Mapoly0035s0146



Description

NAI1, DNA BINDING / TRANSCRIPTION FACTOR

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR23042 CIRCADIAN PROTEIN CLOCK/ARNT/BMAL/PAS
PANTHER PTHR23042:SF25 NAI1, DNA BINDING / TRANSCRIPTION FACTOR

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH5 transcription factor, bHLH Mapoly0035s0146.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0035s0146.1 scaffold_35:1536958..1544182  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0035s0146.2 scaffold_35:1536958..1544182  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0035s0146.3 scaffold_35:1536958..1541234  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0035s0146.1  

Gene structure:

mRNA scaffold_35:1536958..1544182  ( - strand )
three_prime_UTR scaffold_35:1536958..1537330  ( - strand )
CDS scaffold_35:1537331..1537414  ( - strand )
CDS scaffold_35:1537917..1538489  ( - strand )
CDS scaffold_35:1538990..1540084  ( - strand )
five_prime_UTR scaffold_35:1540085..1540177  ( - strand )
five_prime_UTR scaffold_35:1542736..1544182  ( - strand )

Sequences:

Gene

>Mapoly0035s0146.1
CCAAGGATTTCATCGTTTCACAGTCCCGCCTGCTCCCGGCCAGAATTCCGTCTCCTGTGACGAAGCGAAGATGACTGTGAAGCCGAGCCCGAGGCCGAGCCCCGGTGCATGCAGATGATTTTTTTGTCAAGCTAGGACTTTTTTTTACAGTCAACATTGTACTGGGAGGGAGGCCGAGCCCTTGCCATGGTCGCCTCGGGTGCTCGAGAATATACGCAGCTATACGAGGCACATGTGGAATTGATATGAGCCCCGATATAAAAAAGCAGTTATACTGCGAGATCTTCAATATAATGCAGAAGTGCACCGACCACAGATGCGAAGGGCATGGCTGGGTTGCCAGGCTACTGGCCGAGAATATTCAGACGAAGCAAACAAGCAAGGCAGACAGCAAGGGAGCGAGGGAGCGAGGGAGCGAGCAAGCAAGCAAGGACTCTAGGAGAACGAGCTCCCGTTCTACGGTGTAGAGCAGGCGTTTAGGCACACGACGAATAGGCTGGGCTCGGGTTACAGCAACTTACGCCAGCTCGCGGAGCTGGCGTGCCATCACAGGTTCAGGTTGAGGCTCACGGACGACGAATATGATGATTCAATTCGTGCAACAAATGTTCCTCAGGATGGGGATCCGTTCACGCCGGGTAGGGAGAGAGTAGGGCCTCATCGCCTGCGTCTGCTGCTGATTAGGCGTTGCCGATGTAGCTTCAGCTGGAGAAGCGAATCAAGGATGCAAAGATATGGCGGCCGCTCGCTGTCTTGACAACACCGTCGTCAGGACTTGCGGAATCTGAGTCTTCGATCTACCGCGGTAGAAGTACAAGTGGTTGCAGTCACTCTCGGTGTCGTGGTCGTAGAAGATTGTCGTAGCGGCCCCAGTAGAACATGAAGAAGGGCCTGACCTCTGTCGAAGATTCGTTTCGTGTGCTGCTGCATCGGGGACTTCATTCACTTGCGGTCAAACGTAGTGCCCCTGGAACGTGAGCGCTAGCGTCGTATAGGGTCCCAACTGTGACGACGACCGGGAGGTACATTGATTCGCGCTGCCCAGTAATTCGAGTAATTCGAGTATCAGTCACTGAGATACTGCTATGCATAAAATTATGATACGGGAAGAGGATAATGGAGTCACTCCAGGTGAGGATCGAGGAGTGTGAGAGAGGCGCTAGCTTCTGCGCATGCTTACAGCGCTGCTGCTGCAGCTTGAAGAAAATTTCTCTTGCCTTGGGTAGCTAGCTGAGCTGAAGCCGGCCGGTGTGGGGAAAGTCATCGTTATCGATGCGAGGTACGTGGAATTCGGCGGATATGAGAGTGAGTGAGGGATCATGAGTGAGGCTCGGCGGACGAGGGGAGGGACGAGAGAGTCAAATGCCGAGCGCAGTTCAGCGAGTGAGACATTTCGAGATCACGCACGCAGTCGTCGCCAAGGCGATGAAGCCAAGCTGAAAAGAAGGTCTGCACTGTGAAGTCACTCGATCACGTTGAGCATTGTCACATGACCCAAGAGCGGCATGTGCAGCCAGGCCCCAACTTGTTAAGAAAATCGGATGGAAAAGAATTTTCTTTTCACGGATTTATCCCTGCGCTGGGTGGCTTGGCCTGAACTGGGCCCTCCCCTCCCCTCTCATCTAGCTCTCCTCTCGCTCTCGCCTCCGATCTGAGGAGGGCGGGTTTAGATCTCAACTCTACGCTATAGGCCAGGCTTTGCGGTGCAGCAGTCGCAACTAGTAAGCAAAAGCGCATCCTTAGCGGGCGAGCATTCAGATGCAGCAGCTAATCAGAGCGACAAAGCAAGGATTGAACACAGACACAGTCGATTAGATCGAAAGTGTGTATCGTCTTGTGAGGTGTGGCTCCTGCTGCTGCAGCAGCCGAGCCAGAAGCCACCAAATTTGACCGCGCAGGCCATGCACATACATGATCGACAAGTTGATTCGAGCATGATCTGAGTGAGCTAGGTTTTGGGGCTGGGAAGAGGCCAGGGAGAGGGTTGGCTAATTAGCGCAAGCCGGGATCTGTCAGCTGTAATTCTCAAGGGTCCGGGAAGAATATTACTAGGACTGGGCGGGGAATCGCCATCAGCTTTAGCATATGCATCGGTTCGCTTCTTTTTGGACCTGGGTTGCTGATTACTGCCGTAAGCCGGGAGCAAAGGCGGAATTGTCCGTCGGGTCTCGCATTGTTCTGCGCTCTAAGTATCCTGTACGATCTCTTTTCTCAGTGCACACCAGACAGACGCAATCAGATGAGTTCCTGCACTCGCGCATGTTCATTAAATTATCAATCGTCATGGTTAGCACCATGCATAGTACGTCAGGCTGGGACTTTGTAGGCCCTCGCCTACGGATTAGCTGCCTAGTACGCATCGAATGGCTACTTTCAGTAAAGCCAAGGGGTGCTAGCTTCATATCTGGACAACAATTGAATACACTCGCCTCGTCTAAGCTTCGGGCCTGTCTGATCATTCTGCAGCTCTAGGGCGCATCTACTTTCCTGTCAGAGCTCGAGCTAAAACTAGCATTAGTCGTCAACTCGACCTTACATTTGACATCACTTCCTGTGCGCACGAGTCTCGAGGACCGAGATTGCGAGCAACAATAATTTTCAGTAAATCGGAATTCCTCCGCTACGTAGTTGTCACGCGTGAGCCTCTGAGACTCACTCTCACTGCGCCGGGGTGAAATATTTTCTCCACCCCGCCTCTCGTCTCCTCTCTCTCTCTCCCTCTCTCCCTCTCTGTGTCGATGGGAAAGCGTGACAGCAGCTAAAGACTGCTTCTCTCTCTGCTAGGACGCGCTTTTCTACACATGTTACTGCAGTTCGATAGAGCAGTCAGCCGGTCTCAGAAGCAGCAGGTTCATGGAATCTCGAAATTGGAGGTGTACTTCGTTCCATACTTGGCTGTCTCCCCTCTCACTTTCTTTCACTATCCTTTCCCTTTTTACGGGGGGGCGACCATTCTGATTTCATCCCGAAACGTACTAGTTTGTGTGACGTGCAATCATAGAAGGGCGCTATGTCTACTCCCCGTGAAACCTATCGAGGCTGTATTTGCACCGGTGGTGTCACGGCGTGCGCAACTAGTGTGGTGGAGAAATTGCTAGAAAGCTTCCCACGCAGGCCCAGGGTTTTTGGAACCGGGCATCTAGTCTTGCGAGAAGAGCTTCATCTGCCTTTCTATCCGGCTTTTTAGTTCCAGTGCACTAGAACTAAAATACACAGTTGCGCCTTCTCCGTCAACGCGACGCGTCTCGTTCCCTCTCATTTAAGCTTTCTTACTTCATCTCGATCTGGTGTTCCTCACAAACCACAAGACTACGCTCTCTCTCTCTTCATCTCTCTCTCCGGCGTAGATATCTTCGTGTCGTGACTGAGTCCGATCTGGGTCACGCAGTGCTGAAATTCGAGGAACATATACGTCCAATTGTAAGATCTTGCAATCACCTCGAAGATCTGGCCATTGGAGTTCTTCGGCTTGTTGATAGTGTCATGGTAGTCTGAACCTTTCGCGGTCCGGGTAGATATCCATACCTCTAATATCTCTGTTGAGCTGTCATCGTTCAAAGGAGTATCTCCGCCAGGTGCAGCAGGTTAGACTAGGCTTCCAGAGGGAAGGAGGGAGGGACGCACTGATCTAAACACATGCATAGACGTCTCGAGCTTGTTGATTCACAGCAGATGATGTTCAAGAAATGCTCGTCAAGCATACACTTTTGGTACTCGAAATTAGAGTTGCATTGAAATTCACCTTCCCGGTCCATATCCATAGAGACCAAATTGTTATGTCCAATCCTGTACACTCAGGCGAATGCGAGCTTGGGAAATGTAAATTTACAGCTCAAATCAACATGCCAAGCATAGGATCAATAGGAGGAAACTATAATTCTTCGTTAAGCCGAATGTGTTTGGAGCTGAGATTGTCCTTTGCAGCTGTGTATCGAGCAGTCGTGAAGCAGATGAATTCACACTAACTGGTTTTCGTCGGTTGTTTGGTGGGCCTGGCGTGTGCAGTGATCTGATCTAGACCACTGGGGCTTCAATTGGAGGAAACGGCCCTCAGCTTCTTTAGCGGATGACTTATGTTGGTGCAAGGCGGTGGTCATCATGTCATCGGTTGTCTTCGTTGCCCAAGACGCGCTAGAGTACAGGTCCCGAATTATGTCCGAGTTCTCGTCAGGAGCATTCAAACCATTTGGAAGTGGTGCTCAGTTCGTTTTGCCCCAGCAGAAATTCGGCGTCCGAGCACCAGCAGCCGAAGACGAGAGCTATCAGGATGTTAAATGGAGGGTCCAGGACAACATGCCCATGGACGGGGATAGTTCCGACCACTCCGGTTTCCGCTCATGGCCAGATTCAGCGCTGTCGCTGTCATCGTCGTCGTCTGCGCATGCCTCAGCACCATGCGCCACATTTGATCATTTCAACGTGAACGAGCACGAAAATGTTGTGGTGAATGAGATGTTCTCGTCACGCGAGGCTCCTGCTTATGAACCGTCGATGCCTCACAGCCTGAACTTGCAGTACCTCGGCAGCAGCAGCCCAGCGCAGTTAGACGAGCTCTATGGCGGTTATCATGGTGGAAGATGGCAAGCAGCTCCAGATCCAAACGGCCCTTGCAACAGCAGTGATGTGCTGGTTGTTGTACCCGGGAACACGCAAGACACAACAAAACCTCTTACCTATCACTTGGCCTCCTCCAACACTTCATGCGACAGTTCTGCGGATTCGTTTAGCTTTCAAAAATTTAGCCCACATTCGACAAGGCTCTCAGCAGCCTCAGGGACACTCCCAGGCAGCATGTCCGGGGCACCACTTGCGATGGCAGACTCTCTGGGCCAGAACAATAAAGCAACAGCACCGTTTAGGAATTCCTTCAGGCCTCCGACAGCTGATCTCAGAAGATTCCAAGCTAGGGGACGAGGGCGAGGAGATTTTAGAGCTGCAGCATCGACCTCGAGAATTGAACAGCAAATGTCTCTAGGAATGAGCTCGCAGTCCTTGGCCGCCAATTATCATCAAGCTCTACGAGTGGCAAAGACACCGACGGACTTCACTCTCGGCAAGCGACAGCTGAACGGTTCCCGAGTTCCCGACATGTTGTCTGGACATTTAGAGCATGTCCAGAGAGAACGCCAACGACGGGACGACATGAGTGCTAAAATTGCCACACTGGAAACTCTTCTCCCGCCTGCTTCCAAAGTTTGTTCCTTTCCCAAGGCGTCGTCCATTTGTTCTTCTTTTTAAATGCTCAGCTCAGTTCAGCTGAGGGTCCATTTCAGGCTCATGATAAGGACAGTCTCATGATCCAGTTCTCATCCGCCGTGCTTGAGTACGGAGCAGCTGACATCTGACACGTAGATAATTTCCGGCATGTATGGATGTACGTAGCGGAAGATCATGAGTTGCAATTGTGCCAAGGTGCAAATCCAATCTCCGCACCTCGGCACAATGCATTATGGTCTGAGCAGACCTTGCACTCTCTAGGTGCTGGCTGGAATTGTCATATCCAAATGCAATATGCTCGAGCCAAAAGTTGTGATGATCTCGTTCCTAGATCATCACTACTAAAATAGACGTCACGAGTCTAACTTTCCACATCTGACCTCTCGTGCGAGTGCGAGCGAGTGAGTGAGGAAGGCTCAGGATGAAGTCCAGTGCAGGAATGTTGATTCCCTTTGCAAATTTGTCGGTGTTTGCAGCGGGACAGGGTCTCCATTGTGCACGACGGCATACACTACGTGAGGGCCTTGCAGGAGAAGGTGAAAGCGCTGCAAGGTCAGCTGCAAGAGGCGAAGCGCAGAGCAGAAGCTGGGGCGCAAGATAAGAAATGGTCATGCTTAGGTAGCAGTAGTAACGTGGATTTTGCTAGCAGTAGTAGAAACCTTTCTAGTTCTCGGGCCGTGCTTAACGCCTCGAGGACTTCGGGTAGATTTCGCCTGGGGCCCATGACGAGGACGACATCGACCACTTCTTTCAACATAGGTGGCACTCAGAGCGGCCGGGCTGAATTCGAAGGAAGCGGTGGCTTCTCAGATTCACCATTGCTGGGTCTAACGCCTAAAAGCGAACCTCTTCCAAGCCGCGGTCCAATTTCTGTGGAGCTTCACGTGCAAGTAGACAGACCGGGTGAACAGGTGCAAGTTGTCAAGTGTGAATGCAGATATAGCTACTTGAGCAGTGTCATGAGAACTCTCGACCAGCTGCAGCTGAGTCTCCACCGGTGCAGTGTTACGAAGCTGCATGACTACGTGATCTGCGTCATAGTAATTAAGGTTCAAACGAGAACTTTAACTCCAACTGTGCTTGAACCTTGCATGATTTGCCTTCTAGAAATTTCGACAGCCACATGCACCAAGTTTCGTCCAGAAAGTAATATGGACCCTGAATTGCCTTCACTGCGTCGCACTCACCTTCTATCTTTGATGATTTACTCCCATTACTTGCTGTTACTTGGAATTGTGAGACCTCCTCTGAGGCCAAGTTCCAAAGCTGGTAGAGAGTTTGATGGTGCATATTTACGGTGTTGGACTCCACATACAGTAGTGAGTCAGTAACCCTTGCAGTCTTTCCTGAAACGTAGACAGCTAGCTCAAATGCGTGTAGCTGCCACATTGGAAGTTTCACTCCTGTAAGTTTCCCTTACGGAAAAGAAGTTTCACTAACTTCCAAAGAAGTGAAACTTACTCTAGAGCTGGCATAAGATAGCTGCAACTTACTCTATTTATTGCTAACACACTGTTTCGGTTGTGGTTGTGTGTTGGGGTTTGTGTGCAGCCAACTTCAAATTGCTCTACTGCTCACGCTGTTTCGTCGGCCCAAATAGCAACTCTGTTGAAGATAGCTGCTGTGGACTCCTGAGAAAGCATTCCTGTGAACAGTTTTATTGGAATGGCTACATCGGCTTTTGGAACAATCCATGGCTAGTTAGCCATCCACTGGAAGAAAACGTATTTAGTACTAAGTGACATTGTCCCTCTCAGTACGTTGAGCATTGTTCATCTGCACATTTCACGTTCCAGATAAAAAGGCATGCGCAGGAAGCGGTATCGAATCTGCTGAACCTGGCGCAATTGGGTTGCAATTTAGAAAAGCTGGGGCCACTCCTCTTATAGAGTGCGTTTAAATCCTGGAGGTCAAATAGAGAACAATGATCTCACATGTAGATTCGCATTTATTCTTTCGATACTTTATAATAGTGTATCTGTTCGAGCCAAGAAATTAATAGAATGGA

