Mapoly0031s0161



Description

Transcription factor HAND2/Transcription factor TAL1/TAL2/LYL1

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
KOG KOG4029 Transcription factor HAND2/Transcription factor TAL1/TAL2/LYL1
OrthoMCL OG5_141651
PFAM PF00010 Helix-loop-helix DNA-binding domain
PFAM PF14215 BHLH-MYC and R2R3-MYB transcription factors N-terminal
PANTHER PTHR11514 MYC
PANTHER PTHR11514:SF9 GL3 (GLABRA 3), TRANSCRIPTION FACTOR

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH12 transcription factor, bHLH Mapoly0031s0161.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0031s0161.1 scaffold_31:1508881..1516201  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0031s0161.2 scaffold_31:1508881..1516201  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0031s0161.3 scaffold_31:1508881..1516201  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0031s0161.1  

Gene structure:

mRNA scaffold_31:1508881..1516201  ( - strand )
three_prime_UTR scaffold_31:1508881..1509431  ( - strand )
CDS scaffold_31:1509432..1509521  ( - strand )
CDS scaffold_31:1509663..1510247  ( - strand )
CDS scaffold_31:1510723..1511634  ( - strand )
CDS scaffold_31:1511925..1511981  ( - strand )
CDS scaffold_31:1512215..1512229  ( - strand )
CDS scaffold_31:1512457..1512553  ( - strand )
CDS scaffold_31:1513237..1513497  ( - strand )
CDS scaffold_31:1514045..1514181  ( - strand )
five_prime_UTR scaffold_31:1514182..1514214  ( - strand )
five_prime_UTR scaffold_31:1515294..1516201  ( - strand )

Sequences:

Gene

>Mapoly0031s0161.1
TGGAGGGGGTGGCCCTTCGGTCTGGAGGCCCGAGGGGCAGTGGAGGGCCGAGGACCAGAATGAGACTTGGAGTAGACCCCCCCACAGACACACACACCTCGCTGCGCGCATCATTGTAGTGCTTTCACTTGTCAGCTTCGAGACAAAGTCCACGGATCGAGCACAGGACAGCCCAGCCTCGCCTCGTCCCTCCCCTCTCGTTCCAGTTAGTCCGGCAGTCGGTCAGTCGGTTGGTCTTGTGGGTGACTGACTGACTAGTCGACGAGCCGACCCTGAGCCTGCGCCTTTGCCTGTGCCTGCTTGCCTGTCTGCCTGCTTGCCTCGCCTTGCTCGTCGGCTGGCTGCGACGGAGATCATTTCGCACAATTTTCGGCCATTGTTTCGATTTCGGAAATCTCTGACGGAGAAAAATAGATGTGTGCTGTTTTCGGGTGGGGGCCAAACTAGGTCCGAGCTCGGACTCGAGCTCGAGCACCCTCGAGTACAGTGAGCTAGCGACCAATACAGCGCGGGGCGAAGCGAGACGAGATCAGAGGGAGCAAGAGCCCCCATCGATACTGATACTGTCGATTCCAGTAGCTTCGCCTGCTGTCCTGGATTTGGTGTCGCTCGGCAGGAGATTTTAGAATAGGAGGTCTCTGGGCTGGGCTGGGCAGGCCGCTTTATTTCTAGTGCGCTAAAGGTGACGGTCCTCGTGCAGAGCAATTTCGTGAAGAACGACTGTGGGACGACGTCGTTTGGCCGCAATTCTGTAATTCGTTTCGCCACTTATTTCAGATGTTTTCAGCGGAGGTTTGCAGCTTACTGGGGCTTGCCACTTTGCCGGAGACTGGAGAGCTGCTGAATGAGGCCCGTCTCGTTCATGAAGACTAGGAAACGATTCGGCCTGCAGTAATCGCCGCAAGCTTGTGAGTGTCCATCTGTCACCTTCCACCCTCTCTCGTCGGATCGCGTGCCTCGTGTGAATGTCGTCAGTAATAAAACAAGGTCGACAGGTCCTTTGTCACAGCCACGAATGTGCATTCGGGCTGAACTCTAGGCCGTAAAGCGCACATTCAATTCACCAGCTTGCCGCCATAATTTTGCGATCCTTAGCTCTGTTTACTCGGTGTCCTGGTTCACGACTGAATGCTTCCGAACGAGCTTATGGCATGAACACAGACAGGGTTACAAATTAAAACATATCAGACGTAAGATAGTTCGTGCACCACATTCGCTCCGAGCAGGCCGAGGTTTCCGATCAATTATTCACGTGCAGGACCATGGGACGGCAACATATGCGTGATCACGAGCAGCATTCATAGATTCGGATGATATGATTTTCCAAGCTGCTTTCGCGGAGTAGTTGGTAGAGACGTATCCGAGCCTTTACTGTTCAGTGATAGATGTCGAGAATGCGTCAGAATATTGTGAGTCGTCGGGCCAGTGAATATGCATGGGTCACTTTAAAATGACCCACCCTCGGAAAAGGGGTTAGGCGTGTTCACCTGAATTCACAGAAACATTGGTGCTTTAGATGATTTAAAAAGAGTATCCAGCTCGCTTCCTAAGCTCCACACTCGCCTGCTTTCAAGCGTGATTACACGCCACAACTCGGAATCTAGCTTCATTTCTCCTTGTTATGTCGTCCACCTTCTTTTCGCTCGTTTGTGCAAGCTTGGCGGTTGATTCCGAGCTCTCGGACGAAGTGGTTGCTGCAAACGCTGATGTCGCATAGGGCTTTAGAGGGCGCCACGAAATTAGAAACGTATGAATTGCTACATCTTCAGTGTCAGTCAGTGAAGACAGTCAATCGGTCTAGCATAGTTCTAGTTCTGAATGAAACGTGGGAGTGAGGAGTTGCAGAGTTGAGTGTCAAAGTCGAGGGGAGAAAGATGTTTTTATTTTCAGTTTATAGCGTTGGCCGCATGTGACATTACTGCGATCGGTGATCGGACTGCGGACTGTGATCCAGATTTCCAGAAACCTTTAATCACGAACGTAACAGCGTCTCTGCGCAGGAAATGTGTGCTACGACACGATGGCTGGAGCGGGCAAAAGAAATTCGTCCACACTTATCGAAGTTCCGAAGGCGACACTTCGAGGCCAATTACAGGCGGCCGTGCAAAGCATTAAGTGGACGTACACTGCCTTCTGGCAGCAATCGAAGCAGAAAGAGTAAACACTTTGAGCACGCATGCGCATCCATGTCCATGTTTGTTCAGCTGATTTGTGGGCTCTTCTTGGCTAGCGGGCCTATATTGTCGGCCTTGCTCCTGCTGCTGCTGCTGCTGCTTGATTTTCCTGCTCTCCGCCTGAAGCTAAATTAGGAAAGAATGTGTGTTTTTTTCTTCCGGCAGTCCAATCCAAATGTAGTCCAGTCCAGTTCAGTCCAGTTTCGAGATACACGGCGGGCGAGCGAGCGCTTCGCTTCACTGCAACAACTCGTGATGGTGCCCGGATTGCATATCCGCCTCGCCTCGTATCAGATTCGCTCCTAGGATCGAAAGTCAACAATTAAATATCATCACGATCAGGTTGAAGACTTGTGTACCGGGGGGTGTAGAACGATGGCAGGGATGGATGGATGATGCTCTAGTTTCCAGAGGATGGTTGAAAATTGGAGCTTCGGTCGTAGAGCCGCTGGAACCGGGATTGCAATGACGACATGCCATCCCATCGAGGACACTAATGGGCAACGGTCGGTCCGGGCTTTGTCTTGCAGAGTGCTTGTCTGGGGAGATGGATATTATAATGGTGCCATCAAAACGAGGAAGACAGTCCAGGCCGCCGAGCTCAGTCAAGAGGAACTCGGCATGCAGAGGACAAGACAACTGCGGGATTTATACGAAACTTTGTCAACCGCAGGAGATGGCAATCAGTCAACCACGAGAAGGCCGTCGGCGGCTCTGACGCCCGAGGACCTCACCGAGACCGAGTGGTTCTATCTGCTATGCATGTCGTGCTCATTCTCGCCGGAAAACGGGTAATGTATTTCTGAGTCCGCCCGCTCTCCTCGATTCCCCGTTTCGATGTCATTCCGAGTCAATTCATTCCAGTCCTTCAGAGGCGAGTCAAACCCATACGGGATCGCGAGACATTCAGCGACATAGTGTGGCTCGTGATGCTGATGCTGATGTTGGCCACAGCCGTAGTGATGCACCTCGGTTTCTTTTTCAAATCTTGACCCCCGCGGGACTGCCTAGCTCCCTGTCCTGCCAATCCCATCCCATTCCATCCTATCGAAGCTCAGCTCAGCTCAGCTCAGCCCTGATCATCTGGACTTTGCTGGAGAGTTGACCGAAAGTGATTTGGTTGAAATCCAGTTTCCCTTCAAAGCAAGAAATGTTGACGTGGATCCGTCGCGTACATTATACGAATCCCTACTGTATGAGCTAAACCTCTGCCACCGTGTGTGGTGCATATGCATGTTCGCCTGAACCCAACCCGAGAGCTTTGCTTTACTGCTGCCAGTCTGTTCTGTGCTGTGCTGTTGCGACAGTTTGCAAACTCTCGACCCGGCAGCTTCGGGGCGAATGCCAAAGCGGAATGGTGGGTTGTTTGGGTAGATGGATGGGTATGGATGGTGATTCTGCAATCCTGTAGCCGGATATACTGATGTGACTCGGTCAAACAGCTGAAGATTTCAGAACCTTGTGACTTGTGCAGATTGCCCGGCAAGGCTTTGGCGCAAGGGCGGCATCTGTGGCTGACTGAGACCAATGAGGCCAGCCCGGAAGTCTTCACTCGGTCCTTGTTGGCTAAGGTTTGCCTCCCAAAGATTCCAGCTCTCCTTTGGGTGCATAGGAATTTTAATAGCAGGAATATTTTTGCTCGGGGTTGTTGACTTTCCTGCATCACTGTCTTCGTCATCGTTGGACTCGAGCGTCTCTGACGGTTCGAGAGTAGTCCACCCCTTGGTGGCAAGCGTCTGATGGCCCTCGTCTGTTGTTGGTTGCATGACGATACCATCTGATCGACCTCGGGCAACAGACTGCGCGAATCCAGGTACAGCCGAGCCCGTCTCTCTTAACTGCGTGCGCAAAGTAAAGCTTACAGTTGTCCATCTGCAGGAACTCTAGAACAGATGAGACGGAATGCTCTATAGCTGCAGCAAATTGGTTCAGGCCAGCAAGTTTCTGTTGTGATGGAACATCCCTAGCATTGAACGATTTGAAAAGTTAGTCCAAGACCAGACTGGAACCTTACCACATCGATTTGTTCACATTTGCTCTCGACAGACGGTTTTATGCATTCCTTTGTGCAAGGGCGTTGTGGAATTTGGAACTACAGAGCTTGTAAGTAAACCCCGTGCTTCTCTACGAGATACGAACTTCTTTGTTGAAACGAATTCCTTCCAGCTAGCGCAGCTGTAGGATGTTGTTCAATGCTCTATATATTCTGATGACGGACCGCATTCAGCACACGTGCCCACATCTCATTACGAGGTACCGAAATGTGTCTCCGGGTGCACGAGCTCGAATGTAGACAGCAGGGTCAGTAAAAGCACCAGTCGAGTTCCGGCGATGAAATTGCTAGCCTTCATGGATACGAGGTATTAAAAAGAGCTCGCCAAATTGTGCGTCAGGTGCGTGAAGACCCCGCTCTAGTACAGCACATCAAGACATTCTTCGCGGAACAGTTCAAACCCGTGGGCTCTGAGCAATCGTCTTCGGGTCCTCAACATCAGGGCGATACTCTTCTGCAGCAGCAGCAGCAGCAACAGCCAGGACGAAGTGGTGCCAACGTCGATCAACATGGAGCCAGTGCGGCCTGGCTCTCGACCTCGTCTCCGTGGGCGAGTGTCAACGTCAGCCATCAGGACTCGATGGTCACATTCTCACACGAAGCCGCCAGAGACAGCGCGCACGGGCACGGGCACGGGCTGCACGACGACGCGGTGGCCATGCTGGTGGACGATCAGAAGAGTATGGGCGCGAGCGCCAAGAGCTGGGACCTTCTCTCGGATCACATCGACGGCTTGCCCGGCAGCGACATCTCGCTGGACCCATACGTGGGCAGCGGGACGAACTCGTCCTCGGATCTCATGCTCCTGAGTGCCAGACATCCATCGTCGCAGCCGCTGCAACATTTACGTCGATTCGGATCTCAGCGCGCCGCCGCGCACTCGCTCGACCACGCCGAGCCCGACCCCTTGACCCGCTACGACCGCCAACGACAACAGCCGCTGGGCTCGACCAGCGCCTTCGTCGACTGGAGAATGACGGCCGGGTCCGCCCCCAAGGCGCCGCTCCCGGGGAACCAGCAGTGGATGCTGAAGAACGCCTTGTTCCACATCACGCACTTGTACTCTGCTCCGCGCAGCGACGAAGCCACTCTCGTCTCGGCCGACAATCGCAGCCGCTCCGGCGGTCCCCGGAAACCGGCTGGCGCGCAGGAGGATCTGAACGTGAGTCATGTGCTCGCAGAGCGCCGCCGGCGCGAGAAGCTGAACGATCGGTTTATGTCACTCCGAGCCCTCGTTCCGTTCGTCACCAAGGTACGACCCCGACCCTGATCCCATGGCCCTCACTCGCTCCCAGTCTCAGTACGCGTCCTCTCCACTCGAATACACATCAGGACATGAATTCTCTTTCCTGTTCTCCATGATCGACTCTGAGAGCTCCACAATTCGGGGAGTAGTATCGGTAGACACATGACCTGATGAGAAGCAGCTGTGAGCCGCAGTAGCTGCTGCCATAAGGCACTTATTTGTTTTTCGACAGGTCCTTGCAATCCAGATGGAGACAGTAACTCGTCCAGGATTGATTCTTTCGAGGTGTCCATTTTGGTTATCCGTGTTAGCTGCAAGTGCATGCATCATGACGCCGAGTCAAAGCACAACGTAGTGACGAGTATTAGGTGATCGAACATCGAGATGCTGTTTCATGTGGATTCTCTCACCGTCGTGATGTGATGTGAGGAAGGAAGCAGAACTGGTTGCATTATTCGGATTCGGCTCGTGGCGTGTGCAGATGGACAAGGCTTCGATACTAGGAGACGCCATCGAGTACGTGAAGCAGTTGCAGAAACGCATTCAGGAACTGGAGCTGCGAGATAAGCAGGCCGAGTCGTCCCATTTGCCGCGTTCTCATGCAGACGATCTGAGCAAATCGCAGTTGGGAGACTCGACACCCAAAACCTCACCTTCTGAGACGTTCAACAGCTCCCATTTCGAGATAGTGTCTAATGGTAATCACATGACAGGTATAGAAACGAACGTGAATGTCAGCTTCGACGGAGCATCGAATTCCGATCCCAAAGTGCCCTCGGGTGACAACGAAATGAAATCTAGTCCCAGTCTTGCATCGGACCGAGAGGACCCGGGATTCTGCAATTCCGACGGGGAATCCAATGCTACACAGGCCAAAAGATTAGACGGAGTTAAAGCTAACGTCAAGGTCACAGCAGACGATGATGTGAGCCTTGAACTAAATTGCCCGTGGAGGAAAACCTTATTAGTAGATGTATTGCGAACTTTGAACGATCTGCAACTTGATGTATTCGTCGTTCAAGCTTCAACGAGTGATGGAACCCTCGCCACCGTTTTTAAAGGCAAGGTGCGTGCACTGGCGATGCGCATGCTCTTCTCCCTCTCGTTTCATGCCCACCTATCGGTCGAATTTCCTTCTTTTCCATACCAGGAGGAAGGAGGTGCACATGTCAAAGGCTTAATTTGCTTGATGTTCGGTTTTGTGCAGATGAGGGAGTCGACACATAGCCTTACGGCAACAAAGACCAAACTGCAGACAGCTTTGGAAGAAACCGCTGCTGGGATGGGCTCCAGATAACAGTTTCCATAAACAAAACGTCTCTGCCCACGTTGTGAATCCAAGTAGAGAGAGCATATTTGTAAAGGCAGGAACAAAGTTTCCTAAGGAGGTGTAGCGACCCAGGAACTCGACATCGTTAAATTTCTGCGAAGCATTTCGAGTAGGTGCGAGCTTATCTGCTGTATATGGTCACGCAGGTGCGGAGGAGGCGACTTTTATAAAGCTGGTAATCCGAATCTTCCTTCGAAACTGTCTACCATAACTACACTGAGCTGCAATGCAAGCTAAGGGCCTTACAGATCACCCAAAGTAGAAGAAGAATAAATCATGAGTGGGTGGGTGGGAGATGTACAAAATGTATGCATGTTACAATGTCCATTGTAGATTACAGTGTATAGTTGCAGATTAATACAAGGTTGTGGCATGCACTCCTGGCAATAAGCTTCCGTCCCCCACGAAAGTACTCGTAGGCGGACAATTTTTGTAAACATCAGTCAACAGGATGAAAGTCTGTGCAAAGCCTGACACCGCTTGCGACTATAAAGCAACAACAGGCAACCCGATTTCAA

