Mapoly0031s0076



Description

MYC

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR11514 MYC
PANTHER PTHR11514:SF29

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH37 transcription factor, bHLH Mapoly0031s0076.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0031s0076.1 scaffold_31:557048..562258  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0031s0076.1  

Gene structure:

mRNA scaffold_31:557048..562258  ( + strand )
five_prime_UTR scaffold_31:557048..558336  ( + strand )
five_prime_UTR scaffold_31:558502..559328  ( + strand )
five_prime_UTR scaffold_31:559553..559623  ( + strand )
CDS scaffold_31:559624..561087  ( + strand )
CDS scaffold_31:561223..561633  ( + strand )
CDS scaffold_31:561829..561903  ( + strand )
three_prime_UTR scaffold_31:561904..562258  ( + strand )

Sequences:

Gene

>Mapoly0031s0076.1
AACTGTCTCCAGCTCAATTGCTTCATGCTTTCGTTGATGACTCCAGGCACACATTTTATTTCAGGAAAATTTAGAATTCCAGATTTCTTTGACGGCAACGAGAGCCGGCCATGGATTGTAGAACTCTCAGCTTGATTCTAACTTTATGAAGGAGAAGCAGTAAATATCGGTGCGATGGTAACAACTGATGTAAATCTCGGATCGAAGGCTACTTGACGACGACGAGGAAGCAGATAGTGAGAAAATGGAGGGGCGTGAAAAAATTCTAATTGTGCTGGTGGTCAATCCTGTGAACCCGGAACTGACCTCAGGTCAAAGACGAGTTAGTAACGATTTCGCGTTCGAGGAAATTAGTGGTCCCGCACTTGCATTTGCAAGTAGGGAGCAAAAAGGTCGAGATTCGCCATGACTAGAAAGATAGCTCGTTAATCTTGATCACGCATTGTGTGCACTTGTCCACGTGAAGGACAGATCCTGCTAGCATCTGAGAAGCTCCAGTTGGAGAGGAAATATGTTACTCAGCGACCGGACAGAGGACAGCCTTTGAGGTCCTCAAATTGTAAGTACTGTAGAATTTGAGCGACACTTGCAGATGGTGCAGGACTGTCAGGTACCACCAGTCCTCGGGTCTCATTCTCATACCTGCCTTCTGCCTCTCTTGACGGCGGATTGGAGTCGTCAGTCTCTTTTCCTGCACTATATATCAGTGTCACCGTGTTCTGTTGGTGACCAGGATTCCCCGATGCAGTATCTCAAGGATAGGCACGGATGGAGGAAAAGGTATGGGCTTGAATCCCGGTGGGCCCAATGGGAGCGGAGGAGAAGGGAATTCCGCAGTATTTCCTTAGAGAGCAATTAGAGCGGCAGTTCGATCGATTCACTCCCTTCTCCCGAACTATCGTAGAAAGACGAGCGTAGAAGTCATGACAAAATCTATCCTCAGTCCCAGAATTCCGGTAAGAAGTCGCAAGCGATCGGACGAAATCTGATTCTTTGTAATGCTCACCGGGATTGTCGTTAGGAAATCGCTTGATGCTGACGGCAGTTTGGAGAAGCCGCATTAATTGCGAGTTCAAATTCTAATCTCTCCGTTTGAGGCTGTAATATGGTTTCCACATATCAAGATATATAGTCGATCGTGGTCAGTGGGGCCACAAGGACGCGCAAGGCTGATGGTGCTTGCTCGTACATACGTAAGCGTATCATAAGACTCTCCGATGAATGATGAGGTTTCGAAAGCCGCTGAATCGTCCGCACCAGTCTGAGAGCTTCCTTCGATTTTTCTCAAGGTAATACACGAACTGCAATCGAAGTTCGGATACAGAATCTGTCTGCTGCTGGTTCACACGAGGTCTTAGCTGTGGTGATTGTCCATCCCTCAGTGTAGCAATGACGAATTAAGGTCATAGTTGCTAGCTTTCTGACGATTTCCAATCTGTTCTAGCACAATGCAGATATCCTTGAGGTTCGAATTTCTGGCGAAGACAAACATTACACAGAAGGGAGACAGGCTTGTCGACTTTTATCGGGCGATCTGTGGTGTCCTTGCTTTGGAAGCCTTAGGCAAGCTTTCGCAGAGATGATAACCAAACATGCTCACTCTACATCCTTGTGATATAAACCGTTGTTTAGTTTTCGTTGATCCATTCTCGGAGAGGATTTCAGCACTCAAAAATCATAGCACTCTCTCCCTGGACAACCCTCGAGCTCTTGATCTTCCTAGACGGGATTGCCATTTCTAGGTCTGATTCAGACTCGTCTGACTTACCTGCATGTAGCTTCTCACAGTTCATCTCAAGCTGTTGCTTACAGAATGGTCTAAGTTGGTGCTCTCATGATAGAAGACCCGCTCGCTCGCTCGCATCTGGGACTCATGGTAAACCAGAATTTAGCCTTAGAAGGAGTCCATCCTTATTTTAGTAATGTTAGGAATCTTCTGAAGTGAAGTGCAGTACTCTCAAACTTGCTTACAAGAGAAATGCAGGGGCCGCCTCTTTCAATCTTTAACATCTGACCAGTTTCCATTTCAAACATGTCCAAGCCTTCTCAATAGTCCTTCAGATCTTCTAATCGAAACTTCAGGTCCTCTATCTTCATTCTAGCATTCTAGCTTCTCGGCATCAGTATTGAGCAATCGACGATCCCTACGCGCTTATGCATAGCAAAGAGGAGATTCGGAGCTCTCTACGAGCATGCAGCAGGTACAAGCATCGTCAACAACCCGAGCACGTTCAGAGGCAGTCGAAGCGGAACAGTATAGAAACGCCTTCAATATTCACAGGTGGGTTATGTTCGATCGAGGAGAATTACATGAGAATCATGCTAGGTTCAGAAACTCTTTGATTTACTAAGTAGACGTGCTAGCCAAATTTGATAGAAGAGTCTGATCATGAGGCATGATCTGATCCTAGGTCATCTTTGCCTGTTAATGCAAGAATGGAGTTTACCCTTTTGGCAAGGACTTTCCTGGAATCTCACGCACTTATTTTGCTATTTTGTGTTCAGAGGTAGACGTCGAAACCAGTCCTTGATGTACAAAGTACAACACTTGAGATTCTTGAGCAGTACAGATTTTGATGGAAAGAATCGAAGCCGGAGTAGAGATGTCTTCCTTCAATTTCCACGGTGGAGATTTCTGTCAGTCTGAGATGGGTGCATATGCTGATCAAGAAGATCAGGACATACGAGCGGAGATGCAGGCGATCACTGATCCAGGTCTGAACAATGTACTACTTGGTCTATCGGATGCGCTGGACACAATACCACGATCTCGCTACGTCGGGCTTACATTAGGAGATCTTCCATTGACGAACATGAATGGATCCGGATCGGAGAATTTCAATGCCAACCGTGCAATGTCGGATCAGCAGAACATGGCCAACCATGATCATCCTCCAGACGGGCTTTCGTTCCCAGTGGACGCTTCGCACCGACAGGGCGAGAATGATAACCATCTCGCTATGCAGGAGATTAGAATGATCCATCAGTCGGAACTGGAGAATGAACAGCAGCAGGAGCGGGAACAGCAGCATCATCAACATCATCAACATCATCAACTCATGACCGAAAATGGTCCTACAGACGCCTTTCATGAACAGTCCTCTGAAACAAAAAATTGTCCAGGCTACAGTTATGACCAGAAGAGTGGAGGGCATGGATTTATGACGGCCTGGGAAGAGAGTGTGAAATACATGGAAGATTTGCGGCAGCTGCAGGAATTACAAGCTCAGCAACAGCCTCGTGCTCAGCCAATTGCAAATAGAGTACAGCCCAACAACGACATTTTCAGCTTGGAGAACTTGGGAGGACTCTCTGCTGGAATTCAAGCTTTCAACAGCTTCTCTGAGCTCGAAAAAATCAGTGAAGGGCATGATCTAAAAGACAAGTTGCCTGCGGAAGTCTTCAATCTTCTTCAGCAGCCTTCGCATTCAATAAGTCCTTCATGTTCTACTGGGCTAGCATTTGCCTCGAGTTCTGGATCAGTGTATCCATCGGTCTCAAATTTCAAAAGACCCACTGGGCCAGTGAACTCTTGTCATGTGCATGTTCCGATGCCAAATCCACATGGTTATCAGCTAATGGACAGGGGGACAAATTCGAGTCTCTTCGGTGGTAATGGTATACAAGCTCCTGCAGTGGCATATCCAGGGCCTTTTACAAAGCTCTTAAATTACAACAATGTTCCAGGAGGTAGCTCAAGAAATTATTCCAAGATCTTCAATTACAACTCTCCTGCAGCTAGTGGCCCTGGGTTTTTTCCTACAGATCTTCCCCCAACCAAATCTGGTTCCAATGTCGATCTGCTGCAGCTGGAGTATGGTCATAACGAGGAGCTTCAAGATGTTTTTGGTGCTGCTCAAATGACAGCACCATCTCACTTCTTGCCTGAGATACCAAGACGTACTAAAAGCGCTTCTGGAAGGCTAACTAACGAAGCTGAGCAAAAACCACTGCACCATTTTGCCACAGAGAGACAAAGACGGGAACATTTGAACGAGAAGTATCAGACCCTGCGATCTTTGGTTCCAAACCCTACTAAGGTCCGTCTACATCCTTGGAATTTTTTATTAGATCTTAGGTCTGCTCTTGTACTTCTTCGCTATCTCTTCTAGTATATGCATATGCATTCTGATATAAAGTTATCCTCATTGTTTGTTGTATGTCCATGCCTGTAGGCTGATCGAGCTTCCATTGTCTCAGATGCTATCAATAGAATACATGATCTGAAAAAAGAAGAAGAAGGTTTGATGGATGAAAAGAAAAACAGACAACTTCGGAGACAATTGAGGCTTGAGATGAGAGCCAATGGAAAACGTCAGAGAGCTGAGGAATCCGAAACAGCTGTCAAAGAAGACGGAGAAAGCTTGTGTCTGAAAGCACTGTGGAGCAAAAAGGTTTCCAAACATGGGACGGAGATCGAAGTTCGCATAGTTTGTGATGAGGTGGATATCCACATCAGGCAGAAACATATGCCCCGATTTCTTATCCGAGTAATAACAGCCGTAGAAAGAGGGCTGAAGCTTGAAATCCTTGATGGAACTGGCGGTGTTATCCACAATTGTGATGTTTACAGATTCAAACTGAAGGTAATATATCTTCATCTGAGAGACTCTGGACATATGAAAAACTGGAACCCAGGTTCTATTTTCTGTCCTCCTGAAAACAGTACATCTTGCTGTATATTTCAAGTTCTAGTAGCTCTCGAGTTTCTACTCGAGTAGCTTGTATCTGGAACAGTTTTTTGTTAATAGTTTTGACTATAAAGTGTACTTTTTTGCCAGATTCAAGGAGATTCGTGCGCTTTCATGGGAGTAATCATGGCGAAACTTCTAGAGATATTGGATACGGTTTTCTGAAGAACGATTCTACTCTCACTCCTATTTGCAAAAGCATATAACTCAAGGAGCTTCCAGGAATTTGAAACCTCAGGATCATGCACTTTAAAAGCCTGAATTGGTTTCTGTGATCTATTCTGATGATTTATATTCTATAAATAAATATTTGGTACTAGTACTGGTTCACAAGATGCAGGATCCTGGAAGCATTTTTTGTACAGATGGTCATATTGGCATTTGGATCTTAGTATAAAGATTCTTGCTCAAATGGTCTGCGGACTGGATGACAGCAGTACCAGGAAAGATAAATTATGCTCGACATGTAAACGTCAGTCTATCTGCGTTTTTAAAAATTCTAAAGTTTGACAATAAATCC

