Mapoly0034s0126



Description

CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
OrthoMCL OG5_155941
PFAM PF00170 BZIP transcription factor
PANTHER PTHR22952 CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED
PANTHER PTHR22952:SF110

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBZIP9 transcription factor, bZIP Mapoly0034s0126.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0034s0126.1 scaffold_34:1530264..1532891  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0034s0126.1  

Gene structure:

mRNA scaffold_34:1530264..1532891  ( + strand )
five_prime_UTR scaffold_34:1530264..1530768  ( + strand )
CDS scaffold_34:1530769..1531234  ( + strand )
CDS scaffold_34:1531503..1532182  ( + strand )
three_prime_UTR scaffold_34:1532183..1532891  ( + strand )

Sequences:

Gene

>Mapoly0034s0126.1
CGTCCTCAAGTACTCTCGCGTCCCTCGCAATTTCTTTCACTTCTCCGTCGCGTTTTTGCAGCGCTCCCGCACCCAAGCAAAGAAAGCATCTCGCCTTCCGAGATCGTCGACGACCCAATTGCTCTCGATTTCTCTCCCTCTCTCTCTCTTCTTTCTCTCGTCGTCGTCTGTGATTCCGACTGCCTGCTGCGCCGAGTCTGCTAGCGTTTCTCTCGATAGATGAGAGAGGGCCACACGAAGTCCGCTCTTGTCGATTGCCTGATTTCGAGATAGTCCTCGAGGTGAGGGAGGTGGTGGAAGAAATTTGACCACGTCGGGGTGAAGTGGAGCGGTAGACAGTGGAGTTCGTGAGATCTTGAGAAGACTCGGTGTATAGTGTGCGTTTGTCGAAGCGGTGAACACGAGAGAATGATGTGATGTTGGAAGTCTGAAGTTAGAAGCTTTGTACATATTGTGAAGAGGAGTGAGTCGTCGCAGTGAGTGTCAGGAGGTCTCAGTTTCTCGCATGGTGGAGAGTTTAGGTACGCGGAGGGAGGCAGAGAAGCTCAAGATCGAGAAAGCAGGCAGGATGGGTGCCATGGAGCAAGTGAGCGGAGAAGGAGATGAGACGGACGGGGTCAATAGTAACAACAAGAAAGGGGAAGCTATGATGTCCAATACCATGCGGCGCGCCACGTCCGTGGACGACCTCTTCGCACCTTTGTGGCAACTAAATGTTCAGTCGTCCTGTACTCCTCGGTCTAATGACCCTCCAGCACCATATCCGAGTGCGTCTTCAGCTGCTGCTTCATCTTCTGCCAAGGCTCCAGCTCCTCAGGCCCCCGTTCCTCACGCTTCGAGAATTGCTGAAGGCGGGGCATCTTCGTCTGTTTCTTCTGTTGCAGTCAACGCAGAGTGTAAGGAAAGAAGTACGAATGGAACTTCGTCTCCTCCACCTCTTAGCCATTCGTCGGCTGGCAGTATTGCGAATGGTATGTGGTTCTTCTCTGTTTCCATATTAGACTCTGGCTGTTAGAACTTCTTTCCACTCGCCAGATGAAAATGCTCAAGAGCCGGTATGATTTTATTCGTTACTGGCTTTAATTCCTTCCATGGGATTTGTCTTCCGCACGCTAAATTGGACAGATTGCCTTCTTGGAGGTCGTAGCCACCTGTCTTTGGTAGGCTGCGAGCTATCTCGTACAGGGTTGGGGTTTGATTCGCACTTACCACGTGCCCTCGGAAATTATTCTCTTGCAGACAGGGACTCGCAAAGAGTGGTGGCAGAGTCCAGAGTACAGCAGTCCGGCAAGAACCAACCGGATGGAGTAAAGCGGACTGGAAGAGACAGACAGTTGGAAGGAAGTTCGTCGTCTTACTCTTCGGAACCAGACGCCGGGGATGTCAAACCCTCTATTATTGCTCCCGAAGCTGATCATTATCCTTTTGGGGCCAAGAGGGAATCAAAAGGCACGACGGGGAAGGCGAGCTCGGGAGACGCTCCCGATCCTCTGCCACCGTCAAATTCCACCTCCGACGACGATCAGCACGCAGGCGGAGTCGACGAACGGAAGCAAAAGCGCATGCTGTCGAATAGGGAGTCTGCACGGAGATCACGCCTGAGGAAGCAGCAGCATCTCGATGAGTTGCGAGCCCAGGTTGCGCACCTGAGGGCCGAGAACAATCACATGATGACCAAGTATTCTATTGCTTCTCAACGTTACGTAACTCTCACAGATGAGAACCAAAGGCTCAGGTCGCATGCGATGGATCTGTCCAGACAGTTGCAGCGACTGCACCACACTGCATCCCAACATCCTGGAGGATTGCGCGCTCTTGGTCTTCAAACTGGCCATTTGGATCCTGTCCCTTTCGGAAGCATGTCATCTGGTCATCACTCTCCCTATTCCCAGCCAATGGTTCCTGATATGCTACATTAATTAGCCTGTTCCGCAGCGCAGCAATTCGTCTCTACTGGAAGTCGTGCCTGACATTTTGCTGTGCTTACCCTCGATCTAGCTTCTATATGTGTCCGACGAAAGCACCCACGAGAAGGCTTGCTATTTAGGCGTTTGCCTCTCAAAAGTCATTCAACGTCGGATACTCCAGCATGAACAATTAAGTGATCCGCCGCGTGCGCCAGTCAGTTCTGCCGGAAGGAAGAAAGGGCAGTCGAGCAGATTAGCCTTTCCCGCAGCGGAGGGGCCTTCTCAAGACTGTCCTCTGGAGCTGAATCCCAGTACAGAATGATCAATTGCAAATTTTTGATGATTTACACTACTTGGAGACGATTCAAGGCTCTGGGTGAAATGGTGTTCACTTTCACGAACAAAGCCGCAACAGCCCACAAGAATATTCCCATCCTGGATATTCTCATTCTTTTCATGTCTATAATCAATTGATCTGAAGTCGCGGTAGAGCTTATTGTTGCTTGGGTGGAAGTCCGCTCAGTATAGATGTAATCACGCTAGAAGCTGAGCTGCCTAGCCCAAGCGGAGGTGCAAGTCACCTGGGGGACTGACATTGCTCCCGTTTGTTTAGAAAAGTCCTCATTTGAGCAAGATTCACTTGTCTCAGGGGATGTGAACATTCCTGTAAAGTGTAATGAATGATTTTATGCAAGCCCTTTATGTGCAGTTAAATGATCGA