mRNA

>Mapoly0031s0161.1
TGGAGGGGGTGGCCCTTCGGTCTGGAGGCCCGAGGGGCAGTGGAGGGCCGAGGACCAGAATGAGACTTGGAGTAGACCCCCCCACAGACACACACACCTCGCTGCGCGCATCATTGTAGTGCTTTCACTTGTCAGCTTCGAGACAAAGTCCACGGATCGAGCACAGGACAGCCCAGCCTCGCCTCGTCCCTCCCCTCTCGTTCCAGTTAGTCCGGCAGTCGGTCAGTCGGTTGGTCTTGTGGGTGACTGACTGACTAGTCGACGAGCCGACCCTGAGCCTGCGCCTTTGCCTGTGCCTGCTTGCCTGTCTGCCTGCTTGCCTCGCCTTGCTCGTCGGCTGGCTGCGACGGAGATCATTTCGCACAATTTTCGGCCATTGTTTCGATTTCGGAAATCTCTGACGGAGAAAAATAGATGTGTGCTGTTTTCGGGTGGGGGCCAAACTAGGTCCGAGCTCGGACTCGAGCTCGAGCACCCTCGAGTACAGTGAGCTAGCGACCAATACAGCGCGGGGCGAAGCGAGACGAGATCAGAGGGAGCAAGAGCCCCCATCGATACTGATACTGTCGATTCCAGTAGCTTCGCCTGCTGTCCTGGATTTGGTGTCGCTCGGCAGGAGATTTTAGAATAGGAGGTCTCTGGGCTGGGCTGGGCAGGCCGCTTTATTTCTAGTGCGCTAAAGGTGACGGTCCTCGTGCAGAGCAATTTCGTGAAGAACGACTGTGGGACGACGTCGTTTGGCCGCAATTCTGTAATTCGTTTCGCCACTTATTTCAGATGTTTTCAGCGGAGGTTTGCAGCTTACTGGGGCTTGCCACTTTGCCGGAGACTGGAGAGCTGCTGAATGAGGCCCGTCTCGTTCATGAAGACTAGGAAACGATTCGGCCTGCAGTAATCGCCGCAAGCTTCGTCTCTGCGCAGGAAATGTGTGCTACGACACGATGGCTGGAGCGGGCAAAAGAAATTCGTCCACACTTATCGAAGTTCCGAAGGCGACACTTCGAGGCCAATTACAGGCGGCCGTGCAAAGCATTAAGTGGACGTACACTGCCTTCTGGCAGCAATCGAAGCAGAAAGAAGTGCTTGTCTGGGGAGATGGATATTATAATGGTGCCATCAAAACGAGGAAGACAGTCCAGGCCGCCGAGCTCAGTCAAGAGGAACTCGGCATGCAGAGGACAAGACAACTGCGGGATTTATACGAAACTTTGTCAACCGCAGGAGATGGCAATCAGTCAACCACGAGAAGGCCGTCGGCGGCTCTGACGCCCGAGGACCTCACCGAGACCGAGTGGTTCTATCTGCTATGCATGTCGTGCTCATTCTCGCCGGAAAACGGATTGCCCGGCAAGGCTTTGGCGCAAGGGCGGCATCTGTGGCTGACTGAGACCAATGAGGCCAGCCCGGAAGTCTTCACTCGGTCCTTGTTGGCTAAGACTGCGCGAATCCAGACGGTTTTATGCATTCCTTTGTGCAAGGGCGTTGTGGAATTTGGAACTACAGAGCTTGTGCGTGAAGACCCCGCTCTAGTACAGCACATCAAGACATTCTTCGCGGAACAGTTCAAACCCGTGGGCTCTGAGCAATCGTCTTCGGGTCCTCAACATCAGGGCGATACTCTTCTGCAGCAGCAGCAGCAGCAACAGCCAGGACGAAGTGGTGCCAACGTCGATCAACATGGAGCCAGTGCGGCCTGGCTCTCGACCTCGTCTCCGTGGGCGAGTGTCAACGTCAGCCATCAGGACTCGATGGTCACATTCTCACACGAAGCCGCCAGAGACAGCGCGCACGGGCACGGGCACGGGCTGCACGACGACGCGGTGGCCATGCTGGTGGACGATCAGAAGAGTATGGGCGCGAGCGCCAAGAGCTGGGACCTTCTCTCGGATCACATCGACGGCTTGCCCGGCAGCGACATCTCGCTGGACCCATACGTGGGCAGCGGGACGAACTCGTCCTCGGATCTCATGCTCCTGAGTGCCAGACATCCATCGTCGCAGCCGCTGCAACATTTACGTCGATTCGGATCTCAGCGCGCCGCCGCGCACTCGCTCGACCACGCCGAGCCCGACCCCTTGACCCGCTACGACCGCCAACGACAACAGCCGCTGGGCTCGACCAGCGCCTTCGTCGACTGGAGAATGACGGCCGGGTCCGCCCCCAAGGCGCCGCTCCCGGGGAACCAGCAGTGGATGCTGAAGAACGCCTTGTTCCACATCACGCACTTGTACTCTGCTCCGCGCAGCGACGAAGCCACTCTCGTCTCGGCCGACAATCGCAGCCGCTCCGGCGGTCCCCGGAAACCGGCTGGCGCGCAGGAGGATCTGAACGTGAGTCATGTGCTCGCAGAGCGCCGCCGGCGCGAGAAGCTGAACGATCGGTTTATGTCACTCCGAGCCCTCGTTCCGTTCGTCACCAAGATGGACAAGGCTTCGATACTAGGAGACGCCATCGAGTACGTGAAGCAGTTGCAGAAACGCATTCAGGAACTGGAGCTGCGAGATAAGCAGGCCGAGTCGTCCCATTTGCCGCGTTCTCATGCAGACGATCTGAGCAAATCGCAGTTGGGAGACTCGACACCCAAAACCTCACCTTCTGAGACGTTCAACAGCTCCCATTTCGAGATAGTGTCTAATGGTAATCACATGACAGGTATAGAAACGAACGTGAATGTCAGCTTCGACGGAGCATCGAATTCCGATCCCAAAGTGCCCTCGGGTGACAACGAAATGAAATCTAGTCCCAGTCTTGCATCGGACCGAGAGGACCCGGGATTCTGCAATTCCGACGGGGAATCCAATGCTACACAGGCCAAAAGATTAGACGGAGTTAAAGCTAACGTCAAGGTCACAGCAGACGATGATGTGAGCCTTGAACTAAATTGCCCGTGGAGGAAAACCTTATTAGTAGATGTATTGCGAACTTTGAACGATCTGCAACTTGATGTATTCGTCGTTCAAGCTTCAACGAGTGATGGAACCCTCGCCACCGTTTTTAAAGGCAAGATGAGGGAGTCGACACATAGCCTTACGGCAACAAAGACCAAACTGCAGACAGCTTTGGAAGAAACCGCTGCTGGGATGGGCTCCAGATAACAGTTTCCATAAACAAAACGTCTCTGCCCACGTTGTGAATCCAAGTAGAGAGAGCATATTTGTAAAGGCAGGAACAAAGTTTCCTAAGGAGGTGTAGCGACCCAGGAACTCGACATCGTTAAATTTCTGCGAAGCATTTCGAGTAGGTGCGAGCTTATCTGCTGTATATGGTCACGCAGGTGCGGAGGAGGCGACTTTTATAAAGCTGGTAATCCGAATCTTCCTTCGAAACTGTCTACCATAACTACACTGAGCTGCAATGCAAGCTAAGGGCCTTACAGATCACCCAAAGTAGAAGAAGAATAAATCATGAGTGGGTGGGTGGGAGATGTACAAAATGTATGCATGTTACAATGTCCATTGTAGATTACAGTGTATAGTTGCAGATTAATACAAGGTTGTGGCATGCACTCCTGGCAATAAGCTTCCGTCCCCCACGAAAGTACTCGTAGGCGGACAATTTTTGTAAACATCAGTCAACAGGATGAAAGTCTGTGCAAAGCCTGACACCGCTTGCGACTATAAAGCAACAACAGGCAACCCGATTTCAA

