTGAAAATTTACAAGAAGCTAGATTCTTAGTTTAACAATGTGAAGCATAGTCTCCAGTAGAGGTATCTATGGCCTTAGGATATCAGGAAACATACCGCTTCAGACATAGCTGCAGACATGTACAGTGAAAACGCAATGAAAGCGAAGACAGTATTTCCATGAAGCCGTGGTCCACTACTATATGTTAGAATTCAAGTGCCAGAAAGTGGAAAAAATGCTCGAACATGACATACTACGATGGCCGTGGGCATCAGATATTGTTTGAGATACAAATGACTTATATTGTGAACCTTTCTGCATGTACCAGATTTTTCCGAAGAAAAAGCTGAATGCCATCTCCATCAAGTTGAATTCAGATGACACTGAAGACGTCAAGTTCAGGATCTCGGAAGATCATGAGCTTCCCCGTGACATTGAAGAATTTCTCTCATGTCCTGAAGGCGGCAGTCACATTGCAAGTCTTATGCAATTCATGGATTGCAGCAAACAACAGAACGGAGTGACTGGTAAACATGAGAGTGGAATCTGTAATCCCATGCTCTCTCGAGAAGTCAGCTGCAATAAGCTTACTATGGACGATGAGTTTTTCGAGAAGTCCCAAGGCGACCGAAACTCTCATTTGAATCCTACTGCTCAGAAATCTTCAGATGACTCCGCAAAACCTTCACAAGCGCAAGAAGGGAATCTTGGAAACCAACCTCCTTGCGATGATCAGGGCGCAGCTTTGGACATGGACGGGACATCAGCTGATGATTTAGTCCATTTCATTGAACAGATTTATTCAGAACAAGAAGACGGGGATTCTGGGTCGACTGAAATTATAGCCTCTCAAAATCAAGCAGCAAATAGTGGACGTGGAACTCCCGCCGTGTCCGCATTGGGTACAGAAGACGAGAAACAGGCCGTAGAAGTTGTTGGAACCGCTGGAGACGTATTCGCACCCTCCTCTCAGGTGAAGAAAAGAAAGCAGAAGAATCAAGCTTGTGGGGATGTCAAAGGAGTGAGTAAGAAGTCAAAAACGTCATCTTACAACAAAAAAGAAGCGAATAAAAGCTACCGGCTGGCTCATCGGAACGCCCACATTGTCGCTGAAAGGCTGCGTCGAAAACAAATGAATGAACATTTTTCTGCATTGAAAGACATTATACCTTCTTCGTATATACCCAGGGTAAGTGCTTTCAGCTCAATAATACCGGCCTTTAGAATTTCGACTCATGTTGTACTCTACCATATTGTCATGCGCCTCGTTATATATGTTTCAGGTAGATGATAGAAAGCTTCAAGGCAATAACTTTGGAATTAATGACGTTTTCCAAACTAAGGTGATACATTGCTCAACATGCTTTTGAGACGATTCAATCCTTATACCTGTAGCGATTTCAAGTGGTTGATGGATTTCAGATGGTCGGAAATCGACCTTGCCCCTCTAAGGTTGAGTCATACTCATCGAGGTATAGATTGGTTTGTGTCCAGCAGCTTGACCAAGCAACAATTCTTGCTGCAGCTGTCAATCTGGTGAGAGACTTGGAACACTTGGTGAAACGACTGCAAGATCAAAAGAATCAAGCATCGCTTTCGGTCTCCCCCTGCAATAGCAGCCTCGTCGCAGAATCCCACTCTCACGAAAGCCCTATATCCACCATTCAGAGCACGAGTGCAGATGTCCCATGGATAGACGTGGAAAGCGGACTATACGGTCAGCTGCATGCCAATTTGAAATCATCGGCTGGAGAAGTTGAGGTGCAGATTACGCAAAATGATGTTTCTGTTACAATTTACACCTTGAGGAAACGAAAAAATCAGGTGATTTTATTACTGGAGGTCTTCCAGGATCTTCAGCTCATTCTATCTCATCTCAGTATCTCCACAGATGGAAACCAGGCACTTTACAAACTTCAAGCAGAGGTATAACTCTTCTTTTCTCATTGAAAAACATGTCGTGCATGTTAGCTCACCAAACTTGCTAGTCTAGACTAACCAGGCTATCAAATTATGACAACTTGAACAATTTTATCATTTGGAGTACTCTTCAAGTTTCTTGCCATTAGTTTTGCTTTACTTTTGTAATATGCTTATGGAATTAGGCACTTTGTTAAGATTTTGATTAAAAAATGCTCTTCTTCTGCAGATCTCAATGAGAGTGAATGCAAAGGTGATAGCAAGTCGGATACATGAATCACTGCTCAATCTTCAATTTGAGAACATGGGTTAAAATCTCCCTGGTGTTGATACTATTGTTGCAGAATATGGGTTTGAATTTATCTTTAATGTAGTGCTGTACATATTTTAGACATATTTTCAATTTAATTTTTCAACAGTGTTTAACTTGCTTGGATGAATTCTCCAGTTTCACTTTGTTATAAAAGTTAGAAAGTAGATTATTAGAGCTATTGTTGTAAGTCTAGAATTATTCAGACTTAATGATGATTTTCATGAAACTAGC

