Mapoly0034s0060



Description

1-aminocyclopropane-1-carboxylate synthase.

Reference DB

Database ID Description
EC 4.4.1.14 1-aminocyclopropane-1-carboxylate synthase.
GO GO:0009058 Biosynthetic process
GO GO:0030170 Pyridoxal phosphate binding
KEGGORTH K01762
KOG KOG0256 1-aminocyclopropane-1-carboxylate synthase, and related proteins
OrthoMCL OG5_128619
PFAM PF00155 Aminotransferase class I and II
PANTHER PTHR11751 SUBGROUP I AMINOTRANSFERASE RELATED
PANTHER PTHR11751:SF340

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpACS Potential acetyl-coA synthetase, possible ortholog to AtACS Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0034s0060.1 scaffold_34:793182..796361  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0034s0060.1  

Gene structure:

mRNA scaffold_34:793182..796361  ( + strand )
five_prime_UTR scaffold_34:793182..793661  ( + strand )
CDS scaffold_34:793662..793841  ( + strand )
CDS scaffold_34:794444..794578  ( + strand )
CDS scaffold_34:794766..794926  ( + strand )
CDS scaffold_34:795191..796034  ( + strand )
three_prime_UTR scaffold_34:796035..796361  ( + strand )

Sequences:

Gene

>Mapoly0034s0060.1
ACAAATGGTTCCGGAACCATTTGTAGCCTATTCTCATCCATAATCACACTTGCCCACCCATGAACAATAATGTAGAACCCATATACACCCAATTCAACTCTGTTGCCCATTCGAATTGACAGTTGTGCAAATTTCAGCCCTGCGGAAGCTTGTGTCCTTTTCCGGAACTCCCTACTGCCTCGCAGCCGTGAATTCTGAGATTCTGGTCAAGTTATGCTTCCAAGAGGGCTGCACGGAGCGATTTTCCAAAGCGTGAGTGAAAAGAATGCAGTCAGCTGAGGTCACACTTCCAGATTCCGAGAGGGCTTTCAGGATGCGAGTGAGAGTGTGTGAAGGTCTTGCTCGAGTAAAACATATTTTTCTATGCGATCCAGCTTTTATGTCGATTTCTGACCCATGGATTTATAAATCACGGGATCGCTGAGACTGAGCATACGTGCGAGAATTGAGAACCCGAGCAGCAGGGGTGGTGCAGAGATTATGCATACGCAAGACGAGGACGTTGCCACTGCACATGTTGCCAAACGAGCTCTCGCCGTCGTTAATGACGACAAACACGTTGAGGCTTACTACATGGGATGGCATGAAGCGCAATCGAATCCCTACGATGCAGTGCAAAATCCTGGAGGATGCATCCAACTCGGCTTGTCAGAGAACACGGTAATTGTCGTGCCTTCGACAATAGCAGAACTTACTCGATCTCTTTCATTTCTGAGTATCAATCAACATCTGAAGTTGTGCGAGGCCTTTATCAAGATCCGGGAGCAGTAAGCAACTGAATGTGTTAATATGAATTGGAGCAGCATATTGACGCTTACCACAATCGTAGAAGATGTTCGCCTGCGAGTGCCTGTGAAGCACTCAACTCATAGTCCACTTGATATCACAATTGACTGTGTTGTCCATGGATCTCTAATCTCAAAGCTGTTAGTACTTTGAGTCGTCTCAGAAGGATGTCCATCCTTTACTTGCTAGAAAAAAGCTCGCTTCCTCGCGTTATGTAATGTGATAATTAACTGGCTTTCAAGATGAGTTCATTTTGAAGCAGCAACAGAGGAGTTTCTCTTCTCTTTGTTTCTGTTCACAAGTTATTTGGCATGTTGTTTATAACAAGTTTTGTCATTCGATTGAGTATGTGTCGTTTTTCTAGTGTGTGGAGATCATATCCTTATATCTGGTGTGAGAACAGCCTTATTTTACCGAGCATACAAGATTGAGGCGAAACCTTCAGCTATACTTGTTTCATATTGGTGTTGTTTCAGTTGTCTCTTGATCTGCTCGACGATTGGTTTTCCACTCACAGTACGGCTCCAGCTCTGGAGCTAGAAAACGTCCTCAACTTCAAGGCTATTGCGGGCTACCCGGATGTTTACCATGGTCTGCTTATTTTTCGAAATGTAAGTTAAACCATTTATTTGAGAGGTATTCAAAATGTCGAGGCTGCACCTTGATTGACCTTCGATACATTTTGTGGTTAGTTGGAACTATTCCTGAGCTTCAGGGCAACTGGGACATATATTCTTCTAACTCAGACATCAAAGTTCTGGTGGTCAGAGATGACATCTATTTCTGTCCTGGTAGCAGCTAATGGCAAACTTCATGAATGAGCTCTATGGTGGAGCAGTATCTTTTGATCCCGAAAAAATGGTCATAACTACGGGTGCAACTTCAGCTATTGAGATCCTGGCGTTCTGCCTGGCTGACCCCGGCGATGTCTTTCTAGTTCCAGCACCTTACTATCCAGGGTATGTTAGCGTCTTCATCATTCGAAAATCAGATTGTCCTCGTCTATCAATTCCAAGTCGGTGTGATGTGATTTGGTGTTTCGCTTTTGTGAGTCCTGCAGAGATTGGTTTGGTCCTCAGCTCATTCACATTATTTAGATGTCCAGAAGGGATCATGGGAGTCCAGACGGATGTCTAAGCTGCATATATTGAGGACCAAGAGGTCAAGGTCTAGCATGTCTTGAGGTTTGCCTCAGAAGTCTGAACCATATGCTGTTGTCGCAGATTCGAAAGGGATATCAGGTTTCGCAGCCAGGTGGACCTTGTGCCTGTTCCAAGCTTCAGTTCAGACGGGTTTGCCGTGACAAGGGCAGCTCTAGAGCAGGCATTCGAGGATGCTGTCAGCCGTGGACGCAAGGTGAAGGCTGTTCTGATGACGTCACCGTCAAATCCCCTCGGTATGACATACAGTCGAGACCAGCTATCTGTGATTCTCGACTTCATCGGCCAGAAAGACATGCATCTCATTTGCGATGAGATATACGCAGGTTCAGTTTTCGGCACCACTGAGTTTATCAGCATTGCTGAGCTTGTAATGCCACCTCGTGTCGACCCTAACCGGGTTCACATCATATACGGCCTGTCAAAAGTTCTAGGCATCCCTGGATTTCGTGTTGGACTCCTGTATTCCTGGAACAGTCTTGTCCTGGATGCAGCAAAGAAGCTCACTCGCTTCAGCTCTGTGCCAACCCTCACTCAGCAGATTCTAATTTCTCTCTTGTCCGATACACACTTTCTTCGACTGTTTCTATCTGAGAATCTCAAAAGACTACAACAGAGATGGAGACTCGTAAGCCATGGATTGCAAGAAGCCGGGTTAGAGTTTGTGAATTGCACGGCTGGGTTCTTTTGCTGGGTCAACATCGGCAAGGTTGCATCCGTGCAGACCAAAGAGCAAGAACTAGAACTGTGGAGTAAGTTGCTTCACGTGGAAGGTTTAAACGTCACTCCTGGATCAGCCTGTCAGTGCTCAGAGCCTGGTTGGTTCAGGCTCTGCTTTGCTTACGTTGACGATCAAACTATGAGTGTTGCACTCGATCGTATCAAGAGATTCACAGCTTCTCTCTAGCAAAATACTCTGGATCATGGTATTGATGAATGTAGTCTCAAGACGGAGTACCTTTTCAGCACTGCCAAGATCTAGGACACTCGTCAAGTCAATCAGTCGCGATTATGTGGACGAGATGCGAGAGAATGAGATATGCTTTCGGAAGCCGGAGTAACAGCTTGGGCTTTGAATTTGAGTCCTGAGGTATCACTAGACACGAAGGGTTGAGTGTCTCACTCGATCGCCCTCGGATGTAGGCTTGTTTACATGCGATGTGGAGTTTCTCAGTGCCACCGTGAATGGTCGGACTTATGGATTACCCAGAACAGTTTAATTTTATCCCTGTCC