CDS

>Mapoly0031s0161.1
ATGGCTGGAGCGGGCAAAAGAAATTCGTCCACACTTATCGAAGTTCCGAAGGCGACACTTCGAGGCCAATTACAGGCGGCCGTGCAAAGCATTAAGTGGACGTACACTGCCTTCTGGCAGCAATCGAAGCAGAAAGAAGTGCTTGTCTGGGGAGATGGATATTATAATGGTGCCATCAAAACGAGGAAGACAGTCCAGGCCGCCGAGCTCAGTCAAGAGGAACTCGGCATGCAGAGGACAAGACAACTGCGGGATTTATACGAAACTTTGTCAACCGCAGGAGATGGCAATCAGTCAACCACGAGAAGGCCGTCGGCGGCTCTGACGCCCGAGGACCTCACCGAGACCGAGTGGTTCTATCTGCTATGCATGTCGTGCTCATTCTCGCCGGAAAACGGATTGCCCGGCAAGGCTTTGGCGCAAGGGCGGCATCTGTGGCTGACTGAGACCAATGAGGCCAGCCCGGAAGTCTTCACTCGGTCCTTGTTGGCTAAGACTGCGCGAATCCAGACGGTTTTATGCATTCCTTTGTGCAAGGGCGTTGTGGAATTTGGAACTACAGAGCTTGTGCGTGAAGACCCCGCTCTAGTACAGCACATCAAGACATTCTTCGCGGAACAGTTCAAACCCGTGGGCTCTGAGCAATCGTCTTCGGGTCCTCAACATCAGGGCGATACTCTTCTGCAGCAGCAGCAGCAGCAACAGCCAGGACGAAGTGGTGCCAACGTCGATCAACATGGAGCCAGTGCGGCCTGGCTCTCGACCTCGTCTCCGTGGGCGAGTGTCAACGTCAGCCATCAGGACTCGATGGTCACATTCTCACACGAAGCCGCCAGAGACAGCGCGCACGGGCACGGGCACGGGCTGCACGACGACGCGGTGGCCATGCTGGTGGACGATCAGAAGAGTATGGGCGCGAGCGCCAAGAGCTGGGACCTTCTCTCGGATCACATCGACGGCTTGCCCGGCAGCGACATCTCGCTGGACCCATACGTGGGCAGCGGGACGAACTCGTCCTCGGATCTCATGCTCCTGAGTGCCAGACATCCATCGTCGCAGCCGCTGCAACATTTACGTCGATTCGGATCTCAGCGCGCCGCCGCGCACTCGCTCGACCACGCCGAGCCCGACCCCTTGACCCGCTACGACCGCCAACGACAACAGCCGCTGGGCTCGACCAGCGCCTTCGTCGACTGGAGAATGACGGCCGGGTCCGCCCCCAAGGCGCCGCTCCCGGGGAACCAGCAGTGGATGCTGAAGAACGCCTTGTTCCACATCACGCACTTGTACTCTGCTCCGCGCAGCGACGAAGCCACTCTCGTCTCGGCCGACAATCGCAGCCGCTCCGGCGGTCCCCGGAAACCGGCTGGCGCGCAGGAGGATCTGAACGTGAGTCATGTGCTCGCAGAGCGCCGCCGGCGCGAGAAGCTGAACGATCGGTTTATGTCACTCCGAGCCCTCGTTCCGTTCGTCACCAAGATGGACAAGGCTTCGATACTAGGAGACGCCATCGAGTACGTGAAGCAGTTGCAGAAACGCATTCAGGAACTGGAGCTGCGAGATAAGCAGGCCGAGTCGTCCCATTTGCCGCGTTCTCATGCAGACGATCTGAGCAAATCGCAGTTGGGAGACTCGACACCCAAAACCTCACCTTCTGAGACGTTCAACAGCTCCCATTTCGAGATAGTGTCTAATGGTAATCACATGACAGGTATAGAAACGAACGTGAATGTCAGCTTCGACGGAGCATCGAATTCCGATCCCAAAGTGCCCTCGGGTGACAACGAAATGAAATCTAGTCCCAGTCTTGCATCGGACCGAGAGGACCCGGGATTCTGCAATTCCGACGGGGAATCCAATGCTACACAGGCCAAAAGATTAGACGGAGTTAAAGCTAACGTCAAGGTCACAGCAGACGATGATGTGAGCCTTGAACTAAATTGCCCGTGGAGGAAAACCTTATTAGTAGATGTATTGCGAACTTTGAACGATCTGCAACTTGATGTATTCGTCGTTCAAGCTTCAACGAGTGATGGAACCCTCGCCACCGTTTTTAAAGGCAAGATGAGGGAGTCGACACATAGCCTTACGGCAACAAAGACCAAACTGCAGACAGCTTTGGAAGAAACCGCTGCTGGGATGGGCTCCAGATAA

Protein

>Mapoly0031s0161.1
MAGAGKRNSSTLIEVPKATLRGQLQAAVQSIKWTYTAFWQQSKQKEVLVWGDGYYNGAIKTRKTVQAAELSQEELGMQRTRQLRDLYETLSTAGDGNQSTTRRPSAALTPEDLTETEWFYLLCMSCSFSPENGLPGKALAQGRHLWLTETNEASPEVFTRSLLAKTARIQTVLCIPLCKGVVEFGTTELVREDPALVQHIKTFFAEQFKPVGSEQSSSGPQHQGDTLLQQQQQQQPGRSGANVDQHGASAAWLSTSSPWASVNVSHQDSMVTFSHEAARDSAHGHGHGLHDDAVAMLVDDQKSMGASAKSWDLLSDHIDGLPGSDISLDPYVGSGTNSSSDLMLLSARHPSSQPLQHLRRFGSQRAAAHSLDHAEPDPLTRYDRQRQQPLGSTSAFVDWRMTAGSAPKAPLPGNQQWMLKNALFHITHLYSAPRSDEATLVSADNRSRSGGPRKPAGAQEDLNVSHVLAERRRREKLNDRFMSLRALVPFVTKMDKASILGDAIEYVKQLQKRIQELELRDKQAESSHLPRSHADDLSKSQLGDSTPKTSPSETFNSSHFEIVSNGNHMTGIETNVNVSFDGASNSDPKVPSGDNEMKSSPSLASDREDPGFCNSDGESNATQAKRLDGVKANVKVTADDDVSLELNCPWRKTLLVDVLRTLNDLQLDVFVVQASTSDGTLATVFKGKMRESTHSLTATKTKLQTALEETAAGMGSR

Mapoly0031s0161.2  

Gene structure:

mRNA scaffold_31:1508881..1516201  ( - strand )
three_prime_UTR scaffold_31:1508881..1509431  ( - strand )
CDS scaffold_31:1509432..1509521  ( - strand )
CDS scaffold_31:1509663..1510247  ( - strand )
CDS scaffold_31:1510723..1511532  ( - strand )
CDS scaffold_31:1511925..1511981  ( - strand )
CDS scaffold_31:1512215..1512229  ( - strand )
CDS scaffold_31:1512457..1512553  ( - strand )
CDS scaffold_31:1513237..1513497  ( - strand )
CDS scaffold_31:1514045..1514181  ( - strand )
five_prime_UTR scaffold_31:1514182..1514214  ( - strand )
five_prime_UTR scaffold_31:1515294..1516201  ( - strand )

Sequences:

Gene

>Mapoly0031s0161.2
TGGAGGGGGTGGCCCTTCGGTCTGGAGGCCCGAGGGGCAGTGGAGGGCCGAGGACCAGAATGAGACTTGGAGTAGACCCCCCCACAGACACACACACCTCGCTGCGCGCATCATTGTAGTGCTTTCACTTGTCAGCTTCGAGACAAAGTCCACGGATCGAGCACAGGACAGCCCAGCCTCGCCTCGTCCCTCCCCTCTCGTTCCAGTTAGTCCGGCAGTCGGTCAGTCGGTTGGTCTTGTGGGTGACTGACTGACTAGTCGACGAGCCGACCCTGAGCCTGCGCCTTTGCCTGTGCCTGCTTGCCTGTCTGCCTGCTTGCCTCGCCTTGCTCGTCGGCTGGCTGCGACGGAGATCATTTCGCACAATTTTCGGCCATTGTTTCGATTTCGGAAATCTCTGACGGAGAAAAATAGATGTGTGCTGTTTTCGGGTGGGGGCCAAACTAGGTCCGAGCTCGGACTCGAGCTCGAGCACCCTCGAGTACAGTGAGCTAGCGACCAATACAGCGCGGGGCGAAGCGAGACGAGATCAGAGGGAGCAAGAGCCCCCATCGATACTGATACTGTCGATTCCAGTAGCTTCGCCTGCTGTCCTGGATTTGGTGTCGCTCGGCAGGAGATTTTAGAATAGGAGGTCTCTGGGCTGGGCTGGGCAGGCCGCTTTATTTCTAGTGCGCTAAAGGTGACGGTCCTCGTGCAGAGCAATTTCGTGAAGAACGACTGTGGGACGACGTCGTTTGGCCGCAATTCTGTAATTCGTTTCGCCACTTATTTCAGATGTTTTCAGCGGAGGTTTGCAGCTTACTGGGGCTTGCCACTTTGCCGGAGACTGGAGAGCTGCTGAATGAGGCCCGTCTCGTTCATGAAGACTAGGAAACGATTCGGCCTGCAGTAATCGCCGCAAGCTTGTGAGTGTCCATCTGTCACCTTCCACCCTCTCTCGTCGGATCGCGTGCCTCGTGTGAATGTCGTCAGTAATAAAACAAGGTCGACAGGTCCTTTGTCACAGCCACGAATGTGCATTCGGGCTGAACTCTAGGCCGTAAAGCGCACATTCAATTCACCAGCTTGCCGCCATAATTTTGCGATCCTTAGCTCTGTTTACTCGGTGTCCTGGTTCACGACTGAATGCTTCCGAACGAGCTTATGGCATGAACACAGACAGGGTTACAAATTAAAACATATCAGACGTAAGATAGTTCGTGCACCACATTCGCTCCGAGCAGGCCGAGGTTTCCGATCAATTATTCACGTGCAGGACCATGGGACGGCAACATATGCGTGATCACGAGCAGCATTCATAGATTCGGATGATATGATTTTCCAAGCTGCTTTCGCGGAGTAGTTGGTAGAGACGTATCCGAGCCTTTACTGTTCAGTGATAGATGTCGAGAATGCGTCAGAATATTGTGAGTCGTCGGGCCAGTGAATATGCATGGGTCACTTTAAAATGACCCACCCTCGGAAAAGGGGTTAGGCGTGTTCACCTGAATTCACAGAAACATTGGTGCTTTAGATGATTTAAAAAGAGTATCCAGCTCGCTTCCTAAGCTCCACACTCGCCTGCTTTCAAGCGTGATTACACGCCACAACTCGGAATCTAGCTTCATTTCTCCTTGTTATGTCGTCCACCTTCTTTTCGCTCGTTTGTGCAAGCTTGGCGGTTGATTCCGAGCTCTCGGACGAAGTGGTTGCTGCAAACGCTGATGTCGCATAGGGCTTTAGAGGGCGCCACGAAATTAGAAACGTATGAATTGCTACATCTTCAGTGTCAGTCAGTGAAGACAGTCAATCGGTCTAGCATAGTTCTAGTTCTGAATGAAACGTGGGAGTGAGGAGTTGCAGAGTTGAGTGTCAAAGTCGAGGGGAGAAAGATGTTTTTATTTTCAGTTTATAGCGTTGGCCGCATGTGACATTACTGCGATCGGTGATCGGACTGCGGACTGTGATCCAGATTTCCAGAAACCTTTAATCACGAACGTAACAGCGTCTCTGCGCAGGAAATGTGTGCTACGACACGATGGCTGGAGCGGGCAAAAGAAATTCGTCCACACTTATCGAAGTTCCGAAGGCGACACTTCGAGGCCAATTACAGGCGGCCGTGCAAAGCATTAAGTGGACGTACACTGCCTTCTGGCAGCAATCGAAGCAGAAAGAGTAAACACTTTGAGCACGCATGCGCATCCATGTCCATGTTTGTTCAGCTGATTTGTGGGCTCTTCTTGGCTAGCGGGCCTATATTGTCGGCCTTGCTCCTGCTGCTGCTGCTGCTGCTTGATTTTCCTGCTCTCCGCCTGAAGCTAAATTAGGAAAGAATGTGTGTTTTTTTCTTCCGGCAGTCCAATCCAAATGTAGTCCAGTCCAGTTCAGTCCAGTTTCGAGATACACGGCGGGCGAGCGAGCGCTTCGCTTCACTGCAACAACTCGTGATGGTGCCCGGATTGCATATCCGCCTCGCCTCGTATCAGATTCGCTCCTAGGATCGAAAGTCAACAATTAAATATCATCACGATCAGGTTGAAGACTTGTGTACCGGGGGGTGTAGAACGATGGCAGGGATGGATGGATGATGCTCTAGTTTCCAGAGGATGGTTGAAAATTGGAGCTTCGGTCGTAGAGCCGCTGGAACCGGGATTGCAATGACGACATGCCATCCCATCGAGGACACTAATGGGCAACGGTCGGTCCGGGCTTTGTCTTGCAGAGTGCTTGTCTGGGGAGATGGATATTATAATGGTGCCATCAAAACGAGGAAGACAGTCCAGGCCGCCGAGCTCAGTCAAGAGGAACTCGGCATGCAGAGGACAAGACAACTGCGGGATTTATACGAAACTTTGTCAACCGCAGGAGATGGCAATCAGTCAACCACGAGAAGGCCGTCGGCGGCTCTGACGCCCGAGGACCTCACCGAGACCGAGTGGTTCTATCTGCTATGCATGTCGTGCTCATTCTCGCCGGAAAACGGGTAATGTATTTCTGAGTCCGCCCGCTCTCCTCGATTCCCCGTTTCGATGTCATTCCGAGTCAATTCATTCCAGTCCTTCAGAGGCGAGTCAAACCCATACGGGATCGCGAGACATTCAGCGACATAGTGTGGCTCGTGATGCTGATGCTGATGTTGGCCACAGCCGTAGTGATGCACCTCGGTTTCTTTTTCAAATCTTGACCCCCGCGGGACTGCCTAGCTCCCTGTCCTGCCAATCCCATCCCATTCCATCCTATCGAAGCTCAGCTCAGCTCAGCTCAGCCCTGATCATCTGGACTTTGCTGGAGAGTTGACCGAAAGTGATTTGGTTGAAATCCAGTTTCCCTTCAAAGCAAGAAATGTTGACGTGGATCCGTCGCGTACATTATACGAATCCCTACTGTATGAGCTAAACCTCTGCCACCGTGTGTGGTGCATATGCATGTTCGCCTGAACCCAACCCGAGAGCTTTGCTTTACTGCTGCCAGTCTGTTCTGTGCTGTGCTGTTGCGACAGTTTGCAAACTCTCGACCCGGCAGCTTCGGGGCGAATGCCAAAGCGGAATGGTGGGTTGTTTGGGTAGATGGATGGGTATGGATGGTGATTCTGCAATCCTGTAGCCGGATATACTGATGTGACTCGGTCAAACAGCTGAAGATTTCAGAACCTTGTGACTTGTGCAGATTGCCCGGCAAGGCTTTGGCGCAAGGGCGGCATCTGTGGCTGACTGAGACCAATGAGGCCAGCCCGGAAGTCTTCACTCGGTCCTTGTTGGCTAAGGTTTGCCTCCCAAAGATTCCAGCTCTCCTTTGGGTGCATAGGAATTTTAATAGCAGGAATATTTTTGCTCGGGGTTGTTGACTTTCCTGCATCACTGTCTTCGTCATCGTTGGACTCGAGCGTCTCTGACGGTTCGAGAGTAGTCCACCCCTTGGTGGCAAGCGTCTGATGGCCCTCGTCTGTTGTTGGTTGCATGACGATACCATCTGATCGACCTCGGGCAACAGACTGCGCGAATCCAGGTACAGCCGAGCCCGTCTCTCTTAACTGCGTGCGCAAAGTAAAGCTTACAGTTGTCCATCTGCAGGAACTCTAGAACAGATGAGACGGAATGCTCTATAGCTGCAGCAAATTGGTTCAGGCCAGCAAGTTTCTGTTGTGATGGAACATCCCTAGCATTGAACGATTTGAAAAGTTAGTCCAAGACCAGACTGGAACCTTACCACATCGATTTGTTCACATTTGCTCTCGACAGACGGTTTTATGCATTCCTTTGTGCAAGGGCGTTGTGGAATTTGGAACTACAGAGCTTGTAAGTAAACCCCGTGCTTCTCTACGAGATACGAACTTCTTTGTTGAAACGAATTCCTTCCAGCTAGCGCAGCTGTAGGATGTTGTTCAATGCTCTATATATTCTGATGACGGACCGCATTCAGCACACGTGCCCACATCTCATTACGAGGTACCGAAATGTGTCTCCGGGTGCACGAGCTCGAATGTAGACAGCAGGGTCAGTAAAAGCACCAGTCGAGTTCCGGCGATGAAATTGCTAGCCTTCATGGATACGAGGTATTAAAAAGAGCTCGCCAAATTGTGCGTCAGGTGCGTGAAGACCCCGCTCTAGTACAGCACATCAAGACATTCTTCGCGGAACAGTTCAAACCCGTGGGCTCTGAGCAATCGTCTTCGGGTCCTCAACATCAGGGCGATACTCTTCTGCAGCAGCAGCAGCAGCAACAGCCAGGACGAAGTGGTGCCAACGTCGATCAACATGGAGCCAGTGCGGCCTGGCTCTCGACCTCGTCTCCGTGGGCGAGTGTCAACGTCAGCCATCAGGACTCGATGGTCACATTCTCACACGAAGCCGCCAGAGACAGCGCGCACGGGCACGGGCACGGGCTGCACGACGACGCGGTGGCCATGCTGGTGGACGATCAGAAGAGTATGGGCGCGAGCGCCAAGAGCTGGGACCTTCTCTCGGATCACATCGACGGCTTGCCCGGCAGCGACATCTCGCTGGACCCATACGTGGGCAGCGGGACGAACTCGTCCTCGGATCTCATGCTCCTGAGTGCCAGACATCCATCGTCGCAGCCGCTGCAACATTTACGTCGATTCGGATCTCAGCGCGCCGCCGCGCACTCGCTCGACCACGCCGAGCCCGACCCCTTGACCCGCTACGACCGCCAACGACAACAGCCGCTGGGCTCGACCAGCGCCTTCGTCGACTGGAGAATGACGGCCGGGTCCGCCCCCAAGGCGCCGCTCCCGGGGAACCAGCAGTGGATGCTGAAGAACGCCTTGTTCCACATCACGCACTTGTACTCTGCTCCGCGCAGCGACGAAGCCACTCTCGTCTCGGCCGACAATCGCAGCCGCTCCGGCGGTCCCCGGAAACCGGCTGGCGCGCAGGAGGATCTGAACGTGAGTCATGTGCTCGCAGAGCGCCGCCGGCGCGAGAAGCTGAACGATCGGTTTATGTCACTCCGAGCCCTCGTTCCGTTCGTCACCAAGGTACGACCCCGACCCTGATCCCATGGCCCTCACTCGCTCCCAGTCTCAGTACGCGTCCTCTCCACTCGAATACACATCAGGACATGAATTCTCTTTCCTGTTCTCCATGATCGACTCTGAGAGCTCCACAATTCGGGGAGTAGTATCGGTAGACACATGACCTGATGAGAAGCAGCTGTGAGCCGCAGTAGCTGCTGCCATAAGGCACTTATTTGTTTTTCGACAGGTCCTTGCAATCCAGATGGAGACAGTAACTCGTCCAGGATTGATTCTTTCGAGGTGTCCATTTTGGTTATCCGTGTTAGCTGCAAGTGCATGCATCATGACGCCGAGTCAAAGCACAACGTAGTGACGAGTATTAGGTGATCGAACATCGAGATGCTGTTTCATGTGGATTCTCTCACCGTCGTGATGTGATGTGAGGAAGGAAGCAGAACTGGTTGCATTATTCGGATTCGGCTCGTGGCGTGTGCAGATGGACAAGGCTTCGATACTAGGAGACGCCATCGAGTACGTGAAGCAGTTGCAGAAACGCATTCAGGAACTGGAGCTGCGAGATAAGCAGGCCGAGTCGTCCCATTTGCCGCGTTCTCATGCAGACGATCTGAGCAAATCGCAGTTGGGAGACTCGACACCCAAAACCTCACCTTCTGAGACGTTCAACAGCTCCCATTTCGAGATAGTGTCTAATGGTAATCACATGACAGGTATAGAAACGAACGTGAATGTCAGCTTCGACGGAGCATCGAATTCCGATCCCAAAGTGCCCTCGGGTGACAACGAAATGAAATCTAGTCCCAGTCTTGCATCGGACCGAGAGGACCCGGGATTCTGCAATTCCGACGGGGAATCCAATGCTACACAGGCCAAAAGATTAGACGGAGTTAAAGCTAACGTCAAGGTCACAGCAGACGATGATGTGAGCCTTGAACTAAATTGCCCGTGGAGGAAAACCTTATTAGTAGATGTATTGCGAACTTTGAACGATCTGCAACTTGATGTATTCGTCGTTCAAGCTTCAACGAGTGATGGAACCCTCGCCACCGTTTTTAAAGGCAAGGTGCGTGCACTGGCGATGCGCATGCTCTTCTCCCTCTCGTTTCATGCCCACCTATCGGTCGAATTTCCTTCTTTTCCATACCAGGAGGAAGGAGGTGCACATGTCAAAGGCTTAATTTGCTTGATGTTCGGTTTTGTGCAGATGAGGGAGTCGACACATAGCCTTACGGCAACAAAGACCAAACTGCAGACAGCTTTGGAAGAAACCGCTGCTGGGATGGGCTCCAGATAACAGTTTCCATAAACAAAACGTCTCTGCCCACGTTGTGAATCCAAGTAGAGAGAGCATATTTGTAAAGGCAGGAACAAAGTTTCCTAAGGAGGTGTAGCGACCCAGGAACTCGACATCGTTAAATTTCTGCGAAGCATTTCGAGTAGGTGCGAGCTTATCTGCTGTATATGGTCACGCAGGTGCGGAGGAGGCGACTTTTATAAAGCTGGTAATCCGAATCTTCCTTCGAAACTGTCTACCATAACTACACTGAGCTGCAATGCAAGCTAAGGGCCTTACAGATCACCCAAAGTAGAAGAAGAATAAATCATGAGTGGGTGGGTGGGAGATGTACAAAATGTATGCATGTTACAATGTCCATTGTAGATTACAGTGTATAGTTGCAGATTAATACAAGGTTGTGGCATGCACTCCTGGCAATAAGCTTCCGTCCCCCACGAAAGTACTCGTAGGCGGACAATTTTTGTAAACATCAGTCAACAGGATGAAAGTCTGTGCAAAGCCTGACACCGCTTGCGACTATAAAGCAACAACAGGCAACCCGATTTCAA