mRNA

>Mapoly0034s0126.1
CGTCCTCAAGTACTCTCGCGTCCCTCGCAATTTCTTTCACTTCTCCGTCGCGTTTTTGCAGCGCTCCCGCACCCAAGCAAAGAAAGCATCTCGCCTTCCGAGATCGTCGACGACCCAATTGCTCTCGATTTCTCTCCCTCTCTCTCTCTTCTTTCTCTCGTCGTCGTCTGTGATTCCGACTGCCTGCTGCGCCGAGTCTGCTAGCGTTTCTCTCGATAGATGAGAGAGGGCCACACGAAGTCCGCTCTTGTCGATTGCCTGATTTCGAGATAGTCCTCGAGGTGAGGGAGGTGGTGGAAGAAATTTGACCACGTCGGGGTGAAGTGGAGCGGTAGACAGTGGAGTTCGTGAGATCTTGAGAAGACTCGGTGTATAGTGTGCGTTTGTCGAAGCGGTGAACACGAGAGAATGATGTGATGTTGGAAGTCTGAAGTTAGAAGCTTTGTACATATTGTGAAGAGGAGTGAGTCGTCGCAGTGAGTGTCAGGAGGTCTCAGTTTCTCGCATGGTGGAGAGTTTAGGTACGCGGAGGGAGGCAGAGAAGCTCAAGATCGAGAAAGCAGGCAGGATGGGTGCCATGGAGCAAGTGAGCGGAGAAGGAGATGAGACGGACGGGGTCAATAGTAACAACAAGAAAGGGGAAGCTATGATGTCCAATACCATGCGGCGCGCCACGTCCGTGGACGACCTCTTCGCACCTTTGTGGCAACTAAATGTTCAGTCGTCCTGTACTCCTCGGTCTAATGACCCTCCAGCACCATATCCGAGTGCGTCTTCAGCTGCTGCTTCATCTTCTGCCAAGGCTCCAGCTCCTCAGGCCCCCGTTCCTCACGCTTCGAGAATTGCTGAAGGCGGGGCATCTTCGTCTGTTTCTTCTGTTGCAGTCAACGCAGAGTGTAAGGAAAGAAGTACGAATGGAACTTCGTCTCCTCCACCTCTTAGCCATTCGTCGGCTGGCAGTATTGCGAATGACAGGGACTCGCAAAGAGTGGTGGCAGAGTCCAGAGTACAGCAGTCCGGCAAGAACCAACCGGATGGAGTAAAGCGGACTGGAAGAGACAGACAGTTGGAAGGAAGTTCGTCGTCTTACTCTTCGGAACCAGACGCCGGGGATGTCAAACCCTCTATTATTGCTCCCGAAGCTGATCATTATCCTTTTGGGGCCAAGAGGGAATCAAAAGGCACGACGGGGAAGGCGAGCTCGGGAGACGCTCCCGATCCTCTGCCACCGTCAAATTCCACCTCCGACGACGATCAGCACGCAGGCGGAGTCGACGAACGGAAGCAAAAGCGCATGCTGTCGAATAGGGAGTCTGCACGGAGATCACGCCTGAGGAAGCAGCAGCATCTCGATGAGTTGCGAGCCCAGGTTGCGCACCTGAGGGCCGAGAACAATCACATGATGACCAAGTATTCTATTGCTTCTCAACGTTACGTAACTCTCACAGATGAGAACCAAAGGCTCAGGTCGCATGCGATGGATCTGTCCAGACAGTTGCAGCGACTGCACCACACTGCATCCCAACATCCTGGAGGATTGCGCGCTCTTGGTCTTCAAACTGGCCATTTGGATCCTGTCCCTTTCGGAAGCATGTCATCTGGTCATCACTCTCCCTATTCCCAGCCAATGGTTCCTGATATGCTACATTAATTAGCCTGTTCCGCAGCGCAGCAATTCGTCTCTACTGGAAGTCGTGCCTGACATTTTGCTGTGCTTACCCTCGATCTAGCTTCTATATGTGTCCGACGAAAGCACCCACGAGAAGGCTTGCTATTTAGGCGTTTGCCTCTCAAAAGTCATTCAACGTCGGATACTCCAGCATGAACAATTAAGTGATCCGCCGCGTGCGCCAGTCAGTTCTGCCGGAAGGAAGAAAGGGCAGTCGAGCAGATTAGCCTTTCCCGCAGCGGAGGGGCCTTCTCAAGACTGTCCTCTGGAGCTGAATCCCAGTACAGAATGATCAATTGCAAATTTTTGATGATTTACACTACTTGGAGACGATTCAAGGCTCTGGGTGAAATGGTGTTCACTTTCACGAACAAAGCCGCAACAGCCCACAAGAATATTCCCATCCTGGATATTCTCATTCTTTTCATGTCTATAATCAATTGATCTGAAGTCGCGGTAGAGCTTATTGTTGCTTGGGTGGAAGTCCGCTCAGTATAGATGTAATCACGCTAGAAGCTGAGCTGCCTAGCCCAAGCGGAGGTGCAAGTCACCTGGGGGACTGACATTGCTCCCGTTTGTTTAGAAAAGTCCTCATTTGAGCAAGATTCACTTGTCTCAGGGGATGTGAACATTCCTGTAAAGTGTAATGAATGATTTTATGCAAGCCCTTTATGTGCAGTTAAATGATCGA

