Mapoly0034s0053



Description

CIRCADIAN PROTEIN CLOCK/ARNT/BMAL/PAS

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_156343
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR23042 CIRCADIAN PROTEIN CLOCK/ARNT/BMAL/PAS

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH32 transcription factor, bHLH Mapoly0034s0053.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0034s0053.1 scaffold_34:616406..621990  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0034s0053.1  

Gene structure:

mRNA scaffold_34:616406..621990  ( + strand )
five_prime_UTR scaffold_34:616406..617460  ( + strand )
five_prime_UTR scaffold_34:618621..618695  ( + strand )
CDS scaffold_34:618696..618746  ( + strand )
CDS scaffold_34:619012..619761  ( + strand )
CDS scaffold_34:620064..620441  ( + strand )
CDS scaffold_34:621042..621116  ( + strand )
three_prime_UTR scaffold_34:621117..621990  ( + strand )

Sequences:

Gene

>Mapoly0034s0053.1
GAAAGGCGAGAGCGCGAGCGCGAGCTGGAGCTGGGAGTGAGTCGGGGAGCGATCGGTCGATCGAATGGCGAGTGCAGGCGCGGAGTGAGGAGAGGGCGCTGCGCTGCGCTGAGCAGCGGGTCAGCTGGCACGAAAGGCAAGAACGAGGCGGGCGAAGAAGATCAGCGGAAGAAAATGGTATTCCGGCTTCGGGAGATGCGCCTGCGGGCCGGGCGAGGCCGCTAGGTAGATGAGGAAGGCGCCGTAGGTTTTGGATCTGTAATTCTGGTCATGAGCAGCAGCAGCAGCTTGTTCGCCTCGTGGGGACCGATGGGGCTCGGATAAGCTGTGCGTGCGTGCGCTGGGAGCTGCAACTCGAGGCTTATGTTTGCGCGTCGGAAGTGTCCATCGCTGTAATCGCTCTGGGGTAGTTCGCTCTGATTAACAGCTCCGGTTCGTACTTGAAAACCTCCTTCTTTGGGTGTTGTGCTCTGCAGTCTTACCCGACCTCTGGCAGCTCAATGTTGAGCCCTTTCTTGGATATGCCTGCCTAGTTTGGAGAGGAGCGGTCTATCGAAGCCAGCCTGATTTTAACCTCTCGCTCTCCAGCGGATTCAATTGATGATCGTTTTCACCGGAAATGGGCTGTGTGTAGAGAATATTGTGATGTTGGTTTCTTCTGAAAGCGACCACGTTGTTCTGACGGAATTAAATTATCCTTCCCTTGTAGCTTTCGAGCTAGTTTCCACCGTACCAGGTCGGTCCTTGCGGAGAGTTGAAACTAGTGCACATGGTATGATACAGCATTGTATCTCCGCATTTGCTTTTTCTAGTCCAATGGAAGCACTGGATGGAAGCACTGTATCATGCCATGTCGACGGACCTTGTTCCGGATTCATTGCTGTGCAGTGTCCAGGAAACATATTAAAAGCCGATCATTTTTGGTTCCGTATGCTCCAGCATATACTATTTCGTTGAGTTAGTGTATATTGGAGTATTTCAGGCGCTCATCTTCGAAGGAGGTCGTGCGTACCTCCCATCGACGGATATATTTTTGAAAGTCTCCGATAAACAAGGTACCGTAGGAATCAATTTTATTATTCCAAGAATTACACCTGACGTAACTGCAAATACTGAAACTACTGCGAAGCTGGTTACGCCATTTCTTTCACAACCTGTGCTGCTCTAACCCTGTTAGTGAGGCTATGAATAGTTTGTTAACAGGAATAATTAAGTCAGATATGGAATATCACTGGCGATGAAGAACGATTTGGACTATATCTACAGTGAATTCTATCAGAGTGTGAGTTTACACTTGTTCAGTCTTCCTAAGAGCTAAATTTGTAACTGGACTAATTTTCCTTCGTCAAATAACATAACAGCCCCCAATTTATCAGCATCTTCAGTTCTATGTTTCTCACTTGTCGGAGACATTACCTGATCTCTACTTGATTGACAACCTTCCGCTATGTTCTGTCTACGCTCCGTTCGAGTAGGCGTGCTTCATGTCTTTACACTGACAGTTTCACGAGTTTCCTTATGTCTGCTCGTCACAATAATTTTTTTCTTATTATCCGTGTTTGCGCTAGGACAATCTCGCTAAAATTGCAAGAACCTGCGCATAGTATGACGGATATCAGAAGCAATCCTATGGAAACTTCGTAGGAAACCATATGAGCGGCATATTATGTCCGATGAACCTCAAAGTAACTGAACTACGGCAAAGAACAATGAAATTTTAATTTGCTACGAGAAGTAAATTAGGTGGGGGGTGTGTTGATATACCGTCATTTTACTATACATGCTGTTGTTTTGTAGCAGCGATAAGCACATGACGTCTATGAGAATAATTGCAAGAGAGCTTTCATGGTGTTCTTTCAGTTTTTGCTCCTCTCCTCCTGTCACAACATTATCATGTTGTACATGTTCTTGTTGGATCCTACCTTTAAGCGGACGCACCGGGGTATCGGCGTTTGCACTACGTGTGTGCTCAATTCTTGACTGGAATTGTTTTGGTTACTGTTTATGTATTTGAGTTATTCTTCTTCTTCTCTTTCTTCTCTTGTTTTAGTTGTTACTAGGCTTCTACCGTACTCACCTTTCTCCTCATTGTTACCTTCGTGCATGATATTTGATCGGGTCCGAAGATATTTCATAACTTTCCACCTCTCACAACCTGAAGGTGTCTTGCTGTTTGACGTTATGTTTGACAGAAACTTCTTTGATGTGCTTGCAGGTTCAAAACTCGCAGCGTAGCTCTTCAAGCACTTAATATTGCAGTTGGAGCTGGAATGTTATTGGACTTTTAACAATGGAGTTTGCACCTTCATCTACTAGTGCGATGCAGTGGTTGTCAGAGATGGTACAGTCCTATCTTAATTTCTGAATGATCATAAGAGACAGAATGTTGAGGGGTTTTCCTTCACCGCAGTATATCCCTCTTGCAAACTTTTAGACTTACAAAAATTGCGCTCGTTATTCCACTTTTGTAACTGCCGATGGCTTCCTTTGACGTCAGATGGATGTCTGTTACCTGCAAGTCAGCGACTGAAGTTCGATCTCCTTTGAATACATGGAGTTTGTGTTTCGTTTCTCTCCTGATTGAGACGTTGTTTTTTGTTAAGCAGGGACTGGAGGATCCTTCTCTTGTGAGGCACTTAGATAGTCTCTTTCCCCCTACATCAGAATCGCTTGTGAATGTCGTCGGACACCAAAATGGCCATAATCTTAGCTTTCCCTCATTGATGCCAGGATTTAAGACAGGTAACGATGTGAAGATCCCGAGTGCAGTGCCTCCTCACAATCTTTCATCGTACTCATCTCCATTGGACAGCCTTTGTAATCTTGAAAGGCCCATGAAGATGCTGAGGTCGAATGCTTGGGAAGGAAATATTTCTCAGCAAGGCCAAAGGAGCTCCACTGTACCGATTTACTCTGGAAAACCTCAGCACCGCATGGTGCAATTTTTGCAGCCCGAGAAGATTGGGAACCATCGTACTGAAGGGTTTACTTCTTTGTCGAAAATACCTGATGAAACACTGGAGTCTGTTGCTTCAACAACAACCTCTATTCCATGTCGTAACGGATTAAGAATCCAGGAAAATTGCAACGATGTACACTCCTCGATAGAAACAGAGAGTAACAGTTGTGGAAGAGAGAGTCCAAATTCTCTTGGAGAATCAATGCCAGGGAAGAGAAAACCAGATATGGATTACGTGGATGTGAAGCCGGATAGAGTCAATGCTGTCCAAGCACCATTCACCACTGTGAAAGGTTCTGGTCACACACAAGACCACATTATGGCCGAGAGGAAACGTCGGGAGAAGTTGAGCCAACGTTTTATTGCACTGTCTGCCATTGTACCAGGACTTAAAAAGGTGAGTCGCTCGTTTTAACTATTCCTGTGCCGAGGGGGCATCTTCCTCAGAGTTTGCAGAGTTTTAACATGTGTGCTGTGTATGTGGAGACCTTAGACCAAATATTAATTTCTGTCAAAAAGGCCGCAGTATCCTACTTGTGACGTTTCTTTTTTCAGCTATTGGTTTACTTGAAACAAATTCAAAATGTTATTCTATGCATCTAAGATAAAATCAAGCAAGCAGTTTCTCTCAGAGGAATCACGAAGCACAAAGTAGTGATAAAATACACCTCATTCACTCTGTCCTTTTTTATTTGATAGATGGACAAGGCTTCCGTCCTTGGTGATGCAATCAAATATGTCAAGCAGCTACAAGACCGGGTTAAAACCTTAGAAGAAAGCACTCCAAAGAAGGGCCTGCGGACAGTTTACACTGTGAAGAAACAGTCTAGAAACGCCAGCGATGAGGAGGATACGAGCGAGAACACCACTGTCACAACGGTTGAAGATGAAGAACAGGCTGCAGAGATTGAAGCTCGTATGATTGAGAAAAATGTTCTCATTAAACTGCACTGTGAGAAGAAGAAAGGTGTGCTAGTAAAATCTTTGGCGGAATTGGAGAAGCTGCGTCTGGTCGTTGTCAGTGCGAACATTCTTTCCTTTTCAGCAACCGCTCTTGACCTGACCTTCAATGCGAAGGTGACTCTTTTCCACCTACCAAATTTTTTGTTGAGGATATTATGTACAAACCTGTTTATTATGAATTTTCAGTGTCTTGTTCTCACGGTATTTTGCCCTATGTATTGCAAGTAAGTAATTACTTCCAGAAACAAAACAGTATATGTGACAGTCTCCATTTGAAATGATTTACAGCGGAACGAACCCATGAGTTGATGGGTCGGTTGACTATCAATACTAGTTAAGAAAATCCGATATTCATGGTGGGAGTGTTCTTTCTTGCATTTATTTTGCTCCAACAAGGTGCTCAGTTGAGTCTGCATTGAATTTAGGGAGATCCCAGTGATCTTTTTGACGGTTATGAATCAGGCTTCGCTATTTGACGAATCAAACACCGAGGCCTGCCCTTGTTTCTCATTCTCTTTGAGTTCTTGAGAGATTTTGGTGGGAAAGCACATTGGTCTCTTTGTCTTGCTGCTCGGGTTTCAAAACCTCAACTGCTCGTCAGCTATTGGGTTGTAGCTGACGGGCTTCTTTCCTTCGAAGATAGTGATGAGCTAATCCTGTTCTGTTTTCATTTGCGGCTATTCTAATGCATGCAAGCATGTTTCAATGTTTCAGGTCGAAGAAGGTTCCGAGCTGACTGCCGATGACATAGTTAATGCATTGCAGAAGCTTTTTAAAACTTTCACTTGAACCTGGCTGCAAAAGTCGAAGCTTGTGTCAAAAACTAACATAACGTAAACACAACGGTTACCAATTTGTGGGGAAGGGAGCTCAAGTCTTTGAGAAGTTCAAAGACTCTTGGAGATTTGAGCTTCATACTCTAAGAAACTTGTACAGGACACAGAGCAAACTATTTCAGGATAGTAGAGCGTATGACTTTCAGAGAATTTCCATTTTCTTCGTTTTTCATGCTTTTTCCCCCCGTGCATTTGAACCTACTCCCGATGGGGTTCAGTGTACAATCGGGGGTGTGGATTTTCACACATTTTCATCTGCCAGTCTGGGCTGTTACGACAAATTCCAGACCTGCCAAATTTTGTGCGAGAACTTTCTTGCTGTAACCTTCTGAAGCCCCTTAACTTACTCTCCCTCCACCTTCACTCAAGCTTTTTTCTTTTTTTAAGAGGATGCTTTGCTATCCCTTTTCCTAGAAGGTGGATGACAATAGTGGTAGTTTTTCAATCCAATGAGGGCCTGGCTCCCTTTTTGACTGCTGGTGGTCTATTGGTGATCTTCAGAATTTTTTTGCAGGGTCCATACCCTGTTCTCCATTTCTCAGACCACCTAAAGCCCACCAGTTCAGTTTTGGTCTCCAGGTATCAGGCTTAGCATTGAGCATGCTAAAAGTCAACTCATTATGGGTTGGGGTAGGGTTTCACGTAAGATATGATCTTGTGCTCGATCTGATTTGGTGTTCTTAGTGCTTTAACTAGTACCAACACATGTGTTGCTATGGAAAAAATGTACAAATACAAAAGTTTCATTGAGGATGATGCGTCCGTTGAGCATCCTTCTCATGACACATAAATAAAGTATGGAAGGTAGCCTTCAGGGCTTATAAGTC