mRNA

>Mapoly0031s0072.1
CGGGCGAGGAGATGGGAAGGTACAAAACACAAGAATTAGAGCGACAGGAGGAAACACCGTGGGTCTGGTTCATTCACTTCGTCTTCTCTCAGTGAGTGAAGGGAGAAGAGAGCGAATTGGAGCGGTTTGCCTGATATCGGAGAATTCATCGTTGCGAGTTCGTCTGCATACGATCAATTCGACTTTTTAGAAAGCTTAAAAAATCTGGTACCTCCTTCACTCACGGTGCAGTTATCTGCAGAGGGAAATGACATTCATATAACGTCGCACGCTTTGCAAAGTATTTTTGGACAGCAAGTTCATTCTGAAGTTTGGCGCAGTACTTTGACCTCGGAAGATTGTTTTATGAATCCAACATCAAATATTTCAATAGGAGGTCAATTGGTCTCCTAGTCCTCGCATAGTGCTCGTCACGGCAGCTCTTCGGGATTCAAGCTCGCAAAGAGCTCCTTATGCTAAAATGTGAGCTTGCTGTAAAGTCGAGGGCAATAATATGGAAACCGAATCTCAGTAATTGCTGCTCATCAACACCCGTTCGAATTCCAGCGTTGTACTTGTTGAAGTCTTCTAGCTCAGTCACCAAATGCTCATCAGTCAGAACATGTAGTAAGTTGTGAACAGCATATCTAAACATTCACAGGGTGTAGTTTCGAAAATTCGCTCCTCGATAATGCATGAGGTACAATGTGAATGTCGGTGATAAGAGTATCTTAATCTGCCCCCCTGAAGTTCAAGTCATGCAGTAAGATACTGGTCCAATCGCTTCGGATGGACGGTGTTGTTCTGGACGATGGTTTGCTACAATCGATTTTTCCGAAGAAAAAGCTGAATGCCATCTCCATCAAGTTGAATTCAGATGACACTGAAGACGTCAAGTTCAGGATCTCGGAAGATCATGAGCTTCCCCGTGACATTGAAGAATTTCTCTCATGTCCTGAAGGCGGCAGTCACATTGCAAGTCTTATGCAATTCATGGATTGCAGCAAACAACAGAACGGAGTGACTGGTAAACATGAGAGTGGAATCTGTAATCCCATGCTCTCTCGAGAAGTCAGCTGCAATAAGCTTACTATGGACGATGAGTTTTTCGAGAAGTCCCAAGGCGACCGAAACTCTCATTTGAATCCTACTGCTCAGAAATCTTCAGATGACTCCGCAAAACCTTCACAAGCGCAAGAAGGGAATCTTGGAAACCAACCTCCTTGCGATGATCAGGGCGCAGCTTTGGACATGGACGGGACATCAGCTGATGATTTAGTCCATTTCATTGAACAGATTTATTCAGAACAAGAAGACGGGGATTCTGGGTCGACTGAAATTATAGCCTCTCAAAATCAAGCAGCAAATAGTGGACGTGGAACTCCCGCCGTGTCCGCATTGGGTACAGAAGACGAGAAACAGGCCGTAGAAGTTGTTGGAACCGCTGGAGACGTATTCGCACCCTCCTCTCAGGTGAAGAAAAGAAAGCAGAAGAATCAAGCTTGTGGGGATGTCAAAGGAGTGAGTAAGAAGTCAAAAACGTCATCTTACAACAAAAAAGAAGCGAATAAAAGCTACCGGCTGGCTCATCGGAACGCCCACATTGTCGCTGAAAGGCTGCGTCGAAAACAAATGAATGAACATTTTTCTGCATTGAAAGACATTATACCTTCTTCGTATATACCCAGGCTTGACCAAGCAACAATTCTTGCTGCAGCTGTCAATCTGGTGAGAGACTTGGAACACTTGGTGAAACGACTGCAAGATCAAAAGAATCAAGCATCGCTTTCGGTCTCCCCCTGCAATAGCAGCCTCGTCGCAGAATCCCACTCTCACGAAAGCCCTATATCCACCATTCAGAGCACGAGTGCAGATGTCCCATGGATAGACGTGGAAAGCGGACTATACGGTCAGCTGCATGCCAATTTGAAATCATCGGCTGGAGAAGTTGAGGTGCAGATTACGCAAAATGATGTTTCTGTTACAATTTACACCTTGAGGAAACGAAAAAATCAGGTGATTTTATTACTGGAGGTCTTCCAGGATCTTCAGCTCATTCTATCTCATCTCAGTATCTCCACAGATGGAAACCAGGCACTTTACAAACTTCAAGCAGAGATCTCAATGAGAGTGAATGCAAAGGTGATAGCAAGTCGGATACATGAATCACTGCTCAATCTTCAATTTGAGAACATGGGTTAAAATCTCCCTGGTGTTGATACTATTGTTGCAGAATATGGGTTTGAATTTATCTTTAATGTAGTGCTGTACATATTTTAGACATATTTTCAATTTAATTTTTCAACAGTGTTTAACTTGCTTGGATGAATTCTCCAGTTTCACTTTGTTATAAAAGTTAGAAAGTAGATTATTAGAGCTATTGTTGTAAGTCTAGAATTATTCAGACTTAATGATGATTTTCATGAAACTAGC