mRNA

>Mapoly0031s0076.1
AACTGTCTCCAGCTCAATTGCTTCATGCTTTCGTTGATGACTCCAGGCACACATTTTATTTCAGGAAAATTTAGAATTCCAGATTTCTTTGACGGCAACGAGAGCCGGCCATGGATTGTAGAACTCTCAGCTTGATTCTAACTTTATGAAGGAGAAGCAGTAAATATCGGTGCGATGGTAACAACTGATGTAAATCTCGGATCGAAGGCTACTTGACGACGACGAGGAAGCAGATAGTGAGAAAATGGAGGGGCGTGAAAAAATTCTAATTGTGCTGGTGGTCAATCCTGTGAACCCGGAACTGACCTCAGGTCAAAGACGAGTTAGTAACGATTTCGCGTTCGAGGAAATTAGTGGTCCCGCACTTGCATTTGCAAGTAGGGAGCAAAAAGGTCGAGATTCGCCATGACTAGAAAGATAGCTCGTTAATCTTGATCACGCATTGTGTGCACTTGTCCACGTGAAGGACAGATCCTGCTAGCATCTGAGAAGCTCCAGTTGGAGAGGAAATATGTTACTCAGCGACCGGACAGAGGACAGCCTTTGAGGTCCTCAAATTGTAAGTACTGTAGAATTTGAGCGACACTTGCAGATGGTGCAGGACTGTCAGGTACCACCAGTCCTCGGGTCTCATTCTCATACCTGCCTTCTGCCTCTCTTGACGGCGGATTGGAGTCGTCAGTCTCTTTTCCTGCACTATATATCAGTGTCACCGTGTTCTGTTGGTGACCAGGATTCCCCGATGCAGTATCTCAAGGATAGGCACGGATGGAGGAAAAGGTATGGGCTTGAATCCCGGTGGGCCCAATGGGAGCGGAGGAGAAGGGAATTCCGCAGTATTTCCTTAGAGAGCAATTAGAGCGGCAGTTCGATCGATTCACTCCCTTCTCCCGAACTATCGTAGAAAGACGAGCGTAGAAGTCATGACAAAATCTATCCTCAGTCCCAGAATTCCGGTAAGAAGTCGCAAGCGATCGGACGAAATCTGATTCTTTGTAATGCTCACCGGGATTGTCGTTAGGAAATCGCTTGATGCTGACGGCAGTTTGGAGAAGCCGCATTAATTGCGAGTTCAAATTCTAATCTCTCCGTTTGAGGCTGTAATATGGTTTCCACATATCAAGATATATAGTCGATCGTGGTCAGTGGGGCCACAAGGACGCGCAAGGCTGATGGTGCTTGCTCGTACATACGTAAGCGTATCATAAGACTCTCCGATGAATGATGAGGTTTCGAAAGCCGCTGAATCGTCCGCACCAGTCTGAGAGCTTCCTTCGATTTTTCTCAAGATATCCTTGAGGTTCGAATTTCTGGCGAAGACAAACATTACACAGAAGGGAGACAGGCTTGTCGACTTTTATCGGGCGATCTGTGGTGTCCTTGCTTTGGAAGCCTTAGGCAAGCTTTCGCAGAGATGATAACCAAACATGCTCACTCTACATCCTTGTGATATAAACCGTTGTTTAGTTTTCGTTGATCCATTCTCGGAGAGGATTTCAGCACTCAAAAATCATAGCACTCTCTCCCTGGACAACCCTCGAGCTCTTGATCTTCCTAGACGGGATTGCCATTTCTAGGTCTGATTCAGACTCGTCTGACTTACCTGCATGTAGCTTCTCACAGTTCATCTCAAGCTGTTGCTTACAGAATGGTCTAAGTTGGTGCTCTCATGATAGAAGACCCGCTCGCTCGCTCGCATCTGGGACTCATGGTAAACCAGAATTTAGCCTTAGAAGGAGTCCATCCTTATTTTAGTAATGTTAGGAATCTTCTGAAGTGAAGTGCAGTACTCTCAAACTTGCTTACAAGAGAAATGCAGGGGCCGCCTCTTTCAATCTTTAACATCTGACCAGTTTCCATTTCAAACATGTCCAAGCCTTCTCAATAGTCCTTCAGATCTTCTAATCGAAACTTCAGGTCCTCTATCTTCATTCTAGCATTCTAGCTTCTCGGCATCAGTATTGAGCAATCGACGATCCCTACGCGCTTATGCATAGCAAAGAGGAGATTCGGAGCTCTCTACGAGCATGCAGCAGGTACAAGCATCGTCAACAACCCGAGCACGTTCAGAGGCAGTCGAAGCGGAACAGTATAGAAACGCCTTCAATATTCACAGAGGTAGACGTCGAAACCAGTCCTTGATGTACAAAGTACAACACTTGAGATTCTTGAGCAGTACAGATTTTGATGGAAAGAATCGAAGCCGGAGTAGAGATGTCTTCCTTCAATTTCCACGGTGGAGATTTCTGTCAGTCTGAGATGGGTGCATATGCTGATCAAGAAGATCAGGACATACGAGCGGAGATGCAGGCGATCACTGATCCAGGTCTGAACAATGTACTACTTGGTCTATCGGATGCGCTGGACACAATACCACGATCTCGCTACGTCGGGCTTACATTAGGAGATCTTCCATTGACGAACATGAATGGATCCGGATCGGAGAATTTCAATGCCAACCGTGCAATGTCGGATCAGCAGAACATGGCCAACCATGATCATCCTCCAGACGGGCTTTCGTTCCCAGTGGACGCTTCGCACCGACAGGGCGAGAATGATAACCATCTCGCTATGCAGGAGATTAGAATGATCCATCAGTCGGAACTGGAGAATGAACAGCAGCAGGAGCGGGAACAGCAGCATCATCAACATCATCAACATCATCAACTCATGACCGAAAATGGTCCTACAGACGCCTTTCATGAACAGTCCTCTGAAACAAAAAATTGTCCAGGCTACAGTTATGACCAGAAGAGTGGAGGGCATGGATTTATGACGGCCTGGGAAGAGAGTGTGAAATACATGGAAGATTTGCGGCAGCTGCAGGAATTACAAGCTCAGCAACAGCCTCGTGCTCAGCCAATTGCAAATAGAGTACAGCCCAACAACGACATTTTCAGCTTGGAGAACTTGGGAGGACTCTCTGCTGGAATTCAAGCTTTCAACAGCTTCTCTGAGCTCGAAAAAATCAGTGAAGGGCATGATCTAAAAGACAAGTTGCCTGCGGAAGTCTTCAATCTTCTTCAGCAGCCTTCGCATTCAATAAGTCCTTCATGTTCTACTGGGCTAGCATTTGCCTCGAGTTCTGGATCAGTGTATCCATCGGTCTCAAATTTCAAAAGACCCACTGGGCCAGTGAACTCTTGTCATGTGCATGTTCCGATGCCAAATCCACATGGTTATCAGCTAATGGACAGGGGGACAAATTCGAGTCTCTTCGGTGGTAATGGTATACAAGCTCCTGCAGTGGCATATCCAGGGCCTTTTACAAAGCTCTTAAATTACAACAATGTTCCAGGAGGTAGCTCAAGAAATTATTCCAAGATCTTCAATTACAACTCTCCTGCAGCTAGTGGCCCTGGGTTTTTTCCTACAGATCTTCCCCCAACCAAATCTGGTTCCAATGTCGATCTGCTGCAGCTGGAGTATGGTCATAACGAGGAGCTTCAAGATGTTTTTGGTGCTGCTCAAATGACAGCACCATCTCACTTCTTGCCTGAGATACCAAGACGTACTAAAAGCGCTTCTGGAAGGCTAACTAACGAAGCTGAGCAAAAACCACTGCACCATTTTGCCACAGAGAGACAAAGACGGGAACATTTGAACGAGAAGTATCAGACCCTGCGATCTTTGGTTCCAAACCCTACTAAGGCTGATCGAGCTTCCATTGTCTCAGATGCTATCAATAGAATACATGATCTGAAAAAAGAAGAAGAAGGTTTGATGGATGAAAAGAAAAACAGACAACTTCGGAGACAATTGAGGCTTGAGATGAGAGCCAATGGAAAACGTCAGAGAGCTGAGGAATCCGAAACAGCTGTCAAAGAAGACGGAGAAAGCTTGTGTCTGAAAGCACTGTGGAGCAAAAAGGTTTCCAAACATGGGACGGAGATCGAAGTTCGCATAGTTTGTGATGAGGTGGATATCCACATCAGGCAGAAACATATGCCCCGATTTCTTATCCGAGTAATAACAGCCGTAGAAAGAGGGCTGAAGCTTGAAATCCTTGATGGAACTGGCGGTGTTATCCACAATTGTGATGTTTACAGATTCAAACTGAAGATTCAAGGAGATTCGTGCGCTTTCATGGGAGTAATCATGGCGAAACTTCTAGAGATATTGGATACGGTTTTCTGAAGAACGATTCTACTCTCACTCCTATTTGCAAAAGCATATAACTCAAGGAGCTTCCAGGAATTTGAAACCTCAGGATCATGCACTTTAAAAGCCTGAATTGGTTTCTGTGATCTATTCTGATGATTTATATTCTATAAATAAATATTTGGTACTAGTACTGGTTCACAAGATGCAGGATCCTGGAAGCATTTTTTGTACAGATGGTCATATTGGCATTTGGATCTTAGTATAAAGATTCTTGCTCAAATGGTCTGCGGACTGGATGACAGCAGTACCAGGAAAGATAAATTATGCTCGACATGTAAACGTCAGTCTATCTGCGTTTTTAAAAATTCTAAAGTTTGACAATAAATCC