mRNA

>Mapoly0031s0161.2
TGGAGGGGGTGGCCCTTCGGTCTGGAGGCCCGAGGGGCAGTGGAGGGCCGAGGACCAGAATGAGACTTGGAGTAGACCCCCCCACAGACACACACACCTCGCTGCGCGCATCATTGTAGTGCTTTCACTTGTCAGCTTCGAGACAAAGTCCACGGATCGAGCACAGGACAGCCCAGCCTCGCCTCGTCCCTCCCCTCTCGTTCCAGTTAGTCCGGCAGTCGGTCAGTCGGTTGGTCTTGTGGGTGACTGACTGACTAGTCGACGAGCCGACCCTGAGCCTGCGCCTTTGCCTGTGCCTGCTTGCCTGTCTGCCTGCTTGCCTCGCCTTGCTCGTCGGCTGGCTGCGACGGAGATCATTTCGCACAATTTTCGGCCATTGTTTCGATTTCGGAAATCTCTGACGGAGAAAAATAGATGTGTGCTGTTTTCGGGTGGGGGCCAAACTAGGTCCGAGCTCGGACTCGAGCTCGAGCACCCTCGAGTACAGTGAGCTAGCGACCAATACAGCGCGGGGCGAAGCGAGACGAGATCAGAGGGAGCAAGAGCCCCCATCGATACTGATACTGTCGATTCCAGTAGCTTCGCCTGCTGTCCTGGATTTGGTGTCGCTCGGCAGGAGATTTTAGAATAGGAGGTCTCTGGGCTGGGCTGGGCAGGCCGCTTTATTTCTAGTGCGCTAAAGGTGACGGTCCTCGTGCAGAGCAATTTCGTGAAGAACGACTGTGGGACGACGTCGTTTGGCCGCAATTCTGTAATTCGTTTCGCCACTTATTTCAGATGTTTTCAGCGGAGGTTTGCAGCTTACTGGGGCTTGCCACTTTGCCGGAGACTGGAGAGCTGCTGAATGAGGCCCGTCTCGTTCATGAAGACTAGGAAACGATTCGGCCTGCAGTAATCGCCGCAAGCTTCGTCTCTGCGCAGGAAATGTGTGCTACGACACGATGGCTGGAGCGGGCAAAAGAAATTCGTCCACACTTATCGAAGTTCCGAAGGCGACACTTCGAGGCCAATTACAGGCGGCCGTGCAAAGCATTAAGTGGACGTACACTGCCTTCTGGCAGCAATCGAAGCAGAAAGAAGTGCTTGTCTGGGGAGATGGATATTATAATGGTGCCATCAAAACGAGGAAGACAGTCCAGGCCGCCGAGCTCAGTCAAGAGGAACTCGGCATGCAGAGGACAAGACAACTGCGGGATTTATACGAAACTTTGTCAACCGCAGGAGATGGCAATCAGTCAACCACGAGAAGGCCGTCGGCGGCTCTGACGCCCGAGGACCTCACCGAGACCGAGTGGTTCTATCTGCTATGCATGTCGTGCTCATTCTCGCCGGAAAACGGATTGCCCGGCAAGGCTTTGGCGCAAGGGCGGCATCTGTGGCTGACTGAGACCAATGAGGCCAGCCCGGAAGTCTTCACTCGGTCCTTGTTGGCTAAGACTGCGCGAATCCAGACGGTTTTATGCATTCCTTTGTGCAAGGGCGTTGTGGAATTTGGAACTACAGAGCTTGGCGATACTCTTCTGCAGCAGCAGCAGCAGCAACAGCCAGGACGAAGTGGTGCCAACGTCGATCAACATGGAGCCAGTGCGGCCTGGCTCTCGACCTCGTCTCCGTGGGCGAGTGTCAACGTCAGCCATCAGGACTCGATGGTCACATTCTCACACGAAGCCGCCAGAGACAGCGCGCACGGGCACGGGCACGGGCTGCACGACGACGCGGTGGCCATGCTGGTGGACGATCAGAAGAGTATGGGCGCGAGCGCCAAGAGCTGGGACCTTCTCTCGGATCACATCGACGGCTTGCCCGGCAGCGACATCTCGCTGGACCCATACGTGGGCAGCGGGACGAACTCGTCCTCGGATCTCATGCTCCTGAGTGCCAGACATCCATCGTCGCAGCCGCTGCAACATTTACGTCGATTCGGATCTCAGCGCGCCGCCGCGCACTCGCTCGACCACGCCGAGCCCGACCCCTTGACCCGCTACGACCGCCAACGACAACAGCCGCTGGGCTCGACCAGCGCCTTCGTCGACTGGAGAATGACGGCCGGGTCCGCCCCCAAGGCGCCGCTCCCGGGGAACCAGCAGTGGATGCTGAAGAACGCCTTGTTCCACATCACGCACTTGTACTCTGCTCCGCGCAGCGACGAAGCCACTCTCGTCTCGGCCGACAATCGCAGCCGCTCCGGCGGTCCCCGGAAACCGGCTGGCGCGCAGGAGGATCTGAACGTGAGTCATGTGCTCGCAGAGCGCCGCCGGCGCGAGAAGCTGAACGATCGGTTTATGTCACTCCGAGCCCTCGTTCCGTTCGTCACCAAGATGGACAAGGCTTCGATACTAGGAGACGCCATCGAGTACGTGAAGCAGTTGCAGAAACGCATTCAGGAACTGGAGCTGCGAGATAAGCAGGCCGAGTCGTCCCATTTGCCGCGTTCTCATGCAGACGATCTGAGCAAATCGCAGTTGGGAGACTCGACACCCAAAACCTCACCTTCTGAGACGTTCAACAGCTCCCATTTCGAGATAGTGTCTAATGGTAATCACATGACAGGTATAGAAACGAACGTGAATGTCAGCTTCGACGGAGCATCGAATTCCGATCCCAAAGTGCCCTCGGGTGACAACGAAATGAAATCTAGTCCCAGTCTTGCATCGGACCGAGAGGACCCGGGATTCTGCAATTCCGACGGGGAATCCAATGCTACACAGGCCAAAAGATTAGACGGAGTTAAAGCTAACGTCAAGGTCACAGCAGACGATGATGTGAGCCTTGAACTAAATTGCCCGTGGAGGAAAACCTTATTAGTAGATGTATTGCGAACTTTGAACGATCTGCAACTTGATGTATTCGTCGTTCAAGCTTCAACGAGTGATGGAACCCTCGCCACCGTTTTTAAAGGCAAGATGAGGGAGTCGACACATAGCCTTACGGCAACAAAGACCAAACTGCAGACAGCTTTGGAAGAAACCGCTGCTGGGATGGGCTCCAGATAACAGTTTCCATAAACAAAACGTCTCTGCCCACGTTGTGAATCCAAGTAGAGAGAGCATATTTGTAAAGGCAGGAACAAAGTTTCCTAAGGAGGTGTAGCGACCCAGGAACTCGACATCGTTAAATTTCTGCGAAGCATTTCGAGTAGGTGCGAGCTTATCTGCTGTATATGGTCACGCAGGTGCGGAGGAGGCGACTTTTATAAAGCTGGTAATCCGAATCTTCCTTCGAAACTGTCTACCATAACTACACTGAGCTGCAATGCAAGCTAAGGGCCTTACAGATCACCCAAAGTAGAAGAAGAATAAATCATGAGTGGGTGGGTGGGAGATGTACAAAATGTATGCATGTTACAATGTCCATTGTAGATTACAGTGTATAGTTGCAGATTAATACAAGGTTGTGGCATGCACTCCTGGCAATAAGCTTCCGTCCCCCACGAAAGTACTCGTAGGCGGACAATTTTTGTAAACATCAGTCAACAGGATGAAAGTCTGTGCAAAGCCTGACACCGCTTGCGACTATAAAGCAACAACAGGCAACCCGATTTCAA