mRNA

>Mapoly0034s0060.1
ACAAATGGTTCCGGAACCATTTGTAGCCTATTCTCATCCATAATCACACTTGCCCACCCATGAACAATAATGTAGAACCCATATACACCCAATTCAACTCTGTTGCCCATTCGAATTGACAGTTGTGCAAATTTCAGCCCTGCGGAAGCTTGTGTCCTTTTCCGGAACTCCCTACTGCCTCGCAGCCGTGAATTCTGAGATTCTGGTCAAGTTATGCTTCCAAGAGGGCTGCACGGAGCGATTTTCCAAAGCGTGAGTGAAAAGAATGCAGTCAGCTGAGGTCACACTTCCAGATTCCGAGAGGGCTTTCAGGATGCGAGTGAGAGTGTGTGAAGGTCTTGCTCGAGTAAAACATATTTTTCTATGCGATCCAGCTTTTATGTCGATTTCTGACCCATGGATTTATAAATCACGGGATCGCTGAGACTGAGCATACGTGCGAGAATTGAGAACCCGAGCAGCAGGGGTGGTGCAGAGATTATGCATACGCAAGACGAGGACGTTGCCACTGCACATGTTGCCAAACGAGCTCTCGCCGTCGTTAATGACGACAAACACGTTGAGGCTTACTACATGGGATGGCATGAAGCGCAATCGAATCCCTACGATGCAGTGCAAAATCCTGGAGGATGCATCCAACTCGGCTTGTCAGAGAACACGTTGTCTCTTGATCTGCTCGACGATTGGTTTTCCACTCACAGTACGGCTCCAGCTCTGGAGCTAGAAAACGTCCTCAACTTCAAGGCTATTGCGGGCTACCCGGATGTTTACCATGGTCTGCTTATTTTTCGAAATCTAATGGCAAACTTCATGAATGAGCTCTATGGTGGAGCAGTATCTTTTGATCCCGAAAAAATGGTCATAACTACGGGTGCAACTTCAGCTATTGAGATCCTGGCGTTCTGCCTGGCTGACCCCGGCGATGTCTTTCTAGTTCCAGCACCTTACTATCCAGGATTCGAAAGGGATATCAGGTTTCGCAGCCAGGTGGACCTTGTGCCTGTTCCAAGCTTCAGTTCAGACGGGTTTGCCGTGACAAGGGCAGCTCTAGAGCAGGCATTCGAGGATGCTGTCAGCCGTGGACGCAAGGTGAAGGCTGTTCTGATGACGTCACCGTCAAATCCCCTCGGTATGACATACAGTCGAGACCAGCTATCTGTGATTCTCGACTTCATCGGCCAGAAAGACATGCATCTCATTTGCGATGAGATATACGCAGGTTCAGTTTTCGGCACCACTGAGTTTATCAGCATTGCTGAGCTTGTAATGCCACCTCGTGTCGACCCTAACCGGGTTCACATCATATACGGCCTGTCAAAAGTTCTAGGCATCCCTGGATTTCGTGTTGGACTCCTGTATTCCTGGAACAGTCTTGTCCTGGATGCAGCAAAGAAGCTCACTCGCTTCAGCTCTGTGCCAACCCTCACTCAGCAGATTCTAATTTCTCTCTTGTCCGATACACACTTTCTTCGACTGTTTCTATCTGAGAATCTCAAAAGACTACAACAGAGATGGAGACTCGTAAGCCATGGATTGCAAGAAGCCGGGTTAGAGTTTGTGAATTGCACGGCTGGGTTCTTTTGCTGGGTCAACATCGGCAAGGTTGCATCCGTGCAGACCAAAGAGCAAGAACTAGAACTGTGGAGTAAGTTGCTTCACGTGGAAGGTTTAAACGTCACTCCTGGATCAGCCTGTCAGTGCTCAGAGCCTGGTTGGTTCAGGCTCTGCTTTGCTTACGTTGACGATCAAACTATGAGTGTTGCACTCGATCGTATCAAGAGATTCACAGCTTCTCTCTAGCAAAATACTCTGGATCATGGTATTGATGAATGTAGTCTCAAGACGGAGTACCTTTTCAGCACTGCCAAGATCTAGGACACTCGTCAAGTCAATCAGTCGCGATTATGTGGACGAGATGCGAGAGAATGAGATATGCTTTCGGAAGCCGGAGTAACAGCTTGGGCTTTGAATTTGAGTCCTGAGGTATCACTAGACACGAAGGGTTGAGTGTCTCACTCGATCGCCCTCGGATGTAGGCTTGTTTACATGCGATGTGGAGTTTCTCAGTGCCACCGTGAATGGTCGGACTTATGGATTACCCAGAACAGTTTAATTTTATCCCTGTCC