CDS

>Mapoly0031s0076.1
ATGGAAAGAATCGAAGCCGGAGTAGAGATGTCTTCCTTCAATTTCCACGGTGGAGATTTCTGTCAGTCTGAGATGGGTGCATATGCTGATCAAGAAGATCAGGACATACGAGCGGAGATGCAGGCGATCACTGATCCAGGTCTGAACAATGTACTACTTGGTCTATCGGATGCGCTGGACACAATACCACGATCTCGCTACGTCGGGCTTACATTAGGAGATCTTCCATTGACGAACATGAATGGATCCGGATCGGAGAATTTCAATGCCAACCGTGCAATGTCGGATCAGCAGAACATGGCCAACCATGATCATCCTCCAGACGGGCTTTCGTTCCCAGTGGACGCTTCGCACCGACAGGGCGAGAATGATAACCATCTCGCTATGCAGGAGATTAGAATGATCCATCAGTCGGAACTGGAGAATGAACAGCAGCAGGAGCGGGAACAGCAGCATCATCAACATCATCAACATCATCAACTCATGACCGAAAATGGTCCTACAGACGCCTTTCATGAACAGTCCTCTGAAACAAAAAATTGTCCAGGCTACAGTTATGACCAGAAGAGTGGAGGGCATGGATTTATGACGGCCTGGGAAGAGAGTGTGAAATACATGGAAGATTTGCGGCAGCTGCAGGAATTACAAGCTCAGCAACAGCCTCGTGCTCAGCCAATTGCAAATAGAGTACAGCCCAACAACGACATTTTCAGCTTGGAGAACTTGGGAGGACTCTCTGCTGGAATTCAAGCTTTCAACAGCTTCTCTGAGCTCGAAAAAATCAGTGAAGGGCATGATCTAAAAGACAAGTTGCCTGCGGAAGTCTTCAATCTTCTTCAGCAGCCTTCGCATTCAATAAGTCCTTCATGTTCTACTGGGCTAGCATTTGCCTCGAGTTCTGGATCAGTGTATCCATCGGTCTCAAATTTCAAAAGACCCACTGGGCCAGTGAACTCTTGTCATGTGCATGTTCCGATGCCAAATCCACATGGTTATCAGCTAATGGACAGGGGGACAAATTCGAGTCTCTTCGGTGGTAATGGTATACAAGCTCCTGCAGTGGCATATCCAGGGCCTTTTACAAAGCTCTTAAATTACAACAATGTTCCAGGAGGTAGCTCAAGAAATTATTCCAAGATCTTCAATTACAACTCTCCTGCAGCTAGTGGCCCTGGGTTTTTTCCTACAGATCTTCCCCCAACCAAATCTGGTTCCAATGTCGATCTGCTGCAGCTGGAGTATGGTCATAACGAGGAGCTTCAAGATGTTTTTGGTGCTGCTCAAATGACAGCACCATCTCACTTCTTGCCTGAGATACCAAGACGTACTAAAAGCGCTTCTGGAAGGCTAACTAACGAAGCTGAGCAAAAACCACTGCACCATTTTGCCACAGAGAGACAAAGACGGGAACATTTGAACGAGAAGTATCAGACCCTGCGATCTTTGGTTCCAAACCCTACTAAGGCTGATCGAGCTTCCATTGTCTCAGATGCTATCAATAGAATACATGATCTGAAAAAAGAAGAAGAAGGTTTGATGGATGAAAAGAAAAACAGACAACTTCGGAGACAATTGAGGCTTGAGATGAGAGCCAATGGAAAACGTCAGAGAGCTGAGGAATCCGAAACAGCTGTCAAAGAAGACGGAGAAAGCTTGTGTCTGAAAGCACTGTGGAGCAAAAAGGTTTCCAAACATGGGACGGAGATCGAAGTTCGCATAGTTTGTGATGAGGTGGATATCCACATCAGGCAGAAACATATGCCCCGATTTCTTATCCGAGTAATAACAGCCGTAGAAAGAGGGCTGAAGCTTGAAATCCTTGATGGAACTGGCGGTGTTATCCACAATTGTGATGTTTACAGATTCAAACTGAAGATTCAAGGAGATTCGTGCGCTTTCATGGGAGTAATCATGGCGAAACTTCTAGAGATATTGGATACGGTTTTCTGA

Protein

>Mapoly0031s0076.1
MERIEAGVEMSSFNFHGGDFCQSEMGAYADQEDQDIRAEMQAITDPGLNNVLLGLSDALDTIPRSRYVGLTLGDLPLTNMNGSGSENFNANRAMSDQQNMANHDHPPDGLSFPVDASHRQGENDNHLAMQEIRMIHQSELENEQQQEREQQHHQHHQHHQLMTENGPTDAFHEQSSETKNCPGYSYDQKSGGHGFMTAWEESVKYMEDLRQLQELQAQQQPRAQPIANRVQPNNDIFSLENLGGLSAGIQAFNSFSELEKISEGHDLKDKLPAEVFNLLQQPSHSISPSCSTGLAFASSSGSVYPSVSNFKRPTGPVNSCHVHVPMPNPHGYQLMDRGTNSSLFGGNGIQAPAVAYPGPFTKLLNYNNVPGGSSRNYSKIFNYNSPAASGPGFFPTDLPPTKSGSNVDLLQLEYGHNEELQDVFGAAQMTAPSHFLPEIPRRTKSASGRLTNEAEQKPLHHFATERQRREHLNEKYQTLRSLVPNPTKADRASIVSDAINRIHDLKKEEEGLMDEKKNRQLRRQLRLEMRANGKRQRAEESETAVKEDGESLCLKALWSKKVSKHGTEIEVRIVCDEVDIHIRQKHMPRFLIRVITAVERGLKLEILDGTGGVIHNCDVYRFKLKIQGDSCAFMGVIMAKLLEILDTVF

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>