mRNA

>Mapoly0034s0053.1
GAAAGGCGAGAGCGCGAGCGCGAGCTGGAGCTGGGAGTGAGTCGGGGAGCGATCGGTCGATCGAATGGCGAGTGCAGGCGCGGAGTGAGGAGAGGGCGCTGCGCTGCGCTGAGCAGCGGGTCAGCTGGCACGAAAGGCAAGAACGAGGCGGGCGAAGAAGATCAGCGGAAGAAAATGGTATTCCGGCTTCGGGAGATGCGCCTGCGGGCCGGGCGAGGCCGCTAGGTAGATGAGGAAGGCGCCGTAGGTTTTGGATCTGTAATTCTGGTCATGAGCAGCAGCAGCAGCTTGTTCGCCTCGTGGGGACCGATGGGGCTCGGATAAGCTGTGCGTGCGTGCGCTGGGAGCTGCAACTCGAGGCTTATGTTTGCGCGTCGGAAGTGTCCATCGCTGTAATCGCTCTGGGGTAGTTCGCTCTGATTAACAGCTCCGGTTCGTACTTGAAAACCTCCTTCTTTGGGTGTTGTGCTCTGCAGTCTTACCCGACCTCTGGCAGCTCAATGTTGAGCCCTTTCTTGGATATGCCTGCCTAGTTTGGAGAGGAGCGGTCTATCGAAGCCAGCCTGATTTTAACCTCTCGCTCTCCAGCGGATTCAATTGATGATCGTTTTCACCGGAAATGGGCTGTGTGTAGAGAATATTGTGATGTTGGTTTCTTCTGAAAGCGACCACGTTGTTCTGACGGAATTAAATTATCCTTCCCTTGTAGCTTTCGAGCTAGTTTCCACCGTACCAGGTCGGTCCTTGCGGAGAGTTGAAACTAGTGCACATGGTATGATACAGCATTGTATCTCCGCATTTGCTTTTTCTAGTCCAATGGAAGCACTGGATGGAAGCACTGTATCATGCCATGTCGACGGACCTTGTTCCGGATTCATTGCTGTGCAGTGTCCAGGAAACATATTAAAAGCCGATCATTTTTGGTTCCGTATGCTCCAGCATATACTATTTCGTTGAGTTAGTGTATATTGGAGTATTTCAGGCGCTCATCTTCGAAGGAGGTCGTGCGTACCTCCCATCGACGGATATATTTTTGAAAGTCTCCGATAAACAAGGTTCAAAACTCGCAGCGTAGCTCTTCAAGCACTTAATATTGCAGTTGGAGCTGGAATGTTATTGGACTTTTAACAATGGAGTTTGCACCTTCATCTACTAGTGCGATGCAGTGGTTGTCAGAGATGGGACTGGAGGATCCTTCTCTTGTGAGGCACTTAGATAGTCTCTTTCCCCCTACATCAGAATCGCTTGTGAATGTCGTCGGACACCAAAATGGCCATAATCTTAGCTTTCCCTCATTGATGCCAGGATTTAAGACAGGTAACGATGTGAAGATCCCGAGTGCAGTGCCTCCTCACAATCTTTCATCGTACTCATCTCCATTGGACAGCCTTTGTAATCTTGAAAGGCCCATGAAGATGCTGAGGTCGAATGCTTGGGAAGGAAATATTTCTCAGCAAGGCCAAAGGAGCTCCACTGTACCGATTTACTCTGGAAAACCTCAGCACCGCATGGTGCAATTTTTGCAGCCCGAGAAGATTGGGAACCATCGTACTGAAGGGTTTACTTCTTTGTCGAAAATACCTGATGAAACACTGGAGTCTGTTGCTTCAACAACAACCTCTATTCCATGTCGTAACGGATTAAGAATCCAGGAAAATTGCAACGATGTACACTCCTCGATAGAAACAGAGAGTAACAGTTGTGGAAGAGAGAGTCCAAATTCTCTTGGAGAATCAATGCCAGGGAAGAGAAAACCAGATATGGATTACGTGGATGTGAAGCCGGATAGAGTCAATGCTGTCCAAGCACCATTCACCACTGTGAAAGGTTCTGGTCACACACAAGACCACATTATGGCCGAGAGGAAACGTCGGGAGAAGTTGAGCCAACGTTTTATTGCACTGTCTGCCATTGTACCAGGACTTAAAAAGATGGACAAGGCTTCCGTCCTTGGTGATGCAATCAAATATGTCAAGCAGCTACAAGACCGGGTTAAAACCTTAGAAGAAAGCACTCCAAAGAAGGGCCTGCGGACAGTTTACACTGTGAAGAAACAGTCTAGAAACGCCAGCGATGAGGAGGATACGAGCGAGAACACCACTGTCACAACGGTTGAAGATGAAGAACAGGCTGCAGAGATTGAAGCTCGTATGATTGAGAAAAATGTTCTCATTAAACTGCACTGTGAGAAGAAGAAAGGTGTGCTAGTAAAATCTTTGGCGGAATTGGAGAAGCTGCGTCTGGTCGTTGTCAGTGCGAACATTCTTTCCTTTTCAGCAACCGCTCTTGACCTGACCTTCAATGCGAAGGTCGAAGAAGGTTCCGAGCTGACTGCCGATGACATAGTTAATGCATTGCAGAAGCTTTTTAAAACTTTCACTTGAACCTGGCTGCAAAAGTCGAAGCTTGTGTCAAAAACTAACATAACGTAAACACAACGGTTACCAATTTGTGGGGAAGGGAGCTCAAGTCTTTGAGAAGTTCAAAGACTCTTGGAGATTTGAGCTTCATACTCTAAGAAACTTGTACAGGACACAGAGCAAACTATTTCAGGATAGTAGAGCGTATGACTTTCAGAGAATTTCCATTTTCTTCGTTTTTCATGCTTTTTCCCCCCGTGCATTTGAACCTACTCCCGATGGGGTTCAGTGTACAATCGGGGGTGTGGATTTTCACACATTTTCATCTGCCAGTCTGGGCTGTTACGACAAATTCCAGACCTGCCAAATTTTGTGCGAGAACTTTCTTGCTGTAACCTTCTGAAGCCCCTTAACTTACTCTCCCTCCACCTTCACTCAAGCTTTTTTCTTTTTTTAAGAGGATGCTTTGCTATCCCTTTTCCTAGAAGGTGGATGACAATAGTGGTAGTTTTTCAATCCAATGAGGGCCTGGCTCCCTTTTTGACTGCTGGTGGTCTATTGGTGATCTTCAGAATTTTTTTGCAGGGTCCATACCCTGTTCTCCATTTCTCAGACCACCTAAAGCCCACCAGTTCAGTTTTGGTCTCCAGGTATCAGGCTTAGCATTGAGCATGCTAAAAGTCAACTCATTATGGGTTGGGGTAGGGTTTCACGTAAGATATGATCTTGTGCTCGATCTGATTTGGTGTTCTTAGTGCTTTAACTAGTACCAACACATGTGTTGCTATGGAAAAAATGTACAAATACAAAAGTTTCATTGAGGATGATGCGTCCGTTGAGCATCCTTCTCATGACACATAAATAAAGTATGGAAGGTAGCCTTCAGGGCTTATAAGTC