CDS

>Mapoly0034s0060.1
ATGCATACGCAAGACGAGGACGTTGCCACTGCACATGTTGCCAAACGAGCTCTCGCCGTCGTTAATGACGACAAACACGTTGAGGCTTACTACATGGGATGGCATGAAGCGCAATCGAATCCCTACGATGCAGTGCAAAATCCTGGAGGATGCATCCAACTCGGCTTGTCAGAGAACACGTTGTCTCTTGATCTGCTCGACGATTGGTTTTCCACTCACAGTACGGCTCCAGCTCTGGAGCTAGAAAACGTCCTCAACTTCAAGGCTATTGCGGGCTACCCGGATGTTTACCATGGTCTGCTTATTTTTCGAAATCTAATGGCAAACTTCATGAATGAGCTCTATGGTGGAGCAGTATCTTTTGATCCCGAAAAAATGGTCATAACTACGGGTGCAACTTCAGCTATTGAGATCCTGGCGTTCTGCCTGGCTGACCCCGGCGATGTCTTTCTAGTTCCAGCACCTTACTATCCAGGATTCGAAAGGGATATCAGGTTTCGCAGCCAGGTGGACCTTGTGCCTGTTCCAAGCTTCAGTTCAGACGGGTTTGCCGTGACAAGGGCAGCTCTAGAGCAGGCATTCGAGGATGCTGTCAGCCGTGGACGCAAGGTGAAGGCTGTTCTGATGACGTCACCGTCAAATCCCCTCGGTATGACATACAGTCGAGACCAGCTATCTGTGATTCTCGACTTCATCGGCCAGAAAGACATGCATCTCATTTGCGATGAGATATACGCAGGTTCAGTTTTCGGCACCACTGAGTTTATCAGCATTGCTGAGCTTGTAATGCCACCTCGTGTCGACCCTAACCGGGTTCACATCATATACGGCCTGTCAAAAGTTCTAGGCATCCCTGGATTTCGTGTTGGACTCCTGTATTCCTGGAACAGTCTTGTCCTGGATGCAGCAAAGAAGCTCACTCGCTTCAGCTCTGTGCCAACCCTCACTCAGCAGATTCTAATTTCTCTCTTGTCCGATACACACTTTCTTCGACTGTTTCTATCTGAGAATCTCAAAAGACTACAACAGAGATGGAGACTCGTAAGCCATGGATTGCAAGAAGCCGGGTTAGAGTTTGTGAATTGCACGGCTGGGTTCTTTTGCTGGGTCAACATCGGCAAGGTTGCATCCGTGCAGACCAAAGAGCAAGAACTAGAACTGTGGAGTAAGTTGCTTCACGTGGAAGGTTTAAACGTCACTCCTGGATCAGCCTGTCAGTGCTCAGAGCCTGGTTGGTTCAGGCTCTGCTTTGCTTACGTTGACGATCAAACTATGAGTGTTGCACTCGATCGTATCAAGAGATTCACAGCTTCTCTCTAG

Protein

>Mapoly0034s0060.1
MHTQDEDVATAHVAKRALAVVNDDKHVEAYYMGWHEAQSNPYDAVQNPGGCIQLGLSENTLSLDLLDDWFSTHSTAPALELENVLNFKAIAGYPDVYHGLLIFRNLMANFMNELYGGAVSFDPEKMVITTGATSAIEILAFCLADPGDVFLVPAPYYPGFERDIRFRSQVDLVPVPSFSSDGFAVTRAALEQAFEDAVSRGRKVKAVLMTSPSNPLGMTYSRDQLSVILDFIGQKDMHLICDEIYAGSVFGTTEFISIAELVMPPRVDPNRVHIIYGLSKVLGIPGFRVGLLYSWNSLVLDAAKKLTRFSSVPTLTQQILISLLSDTHFLRLFLSENLKRLQQRWRLVSHGLQEAGLEFVNCTAGFFCWVNIGKVASVQTKEQELELWSKLLHVEGLNVTPGSACQCSEPGWFRLCFAYVDDQTMSVALDRIKRFTASL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>