CDS

>Mapoly0034s0126.1
ATGGTGGAGAGTTTAGGTACGCGGAGGGAGGCAGAGAAGCTCAAGATCGAGAAAGCAGGCAGGATGGGTGCCATGGAGCAAGTGAGCGGAGAAGGAGATGAGACGGACGGGGTCAATAGTAACAACAAGAAAGGGGAAGCTATGATGTCCAATACCATGCGGCGCGCCACGTCCGTGGACGACCTCTTCGCACCTTTGTGGCAACTAAATGTTCAGTCGTCCTGTACTCCTCGGTCTAATGACCCTCCAGCACCATATCCGAGTGCGTCTTCAGCTGCTGCTTCATCTTCTGCCAAGGCTCCAGCTCCTCAGGCCCCCGTTCCTCACGCTTCGAGAATTGCTGAAGGCGGGGCATCTTCGTCTGTTTCTTCTGTTGCAGTCAACGCAGAGTGTAAGGAAAGAAGTACGAATGGAACTTCGTCTCCTCCACCTCTTAGCCATTCGTCGGCTGGCAGTATTGCGAATGACAGGGACTCGCAAAGAGTGGTGGCAGAGTCCAGAGTACAGCAGTCCGGCAAGAACCAACCGGATGGAGTAAAGCGGACTGGAAGAGACAGACAGTTGGAAGGAAGTTCGTCGTCTTACTCTTCGGAACCAGACGCCGGGGATGTCAAACCCTCTATTATTGCTCCCGAAGCTGATCATTATCCTTTTGGGGCCAAGAGGGAATCAAAAGGCACGACGGGGAAGGCGAGCTCGGGAGACGCTCCCGATCCTCTGCCACCGTCAAATTCCACCTCCGACGACGATCAGCACGCAGGCGGAGTCGACGAACGGAAGCAAAAGCGCATGCTGTCGAATAGGGAGTCTGCACGGAGATCACGCCTGAGGAAGCAGCAGCATCTCGATGAGTTGCGAGCCCAGGTTGCGCACCTGAGGGCCGAGAACAATCACATGATGACCAAGTATTCTATTGCTTCTCAACGTTACGTAACTCTCACAGATGAGAACCAAAGGCTCAGGTCGCATGCGATGGATCTGTCCAGACAGTTGCAGCGACTGCACCACACTGCATCCCAACATCCTGGAGGATTGCGCGCTCTTGGTCTTCAAACTGGCCATTTGGATCCTGTCCCTTTCGGAAGCATGTCATCTGGTCATCACTCTCCCTATTCCCAGCCAATGGTTCCTGATATGCTACATTAA

Protein

>Mapoly0034s0126.1
MVESLGTRREAEKLKIEKAGRMGAMEQVSGEGDETDGVNSNNKKGEAMMSNTMRRATSVDDLFAPLWQLNVQSSCTPRSNDPPAPYPSASSAAASSSAKAPAPQAPVPHASRIAEGGASSSVSSVAVNAECKERSTNGTSSPPPLSHSSAGSIANDRDSQRVVAESRVQQSGKNQPDGVKRTGRDRQLEGSSSSYSSEPDAGDVKPSIIAPEADHYPFGAKRESKGTTGKASSGDAPDPLPPSNSTSDDDQHAGGVDERKQKRMLSNRESARRSRLRKQQHLDELRAQVAHLRAENNHMMTKYSIASQRYVTLTDENQRLRSHAMDLSRQLQRLHHTASQHPGGLRALGLQTGHLDPVPFGSMSSGHHSPYSQPMVPDMLH

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>