CDS

>Mapoly0034s0053.1
ATGGAGTTTGCACCTTCATCTACTAGTGCGATGCAGTGGTTGTCAGAGATGGGACTGGAGGATCCTTCTCTTGTGAGGCACTTAGATAGTCTCTTTCCCCCTACATCAGAATCGCTTGTGAATGTCGTCGGACACCAAAATGGCCATAATCTTAGCTTTCCCTCATTGATGCCAGGATTTAAGACAGGTAACGATGTGAAGATCCCGAGTGCAGTGCCTCCTCACAATCTTTCATCGTACTCATCTCCATTGGACAGCCTTTGTAATCTTGAAAGGCCCATGAAGATGCTGAGGTCGAATGCTTGGGAAGGAAATATTTCTCAGCAAGGCCAAAGGAGCTCCACTGTACCGATTTACTCTGGAAAACCTCAGCACCGCATGGTGCAATTTTTGCAGCCCGAGAAGATTGGGAACCATCGTACTGAAGGGTTTACTTCTTTGTCGAAAATACCTGATGAAACACTGGAGTCTGTTGCTTCAACAACAACCTCTATTCCATGTCGTAACGGATTAAGAATCCAGGAAAATTGCAACGATGTACACTCCTCGATAGAAACAGAGAGTAACAGTTGTGGAAGAGAGAGTCCAAATTCTCTTGGAGAATCAATGCCAGGGAAGAGAAAACCAGATATGGATTACGTGGATGTGAAGCCGGATAGAGTCAATGCTGTCCAAGCACCATTCACCACTGTGAAAGGTTCTGGTCACACACAAGACCACATTATGGCCGAGAGGAAACGTCGGGAGAAGTTGAGCCAACGTTTTATTGCACTGTCTGCCATTGTACCAGGACTTAAAAAGATGGACAAGGCTTCCGTCCTTGGTGATGCAATCAAATATGTCAAGCAGCTACAAGACCGGGTTAAAACCTTAGAAGAAAGCACTCCAAAGAAGGGCCTGCGGACAGTTTACACTGTGAAGAAACAGTCTAGAAACGCCAGCGATGAGGAGGATACGAGCGAGAACACCACTGTCACAACGGTTGAAGATGAAGAACAGGCTGCAGAGATTGAAGCTCGTATGATTGAGAAAAATGTTCTCATTAAACTGCACTGTGAGAAGAAGAAAGGTGTGCTAGTAAAATCTTTGGCGGAATTGGAGAAGCTGCGTCTGGTCGTTGTCAGTGCGAACATTCTTTCCTTTTCAGCAACCGCTCTTGACCTGACCTTCAATGCGAAGGTCGAAGAAGGTTCCGAGCTGACTGCCGATGACATAGTTAATGCATTGCAGAAGCTTTTTAAAACTTTCACTTGA

Protein

>Mapoly0034s0053.1
MEFAPSSTSAMQWLSEMGLEDPSLVRHLDSLFPPTSESLVNVVGHQNGHNLSFPSLMPGFKTGNDVKIPSAVPPHNLSSYSSPLDSLCNLERPMKMLRSNAWEGNISQQGQRSSTVPIYSGKPQHRMVQFLQPEKIGNHRTEGFTSLSKIPDETLESVASTTTSIPCRNGLRIQENCNDVHSSIETESNSCGRESPNSLGESMPGKRKPDMDYVDVKPDRVNAVQAPFTTVKGSGHTQDHIMAERKRREKLSQRFIALSAIVPGLKKMDKASVLGDAIKYVKQLQDRVKTLEESTPKKGLRTVYTVKKQSRNASDEEDTSENTTVTTVEDEEQAAEIEARMIEKNVLIKLHCEKKKGVLVKSLAELEKLRLVVVSANILSFSATALDLTFNAKVEEGSELTADDIVNALQKLFKTFT

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>