CDS

>Mapoly0031s0072.1
ATGGACGGTGTTGTTCTGGACGATGGTTTGCTACAATCGATTTTTCCGAAGAAAAAGCTGAATGCCATCTCCATCAAGTTGAATTCAGATGACACTGAAGACGTCAAGTTCAGGATCTCGGAAGATCATGAGCTTCCCCGTGACATTGAAGAATTTCTCTCATGTCCTGAAGGCGGCAGTCACATTGCAAGTCTTATGCAATTCATGGATTGCAGCAAACAACAGAACGGAGTGACTGGTAAACATGAGAGTGGAATCTGTAATCCCATGCTCTCTCGAGAAGTCAGCTGCAATAAGCTTACTATGGACGATGAGTTTTTCGAGAAGTCCCAAGGCGACCGAAACTCTCATTTGAATCCTACTGCTCAGAAATCTTCAGATGACTCCGCAAAACCTTCACAAGCGCAAGAAGGGAATCTTGGAAACCAACCTCCTTGCGATGATCAGGGCGCAGCTTTGGACATGGACGGGACATCAGCTGATGATTTAGTCCATTTCATTGAACAGATTTATTCAGAACAAGAAGACGGGGATTCTGGGTCGACTGAAATTATAGCCTCTCAAAATCAAGCAGCAAATAGTGGACGTGGAACTCCCGCCGTGTCCGCATTGGGTACAGAAGACGAGAAACAGGCCGTAGAAGTTGTTGGAACCGCTGGAGACGTATTCGCACCCTCCTCTCAGGTGAAGAAAAGAAAGCAGAAGAATCAAGCTTGTGGGGATGTCAAAGGAGTGAGTAAGAAGTCAAAAACGTCATCTTACAACAAAAAAGAAGCGAATAAAAGCTACCGGCTGGCTCATCGGAACGCCCACATTGTCGCTGAAAGGCTGCGTCGAAAACAAATGAATGAACATTTTTCTGCATTGAAAGACATTATACCTTCTTCGTATATACCCAGGCTTGACCAAGCAACAATTCTTGCTGCAGCTGTCAATCTGGTGAGAGACTTGGAACACTTGGTGAAACGACTGCAAGATCAAAAGAATCAAGCATCGCTTTCGGTCTCCCCCTGCAATAGCAGCCTCGTCGCAGAATCCCACTCTCACGAAAGCCCTATATCCACCATTCAGAGCACGAGTGCAGATGTCCCATGGATAGACGTGGAAAGCGGACTATACGGTCAGCTGCATGCCAATTTGAAATCATCGGCTGGAGAAGTTGAGGTGCAGATTACGCAAAATGATGTTTCTGTTACAATTTACACCTTGAGGAAACGAAAAAATCAGGTGATTTTATTACTGGAGGTCTTCCAGGATCTTCAGCTCATTCTATCTCATCTCAGTATCTCCACAGATGGAAACCAGGCACTTTACAAACTTCAAGCAGAGATCTCAATGAGAGTGAATGCAAAGGTGATAGCAAGTCGGATACATGAATCACTGCTCAATCTTCAATTTGAGAACATGGGTTAA

Protein

>Mapoly0031s0072.1
MDGVVLDDGLLQSIFPKKKLNAISIKLNSDDTEDVKFRISEDHELPRDIEEFLSCPEGGSHIASLMQFMDCSKQQNGVTGKHESGICNPMLSREVSCNKLTMDDEFFEKSQGDRNSHLNPTAQKSSDDSAKPSQAQEGNLGNQPPCDDQGAALDMDGTSADDLVHFIEQIYSEQEDGDSGSTEIIASQNQAANSGRGTPAVSALGTEDEKQAVEVVGTAGDVFAPSSQVKKRKQKNQACGDVKGVSKKSKTSSYNKKEANKSYRLAHRNAHIVAERLRRKQMNEHFSALKDIIPSSYIPRLDQATILAAAVNLVRDLEHLVKRLQDQKNQASLSVSPCNSSLVAESHSHESPISTIQSTSADVPWIDVESGLYGQLHANLKSSAGEVEVQITQNDVSVTIYTLRKRKNQVILLLEVFQDLQLILSHLSISTDGNQALYKLQAEISMRVNAKVIASRIHESLLNLQFENMG

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>