CDS

>Mapoly0031s0161.2
ATGGCTGGAGCGGGCAAAAGAAATTCGTCCACACTTATCGAAGTTCCGAAGGCGACACTTCGAGGCCAATTACAGGCGGCCGTGCAAAGCATTAAGTGGACGTACACTGCCTTCTGGCAGCAATCGAAGCAGAAAGAAGTGCTTGTCTGGGGAGATGGATATTATAATGGTGCCATCAAAACGAGGAAGACAGTCCAGGCCGCCGAGCTCAGTCAAGAGGAACTCGGCATGCAGAGGACAAGACAACTGCGGGATTTATACGAAACTTTGTCAACCGCAGGAGATGGCAATCAGTCAACCACGAGAAGGCCGTCGGCGGCTCTGACGCCCGAGGACCTCACCGAGACCGAGTGGTTCTATCTGCTATGCATGTCGTGCTCATTCTCGCCGGAAAACGGATTGCCCGGCAAGGCTTTGGCGCAAGGGCGGCATCTGTGGCTGACTGAGACCAATGAGGCCAGCCCGGAAGTCTTCACTCGGTCCTTGTTGGCTAAGACTGCGCGAATCCAGACGGTTTTATGCATTCCTTTGTGCAAGGGCGTTGTGGAATTTGGAACTACAGAGCTTGGCGATACTCTTCTGCAGCAGCAGCAGCAGCAACAGCCAGGACGAAGTGGTGCCAACGTCGATCAACATGGAGCCAGTGCGGCCTGGCTCTCGACCTCGTCTCCGTGGGCGAGTGTCAACGTCAGCCATCAGGACTCGATGGTCACATTCTCACACGAAGCCGCCAGAGACAGCGCGCACGGGCACGGGCACGGGCTGCACGACGACGCGGTGGCCATGCTGGTGGACGATCAGAAGAGTATGGGCGCGAGCGCCAAGAGCTGGGACCTTCTCTCGGATCACATCGACGGCTTGCCCGGCAGCGACATCTCGCTGGACCCATACGTGGGCAGCGGGACGAACTCGTCCTCGGATCTCATGCTCCTGAGTGCCAGACATCCATCGTCGCAGCCGCTGCAACATTTACGTCGATTCGGATCTCAGCGCGCCGCCGCGCACTCGCTCGACCACGCCGAGCCCGACCCCTTGACCCGCTACGACCGCCAACGACAACAGCCGCTGGGCTCGACCAGCGCCTTCGTCGACTGGAGAATGACGGCCGGGTCCGCCCCCAAGGCGCCGCTCCCGGGGAACCAGCAGTGGATGCTGAAGAACGCCTTGTTCCACATCACGCACTTGTACTCTGCTCCGCGCAGCGACGAAGCCACTCTCGTCTCGGCCGACAATCGCAGCCGCTCCGGCGGTCCCCGGAAACCGGCTGGCGCGCAGGAGGATCTGAACGTGAGTCATGTGCTCGCAGAGCGCCGCCGGCGCGAGAAGCTGAACGATCGGTTTATGTCACTCCGAGCCCTCGTTCCGTTCGTCACCAAGATGGACAAGGCTTCGATACTAGGAGACGCCATCGAGTACGTGAAGCAGTTGCAGAAACGCATTCAGGAACTGGAGCTGCGAGATAAGCAGGCCGAGTCGTCCCATTTGCCGCGTTCTCATGCAGACGATCTGAGCAAATCGCAGTTGGGAGACTCGACACCCAAAACCTCACCTTCTGAGACGTTCAACAGCTCCCATTTCGAGATAGTGTCTAATGGTAATCACATGACAGGTATAGAAACGAACGTGAATGTCAGCTTCGACGGAGCATCGAATTCCGATCCCAAAGTGCCCTCGGGTGACAACGAAATGAAATCTAGTCCCAGTCTTGCATCGGACCGAGAGGACCCGGGATTCTGCAATTCCGACGGGGAATCCAATGCTACACAGGCCAAAAGATTAGACGGAGTTAAAGCTAACGTCAAGGTCACAGCAGACGATGATGTGAGCCTTGAACTAAATTGCCCGTGGAGGAAAACCTTATTAGTAGATGTATTGCGAACTTTGAACGATCTGCAACTTGATGTATTCGTCGTTCAAGCTTCAACGAGTGATGGAACCCTCGCCACCGTTTTTAAAGGCAAGATGAGGGAGTCGACACATAGCCTTACGGCAACAAAGACCAAACTGCAGACAGCTTTGGAAGAAACCGCTGCTGGGATGGGCTCCAGATAA

Protein

>Mapoly0031s0161.2
MAGAGKRNSSTLIEVPKATLRGQLQAAVQSIKWTYTAFWQQSKQKEVLVWGDGYYNGAIKTRKTVQAAELSQEELGMQRTRQLRDLYETLSTAGDGNQSTTRRPSAALTPEDLTETEWFYLLCMSCSFSPENGLPGKALAQGRHLWLTETNEASPEVFTRSLLAKTARIQTVLCIPLCKGVVEFGTTELGDTLLQQQQQQQPGRSGANVDQHGASAAWLSTSSPWASVNVSHQDSMVTFSHEAARDSAHGHGHGLHDDAVAMLVDDQKSMGASAKSWDLLSDHIDGLPGSDISLDPYVGSGTNSSSDLMLLSARHPSSQPLQHLRRFGSQRAAAHSLDHAEPDPLTRYDRQRQQPLGSTSAFVDWRMTAGSAPKAPLPGNQQWMLKNALFHITHLYSAPRSDEATLVSADNRSRSGGPRKPAGAQEDLNVSHVLAERRRREKLNDRFMSLRALVPFVTKMDKASILGDAIEYVKQLQKRIQELELRDKQAESSHLPRSHADDLSKSQLGDSTPKTSPSETFNSSHFEIVSNGNHMTGIETNVNVSFDGASNSDPKVPSGDNEMKSSPSLASDREDPGFCNSDGESNATQAKRLDGVKANVKVTADDDVSLELNCPWRKTLLVDVLRTLNDLQLDVFVVQASTSDGTLATVFKGKMRESTHSLTATKTKLQTALEETAAGMGSR

Mapoly0031s0161.3  

Gene structure:

mRNA scaffold_31:1508881..1516201  ( - strand )
three_prime_UTR scaffold_31:1508881..1509431  ( - strand )
CDS scaffold_31:1509432..1509521  ( - strand )
CDS scaffold_31:1509663..1510247  ( - strand )
CDS scaffold_31:1510723..1511634  ( - strand )
CDS scaffold_31:1511925..1511981  ( - strand )
CDS scaffold_31:1512215..1512229  ( - strand )
CDS scaffold_31:1512457..1512553  ( - strand )
CDS scaffold_31:1513237..1513497  ( - strand )
CDS scaffold_31:1514045..1514181  ( - strand )
five_prime_UTR scaffold_31:1514182..1514201  ( - strand )
five_prime_UTR scaffold_31:1515294..1516201  ( - strand )

Sequences:

Gene

>Mapoly0031s0161.3
TGGAGGGGGTGGCCCTTCGGTCTGGAGGCCCGAGGGGCAGTGGAGGGCCGAGGACCAGAATGAGACTTGGAGTAGACCCCCCCACAGACACACACACCTCGCTGCGCGCATCATTGTAGTGCTTTCACTTGTCAGCTTCGAGACAAAGTCCACGGATCGAGCACAGGACAGCCCAGCCTCGCCTCGTCCCTCCCCTCTCGTTCCAGTTAGTCCGGCAGTCGGTCAGTCGGTTGGTCTTGTGGGTGACTGACTGACTAGTCGACGAGCCGACCCTGAGCCTGCGCCTTTGCCTGTGCCTGCTTGCCTGTCTGCCTGCTTGCCTCGCCTTGCTCGTCGGCTGGCTGCGACGGAGATCATTTCGCACAATTTTCGGCCATTGTTTCGATTTCGGAAATCTCTGACGGAGAAAAATAGATGTGTGCTGTTTTCGGGTGGGGGCCAAACTAGGTCCGAGCTCGGACTCGAGCTCGAGCACCCTCGAGTACAGTGAGCTAGCGACCAATACAGCGCGGGGCGAAGCGAGACGAGATCAGAGGGAGCAAGAGCCCCCATCGATACTGATACTGTCGATTCCAGTAGCTTCGCCTGCTGTCCTGGATTTGGTGTCGCTCGGCAGGAGATTTTAGAATAGGAGGTCTCTGGGCTGGGCTGGGCAGGCCGCTTTATTTCTAGTGCGCTAAAGGTGACGGTCCTCGTGCAGAGCAATTTCGTGAAGAACGACTGTGGGACGACGTCGTTTGGCCGCAATTCTGTAATTCGTTTCGCCACTTATTTCAGATGTTTTCAGCGGAGGTTTGCAGCTTACTGGGGCTTGCCACTTTGCCGGAGACTGGAGAGCTGCTGAATGAGGCCCGTCTCGTTCATGAAGACTAGGAAACGATTCGGCCTGCAGTAATCGCCGCAAGCTTGTGAGTGTCCATCTGTCACCTTCCACCCTCTCTCGTCGGATCGCGTGCCTCGTGTGAATGTCGTCAGTAATAAAACAAGGTCGACAGGTCCTTTGTCACAGCCACGAATGTGCATTCGGGCTGAACTCTAGGCCGTAAAGCGCACATTCAATTCACCAGCTTGCCGCCATAATTTTGCGATCCTTAGCTCTGTTTACTCGGTGTCCTGGTTCACGACTGAATGCTTCCGAACGAGCTTATGGCATGAACACAGACAGGGTTACAAATTAAAACATATCAGACGTAAGATAGTTCGTGCACCACATTCGCTCCGAGCAGGCCGAGGTTTCCGATCAATTATTCACGTGCAGGACCATGGGACGGCAACATATGCGTGATCACGAGCAGCATTCATAGATTCGGATGATATGATTTTCCAAGCTGCTTTCGCGGAGTAGTTGGTAGAGACGTATCCGAGCCTTTACTGTTCAGTGATAGATGTCGAGAATGCGTCAGAATATTGTGAGTCGTCGGGCCAGTGAATATGCATGGGTCACTTTAAAATGACCCACCCTCGGAAAAGGGGTTAGGCGTGTTCACCTGAATTCACAGAAACATTGGTGCTTTAGATGATTTAAAAAGAGTATCCAGCTCGCTTCCTAAGCTCCACACTCGCCTGCTTTCAAGCGTGATTACACGCCACAACTCGGAATCTAGCTTCATTTCTCCTTGTTATGTCGTCCACCTTCTTTTCGCTCGTTTGTGCAAGCTTGGCGGTTGATTCCGAGCTCTCGGACGAAGTGGTTGCTGCAAACGCTGATGTCGCATAGGGCTTTAGAGGGCGCCACGAAATTAGAAACGTATGAATTGCTACATCTTCAGTGTCAGTCAGTGAAGACAGTCAATCGGTCTAGCATAGTTCTAGTTCTGAATGAAACGTGGGAGTGAGGAGTTGCAGAGTTGAGTGTCAAAGTCGAGGGGAGAAAGATGTTTTTATTTTCAGTTTATAGCGTTGGCCGCATGTGACATTACTGCGATCGGTGATCGGACTGCGGACTGTGATCCAGATTTCCAGAAACCTTTAATCACGAACGTAACAGCGTCTCTGCGCAGGAAATGTGTGCTACGACACGATGGCTGGAGCGGGCAAAAGAAATTCGTCCACACTTATCGAAGTTCCGAAGGCGACACTTCGAGGCCAATTACAGGCGGCCGTGCAAAGCATTAAGTGGACGTACACTGCCTTCTGGCAGCAATCGAAGCAGAAAGAGTAAACACTTTGAGCACGCATGCGCATCCATGTCCATGTTTGTTCAGCTGATTTGTGGGCTCTTCTTGGCTAGCGGGCCTATATTGTCGGCCTTGCTCCTGCTGCTGCTGCTGCTGCTTGATTTTCCTGCTCTCCGCCTGAAGCTAAATTAGGAAAGAATGTGTGTTTTTTTCTTCCGGCAGTCCAATCCAAATGTAGTCCAGTCCAGTTCAGTCCAGTTTCGAGATACACGGCGGGCGAGCGAGCGCTTCGCTTCACTGCAACAACTCGTGATGGTGCCCGGATTGCATATCCGCCTCGCCTCGTATCAGATTCGCTCCTAGGATCGAAAGTCAACAATTAAATATCATCACGATCAGGTTGAAGACTTGTGTACCGGGGGGTGTAGAACGATGGCAGGGATGGATGGATGATGCTCTAGTTTCCAGAGGATGGTTGAAAATTGGAGCTTCGGTCGTAGAGCCGCTGGAACCGGGATTGCAATGACGACATGCCATCCCATCGAGGACACTAATGGGCAACGGTCGGTCCGGGCTTTGTCTTGCAGAGTGCTTGTCTGGGGAGATGGATATTATAATGGTGCCATCAAAACGAGGAAGACAGTCCAGGCCGCCGAGCTCAGTCAAGAGGAACTCGGCATGCAGAGGACAAGACAACTGCGGGATTTATACGAAACTTTGTCAACCGCAGGAGATGGCAATCAGTCAACCACGAGAAGGCCGTCGGCGGCTCTGACGCCCGAGGACCTCACCGAGACCGAGTGGTTCTATCTGCTATGCATGTCGTGCTCATTCTCGCCGGAAAACGGGTAATGTATTTCTGAGTCCGCCCGCTCTCCTCGATTCCCCGTTTCGATGTCATTCCGAGTCAATTCATTCCAGTCCTTCAGAGGCGAGTCAAACCCATACGGGATCGCGAGACATTCAGCGACATAGTGTGGCTCGTGATGCTGATGCTGATGTTGGCCACAGCCGTAGTGATGCACCTCGGTTTCTTTTTCAAATCTTGACCCCCGCGGGACTGCCTAGCTCCCTGTCCTGCCAATCCCATCCCATTCCATCCTATCGAAGCTCAGCTCAGCTCAGCTCAGCCCTGATCATCTGGACTTTGCTGGAGAGTTGACCGAAAGTGATTTGGTTGAAATCCAGTTTCCCTTCAAAGCAAGAAATGTTGACGTGGATCCGTCGCGTACATTATACGAATCCCTACTGTATGAGCTAAACCTCTGCCACCGTGTGTGGTGCATATGCATGTTCGCCTGAACCCAACCCGAGAGCTTTGCTTTACTGCTGCCAGTCTGTTCTGTGCTGTGCTGTTGCGACAGTTTGCAAACTCTCGACCCGGCAGCTTCGGGGCGAATGCCAAAGCGGAATGGTGGGTTGTTTGGGTAGATGGATGGGTATGGATGGTGATTCTGCAATCCTGTAGCCGGATATACTGATGTGACTCGGTCAAACAGCTGAAGATTTCAGAACCTTGTGACTTGTGCAGATTGCCCGGCAAGGCTTTGGCGCAAGGGCGGCATCTGTGGCTGACTGAGACCAATGAGGCCAGCCCGGAAGTCTTCACTCGGTCCTTGTTGGCTAAGGTTTGCCTCCCAAAGATTCCAGCTCTCCTTTGGGTGCATAGGAATTTTAATAGCAGGAATATTTTTGCTCGGGGTTGTTGACTTTCCTGCATCACTGTCTTCGTCATCGTTGGACTCGAGCGTCTCTGACGGTTCGAGAGTAGTCCACCCCTTGGTGGCAAGCGTCTGATGGCCCTCGTCTGTTGTTGGTTGCATGACGATACCATCTGATCGACCTCGGGCAACAGACTGCGCGAATCCAGGTACAGCCGAGCCCGTCTCTCTTAACTGCGTGCGCAAAGTAAAGCTTACAGTTGTCCATCTGCAGGAACTCTAGAACAGATGAGACGGAATGCTCTATAGCTGCAGCAAATTGGTTCAGGCCAGCAAGTTTCTGTTGTGATGGAACATCCCTAGCATTGAACGATTTGAAAAGTTAGTCCAAGACCAGACTGGAACCTTACCACATCGATTTGTTCACATTTGCTCTCGACAGACGGTTTTATGCATTCCTTTGTGCAAGGGCGTTGTGGAATTTGGAACTACAGAGCTTGTAAGTAAACCCCGTGCTTCTCTACGAGATACGAACTTCTTTGTTGAAACGAATTCCTTCCAGCTAGCGCAGCTGTAGGATGTTGTTCAATGCTCTATATATTCTGATGACGGACCGCATTCAGCACACGTGCCCACATCTCATTACGAGGTACCGAAATGTGTCTCCGGGTGCACGAGCTCGAATGTAGACAGCAGGGTCAGTAAAAGCACCAGTCGAGTTCCGGCGATGAAATTGCTAGCCTTCATGGATACGAGGTATTAAAAAGAGCTCGCCAAATTGTGCGTCAGGTGCGTGAAGACCCCGCTCTAGTACAGCACATCAAGACATTCTTCGCGGAACAGTTCAAACCCGTGGGCTCTGAGCAATCGTCTTCGGGTCCTCAACATCAGGGCGATACTCTTCTGCAGCAGCAGCAGCAGCAACAGCCAGGACGAAGTGGTGCCAACGTCGATCAACATGGAGCCAGTGCGGCCTGGCTCTCGACCTCGTCTCCGTGGGCGAGTGTCAACGTCAGCCATCAGGACTCGATGGTCACATTCTCACACGAAGCCGCCAGAGACAGCGCGCACGGGCACGGGCACGGGCTGCACGACGACGCGGTGGCCATGCTGGTGGACGATCAGAAGAGTATGGGCGCGAGCGCCAAGAGCTGGGACCTTCTCTCGGATCACATCGACGGCTTGCCCGGCAGCGACATCTCGCTGGACCCATACGTGGGCAGCGGGACGAACTCGTCCTCGGATCTCATGCTCCTGAGTGCCAGACATCCATCGTCGCAGCCGCTGCAACATTTACGTCGATTCGGATCTCAGCGCGCCGCCGCGCACTCGCTCGACCACGCCGAGCCCGACCCCTTGACCCGCTACGACCGCCAACGACAACAGCCGCTGGGCTCGACCAGCGCCTTCGTCGACTGGAGAATGACGGCCGGGTCCGCCCCCAAGGCGCCGCTCCCGGGGAACCAGCAGTGGATGCTGAAGAACGCCTTGTTCCACATCACGCACTTGTACTCTGCTCCGCGCAGCGACGAAGCCACTCTCGTCTCGGCCGACAATCGCAGCCGCTCCGGCGGTCCCCGGAAACCGGCTGGCGCGCAGGAGGATCTGAACGTGAGTCATGTGCTCGCAGAGCGCCGCCGGCGCGAGAAGCTGAACGATCGGTTTATGTCACTCCGAGCCCTCGTTCCGTTCGTCACCAAGGTACGACCCCGACCCTGATCCCATGGCCCTCACTCGCTCCCAGTCTCAGTACGCGTCCTCTCCACTCGAATACACATCAGGACATGAATTCTCTTTCCTGTTCTCCATGATCGACTCTGAGAGCTCCACAATTCGGGGAGTAGTATCGGTAGACACATGACCTGATGAGAAGCAGCTGTGAGCCGCAGTAGCTGCTGCCATAAGGCACTTATTTGTTTTTCGACAGGTCCTTGCAATCCAGATGGAGACAGTAACTCGTCCAGGATTGATTCTTTCGAGGTGTCCATTTTGGTTATCCGTGTTAGCTGCAAGTGCATGCATCATGACGCCGAGTCAAAGCACAACGTAGTGACGAGTATTAGGTGATCGAACATCGAGATGCTGTTTCATGTGGATTCTCTCACCGTCGTGATGTGATGTGAGGAAGGAAGCAGAACTGGTTGCATTATTCGGATTCGGCTCGTGGCGTGTGCAGATGGACAAGGCTTCGATACTAGGAGACGCCATCGAGTACGTGAAGCAGTTGCAGAAACGCATTCAGGAACTGGAGCTGCGAGATAAGCAGGCCGAGTCGTCCCATTTGCCGCGTTCTCATGCAGACGATCTGAGCAAATCGCAGTTGGGAGACTCGACACCCAAAACCTCACCTTCTGAGACGTTCAACAGCTCCCATTTCGAGATAGTGTCTAATGGTAATCACATGACAGGTATAGAAACGAACGTGAATGTCAGCTTCGACGGAGCATCGAATTCCGATCCCAAAGTGCCCTCGGGTGACAACGAAATGAAATCTAGTCCCAGTCTTGCATCGGACCGAGAGGACCCGGGATTCTGCAATTCCGACGGGGAATCCAATGCTACACAGGCCAAAAGATTAGACGGAGTTAAAGCTAACGTCAAGGTCACAGCAGACGATGATGTGAGCCTTGAACTAAATTGCCCGTGGAGGAAAACCTTATTAGTAGATGTATTGCGAACTTTGAACGATCTGCAACTTGATGTATTCGTCGTTCAAGCTTCAACGAGTGATGGAACCCTCGCCACCGTTTTTAAAGGCAAGGTGCGTGCACTGGCGATGCGCATGCTCTTCTCCCTCTCGTTTCATGCCCACCTATCGGTCGAATTTCCTTCTTTTCCATACCAGGAGGAAGGAGGTGCACATGTCAAAGGCTTAATTTGCTTGATGTTCGGTTTTGTGCAGATGAGGGAGTCGACACATAGCCTTACGGCAACAAAGACCAAACTGCAGACAGCTTTGGAAGAAACCGCTGCTGGGATGGGCTCCAGATAACAGTTTCCATAAACAAAACGTCTCTGCCCACGTTGTGAATCCAAGTAGAGAGAGCATATTTGTAAAGGCAGGAACAAAGTTTCCTAAGGAGGTGTAGCGACCCAGGAACTCGACATCGTTAAATTTCTGCGAAGCATTTCGAGTAGGTGCGAGCTTATCTGCTGTATATGGTCACGCAGGTGCGGAGGAGGCGACTTTTATAAAGCTGGTAATCCGAATCTTCCTTCGAAACTGTCTACCATAACTACACTGAGCTGCAATGCAAGCTAAGGGCCTTACAGATCACCCAAAGTAGAAGAAGAATAAATCATGAGTGGGTGGGTGGGAGATGTACAAAATGTATGCATGTTACAATGTCCATTGTAGATTACAGTGTATAGTTGCAGATTAATACAAGGTTGTGGCATGCACTCCTGGCAATAAGCTTCCGTCCCCCACGAAAGTACTCGTAGGCGGACAATTTTTGTAAACATCAGTCAACAGGATGAAAGTCTGTGCAAAGCCTGACACCGCTTGCGACTATAAAGCAACAACAGGCAACCCGATTTCAA

mRNA

>Mapoly0031s0161.3
TGGAGGGGGTGGCCCTTCGGTCTGGAGGCCCGAGGGGCAGTGGAGGGCCGAGGACCAGAATGAGACTTGGAGTAGACCCCCCCACAGACACACACACCTCGCTGCGCGCATCATTGTAGTGCTTTCACTTGTCAGCTTCGAGACAAAGTCCACGGATCGAGCACAGGACAGCCCAGCCTCGCCTCGTCCCTCCCCTCTCGTTCCAGTTAGTCCGGCAGTCGGTCAGTCGGTTGGTCTTGTGGGTGACTGACTGACTAGTCGACGAGCCGACCCTGAGCCTGCGCCTTTGCCTGTGCCTGCTTGCCTGTCTGCCTGCTTGCCTCGCCTTGCTCGTCGGCTGGCTGCGACGGAGATCATTTCGCACAATTTTCGGCCATTGTTTCGATTTCGGAAATCTCTGACGGAGAAAAATAGATGTGTGCTGTTTTCGGGTGGGGGCCAAACTAGGTCCGAGCTCGGACTCGAGCTCGAGCACCCTCGAGTACAGTGAGCTAGCGACCAATACAGCGCGGGGCGAAGCGAGACGAGATCAGAGGGAGCAAGAGCCCCCATCGATACTGATACTGTCGATTCCAGTAGCTTCGCCTGCTGTCCTGGATTTGGTGTCGCTCGGCAGGAGATTTTAGAATAGGAGGTCTCTGGGCTGGGCTGGGCAGGCCGCTTTATTTCTAGTGCGCTAAAGGTGACGGTCCTCGTGCAGAGCAATTTCGTGAAGAACGACTGTGGGACGACGTCGTTTGGCCGCAATTCTGTAATTCGTTTCGCCACTTATTTCAGATGTTTTCAGCGGAGGTTTGCAGCTTACTGGGGCTTGCCACTTTGCCGGAGACTGGAGAGCTGCTGAATGAGGCCCGTCTCGTTCATGAAGACTAGGAAACGATTCGGCCTGCAGTAATCGCCGCAAGCTTGAAATGTGTGCTACGACACGATGGCTGGAGCGGGCAAAAGAAATTCGTCCACACTTATCGAAGTTCCGAAGGCGACACTTCGAGGCCAATTACAGGCGGCCGTGCAAAGCATTAAGTGGACGTACACTGCCTTCTGGCAGCAATCGAAGCAGAAAGAAGTGCTTGTCTGGGGAGATGGATATTATAATGGTGCCATCAAAACGAGGAAGACAGTCCAGGCCGCCGAGCTCAGTCAAGAGGAACTCGGCATGCAGAGGACAAGACAACTGCGGGATTTATACGAAACTTTGTCAACCGCAGGAGATGGCAATCAGTCAACCACGAGAAGGCCGTCGGCGGCTCTGACGCCCGAGGACCTCACCGAGACCGAGTGGTTCTATCTGCTATGCATGTCGTGCTCATTCTCGCCGGAAAACGGATTGCCCGGCAAGGCTTTGGCGCAAGGGCGGCATCTGTGGCTGACTGAGACCAATGAGGCCAGCCCGGAAGTCTTCACTCGGTCCTTGTTGGCTAAGACTGCGCGAATCCAGACGGTTTTATGCATTCCTTTGTGCAAGGGCGTTGTGGAATTTGGAACTACAGAGCTTGTGCGTGAAGACCCCGCTCTAGTACAGCACATCAAGACATTCTTCGCGGAACAGTTCAAACCCGTGGGCTCTGAGCAATCGTCTTCGGGTCCTCAACATCAGGGCGATACTCTTCTGCAGCAGCAGCAGCAGCAACAGCCAGGACGAAGTGGTGCCAACGTCGATCAACATGGAGCCAGTGCGGCCTGGCTCTCGACCTCGTCTCCGTGGGCGAGTGTCAACGTCAGCCATCAGGACTCGATGGTCACATTCTCACACGAAGCCGCCAGAGACAGCGCGCACGGGCACGGGCACGGGCTGCACGACGACGCGGTGGCCATGCTGGTGGACGATCAGAAGAGTATGGGCGCGAGCGCCAAGAGCTGGGACCTTCTCTCGGATCACATCGACGGCTTGCCCGGCAGCGACATCTCGCTGGACCCATACGTGGGCAGCGGGACGAACTCGTCCTCGGATCTCATGCTCCTGAGTGCCAGACATCCATCGTCGCAGCCGCTGCAACATTTACGTCGATTCGGATCTCAGCGCGCCGCCGCGCACTCGCTCGACCACGCCGAGCCCGACCCCTTGACCCGCTACGACCGCCAACGACAACAGCCGCTGGGCTCGACCAGCGCCTTCGTCGACTGGAGAATGACGGCCGGGTCCGCCCCCAAGGCGCCGCTCCCGGGGAACCAGCAGTGGATGCTGAAGAACGCCTTGTTCCACATCACGCACTTGTACTCTGCTCCGCGCAGCGACGAAGCCACTCTCGTCTCGGCCGACAATCGCAGCCGCTCCGGCGGTCCCCGGAAACCGGCTGGCGCGCAGGAGGATCTGAACGTGAGTCATGTGCTCGCAGAGCGCCGCCGGCGCGAGAAGCTGAACGATCGGTTTATGTCACTCCGAGCCCTCGTTCCGTTCGTCACCAAGATGGACAAGGCTTCGATACTAGGAGACGCCATCGAGTACGTGAAGCAGTTGCAGAAACGCATTCAGGAACTGGAGCTGCGAGATAAGCAGGCCGAGTCGTCCCATTTGCCGCGTTCTCATGCAGACGATCTGAGCAAATCGCAGTTGGGAGACTCGACACCCAAAACCTCACCTTCTGAGACGTTCAACAGCTCCCATTTCGAGATAGTGTCTAATGGTAATCACATGACAGGTATAGAAACGAACGTGAATGTCAGCTTCGACGGAGCATCGAATTCCGATCCCAAAGTGCCCTCGGGTGACAACGAAATGAAATCTAGTCCCAGTCTTGCATCGGACCGAGAGGACCCGGGATTCTGCAATTCCGACGGGGAATCCAATGCTACACAGGCCAAAAGATTAGACGGAGTTAAAGCTAACGTCAAGGTCACAGCAGACGATGATGTGAGCCTTGAACTAAATTGCCCGTGGAGGAAAACCTTATTAGTAGATGTATTGCGAACTTTGAACGATCTGCAACTTGATGTATTCGTCGTTCAAGCTTCAACGAGTGATGGAACCCTCGCCACCGTTTTTAAAGGCAAGATGAGGGAGTCGACACATAGCCTTACGGCAACAAAGACCAAACTGCAGACAGCTTTGGAAGAAACCGCTGCTGGGATGGGCTCCAGATAACAGTTTCCATAAACAAAACGTCTCTGCCCACGTTGTGAATCCAAGTAGAGAGAGCATATTTGTAAAGGCAGGAACAAAGTTTCCTAAGGAGGTGTAGCGACCCAGGAACTCGACATCGTTAAATTTCTGCGAAGCATTTCGAGTAGGTGCGAGCTTATCTGCTGTATATGGTCACGCAGGTGCGGAGGAGGCGACTTTTATAAAGCTGGTAATCCGAATCTTCCTTCGAAACTGTCTACCATAACTACACTGAGCTGCAATGCAAGCTAAGGGCCTTACAGATCACCCAAAGTAGAAGAAGAATAAATCATGAGTGGGTGGGTGGGAGATGTACAAAATGTATGCATGTTACAATGTCCATTGTAGATTACAGTGTATAGTTGCAGATTAATACAAGGTTGTGGCATGCACTCCTGGCAATAAGCTTCCGTCCCCCACGAAAGTACTCGTAGGCGGACAATTTTTGTAAACATCAGTCAACAGGATGAAAGTCTGTGCAAAGCCTGACACCGCTTGCGACTATAAAGCAACAACAGGCAACCCGATTTCAA

CDS

>Mapoly0031s0161.3
ATGGCTGGAGCGGGCAAAAGAAATTCGTCCACACTTATCGAAGTTCCGAAGGCGACACTTCGAGGCCAATTACAGGCGGCCGTGCAAAGCATTAAGTGGACGTACACTGCCTTCTGGCAGCAATCGAAGCAGAAAGAAGTGCTTGTCTGGGGAGATGGATATTATAATGGTGCCATCAAAACGAGGAAGACAGTCCAGGCCGCCGAGCTCAGTCAAGAGGAACTCGGCATGCAGAGGACAAGACAACTGCGGGATTTATACGAAACTTTGTCAACCGCAGGAGATGGCAATCAGTCAACCACGAGAAGGCCGTCGGCGGCTCTGACGCCCGAGGACCTCACCGAGACCGAGTGGTTCTATCTGCTATGCATGTCGTGCTCATTCTCGCCGGAAAACGGATTGCCCGGCAAGGCTTTGGCGCAAGGGCGGCATCTGTGGCTGACTGAGACCAATGAGGCCAGCCCGGAAGTCTTCACTCGGTCCTTGTTGGCTAAGACTGCGCGAATCCAGACGGTTTTATGCATTCCTTTGTGCAAGGGCGTTGTGGAATTTGGAACTACAGAGCTTGTGCGTGAAGACCCCGCTCTAGTACAGCACATCAAGACATTCTTCGCGGAACAGTTCAAACCCGTGGGCTCTGAGCAATCGTCTTCGGGTCCTCAACATCAGGGCGATACTCTTCTGCAGCAGCAGCAGCAGCAACAGCCAGGACGAAGTGGTGCCAACGTCGATCAACATGGAGCCAGTGCGGCCTGGCTCTCGACCTCGTCTCCGTGGGCGAGTGTCAACGTCAGCCATCAGGACTCGATGGTCACATTCTCACACGAAGCCGCCAGAGACAGCGCGCACGGGCACGGGCACGGGCTGCACGACGACGCGGTGGCCATGCTGGTGGACGATCAGAAGAGTATGGGCGCGAGCGCCAAGAGCTGGGACCTTCTCTCGGATCACATCGACGGCTTGCCCGGCAGCGACATCTCGCTGGACCCATACGTGGGCAGCGGGACGAACTCGTCCTCGGATCTCATGCTCCTGAGTGCCAGACATCCATCGTCGCAGCCGCTGCAACATTTACGTCGATTCGGATCTCAGCGCGCCGCCGCGCACTCGCTCGACCACGCCGAGCCCGACCCCTTGACCCGCTACGACCGCCAACGACAACAGCCGCTGGGCTCGACCAGCGCCTTCGTCGACTGGAGAATGACGGCCGGGTCCGCCCCCAAGGCGCCGCTCCCGGGGAACCAGCAGTGGATGCTGAAGAACGCCTTGTTCCACATCACGCACTTGTACTCTGCTCCGCGCAGCGACGAAGCCACTCTCGTCTCGGCCGACAATCGCAGCCGCTCCGGCGGTCCCCGGAAACCGGCTGGCGCGCAGGAGGATCTGAACGTGAGTCATGTGCTCGCAGAGCGCCGCCGGCGCGAGAAGCTGAACGATCGGTTTATGTCACTCCGAGCCCTCGTTCCGTTCGTCACCAAGATGGACAAGGCTTCGATACTAGGAGACGCCATCGAGTACGTGAAGCAGTTGCAGAAACGCATTCAGGAACTGGAGCTGCGAGATAAGCAGGCCGAGTCGTCCCATTTGCCGCGTTCTCATGCAGACGATCTGAGCAAATCGCAGTTGGGAGACTCGACACCCAAAACCTCACCTTCTGAGACGTTCAACAGCTCCCATTTCGAGATAGTGTCTAATGGTAATCACATGACAGGTATAGAAACGAACGTGAATGTCAGCTTCGACGGAGCATCGAATTCCGATCCCAAAGTGCCCTCGGGTGACAACGAAATGAAATCTAGTCCCAGTCTTGCATCGGACCGAGAGGACCCGGGATTCTGCAATTCCGACGGGGAATCCAATGCTACACAGGCCAAAAGATTAGACGGAGTTAAAGCTAACGTCAAGGTCACAGCAGACGATGATGTGAGCCTTGAACTAAATTGCCCGTGGAGGAAAACCTTATTAGTAGATGTATTGCGAACTTTGAACGATCTGCAACTTGATGTATTCGTCGTTCAAGCTTCAACGAGTGATGGAACCCTCGCCACCGTTTTTAAAGGCAAGATGAGGGAGTCGACACATAGCCTTACGGCAACAAAGACCAAACTGCAGACAGCTTTGGAAGAAACCGCTGCTGGGATGGGCTCCAGATAA

Protein

>Mapoly0031s0161.3
MAGAGKRNSSTLIEVPKATLRGQLQAAVQSIKWTYTAFWQQSKQKEVLVWGDGYYNGAIKTRKTVQAAELSQEELGMQRTRQLRDLYETLSTAGDGNQSTTRRPSAALTPEDLTETEWFYLLCMSCSFSPENGLPGKALAQGRHLWLTETNEASPEVFTRSLLAKTARIQTVLCIPLCKGVVEFGTTELVREDPALVQHIKTFFAEQFKPVGSEQSSSGPQHQGDTLLQQQQQQQPGRSGANVDQHGASAAWLSTSSPWASVNVSHQDSMVTFSHEAARDSAHGHGHGLHDDAVAMLVDDQKSMGASAKSWDLLSDHIDGLPGSDISLDPYVGSGTNSSSDLMLLSARHPSSQPLQHLRRFGSQRAAAHSLDHAEPDPLTRYDRQRQQPLGSTSAFVDWRMTAGSAPKAPLPGNQQWMLKNALFHITHLYSAPRSDEATLVSADNRSRSGGPRKPAGAQEDLNVSHVLAERRRREKLNDRFMSLRALVPFVTKMDKASILGDAIEYVKQLQKRIQELELRDKQAESSHLPRSHADDLSKSQLGDSTPKTSPSETFNSSHFEIVSNGNHMTGIETNVNVSFDGASNSDPKVPSGDNEMKSSPSLASDREDPGFCNSDGESNATQAKRLDGVKANVKVTADDDVSLELNCPWRKTLLVDVLRTLNDLQLDVFVVQASTSDGTLATVFKGKMRESTHSLTATKTKLQTALEETAAGMGSR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>