mRNA

>Mapoly0035s0146.1
CCAAGGATTTCATCGTTTCACAGTCCCGCCTGCTCCCGGCCAGAATTCCGTCTCCTGTGACGAAGCGAAGATGACTGTGAAGCCGAGCCCGAGGCCGAGCCCCGGTGCATGCAGATGATTTTTTTGTCAAGCTAGGACTTTTTTTTACAGTCAACATTGTACTGGGAGGGAGGCCGAGCCCTTGCCATGGTCGCCTCGGGTGCTCGAGAATATACGCAGCTATACGAGGCACATGTGGAATTGATATGAGCCCCGATATAAAAAAGCAGTTATACTGCGAGATCTTCAATATAATGCAGAAGTGCACCGACCACAGATGCGAAGGGCATGGCTGGGTTGCCAGGCTACTGGCCGAGAATATTCAGACGAAGCAAACAAGCAAGGCAGACAGCAAGGGAGCGAGGGAGCGAGGGAGCGAGCAAGCAAGCAAGGACTCTAGGAGAACGAGCTCCCGTTCTACGGTGTAGAGCAGGCGTTTAGGCACACGACGAATAGGCTGGGCTCGGGTTACAGCAACTTACGCCAGCTCGCGGAGCTGGCGTGCCATCACAGGTTCAGGTTGAGGCTCACGGACGACGAATATGATGATTCAATTCGTGCAACAAATGTTCCTCAGGATGGGGATCCGTTCACGCCGGGTAGGGAGAGAGTAGGGCCTCATCGCCTGCGTCTGCTGCTGATTAGGCGTTGCCGATGTAGCTTCAGCTGGAGAAGCGAATCAAGGATGCAAAGATATGGCGGCCGCTCGCTGTCTTGACAACACCGTCGTCAGGACTTGCGGAATCTGAGTCTTCGATCTACCGCGGTAGAAGTACAAGTGGTTGCAGTCACTCTCGGTGTCGTGGTCGTAGAAGATTGTCGTAGCGGCCCCAGTAGAACATGAAGAAGGGCCTGACCTCTGTCGAAGATTCGTTTCGTGTGCTGCTGCATCGGGGACTTCATTCACTTGCGGTCAAACGTAGTGCCCCTGGAACGTGAGCGCTAGCGTCGTATAGGGTCCCAACTGTGACGACGACCGGGAGGTACATTGATTCGCGCTGCCCAGTAATTCGAGTAATTCGAGTATCAGTCACTGAGATACTGCTATGCATAAAATTATGATACGGGAAGAGGATAATGGAGTCACTCCAGGTGAGGATCGAGGAGTGTGAGAGAGGCGCTAGCTTCTGCGCATGCTTACAGCGCTGCTGCTGCAGCTTGAAGAAAATTTCTCTTGCCTTGGGTAGCTAGCTGAGCTGAAGCCGGCCGGTGTGGGGAAAGTCATCGTTATCGATGCGAGGTACGTGGAATTCGGCGGATATGAGAGTGAGTGAGGGATCATGAGTGAGGCTCGGCGGACGAGGGGAGGGACGAGAGAGTCAAATGCCGAGCGCAGTTCAGCGAGTGAGACATTTCGAGATCACGCACGCAGTCGTCGCCAAGGCGATGAAGCCAAGCTGAAAAGAAGTGATCTGATCTAGACCACTGGGGCTTCAATTGGAGGAAACGGCCCTCAGCTTCTTTAGCGGATGACTTATGTTGGTGCAAGGCGGTGGTCATCATGTCATCGGTTGTCTTCGTTGCCCAAGACGCGCTAGAGTACAGGTCCCGAATTATGTCCGAGTTCTCGTCAGGAGCATTCAAACCATTTGGAAGTGGTGCTCAGTTCGTTTTGCCCCAGCAGAAATTCGGCGTCCGAGCACCAGCAGCCGAAGACGAGAGCTATCAGGATGTTAAATGGAGGGTCCAGGACAACATGCCCATGGACGGGGATAGTTCCGACCACTCCGGTTTCCGCTCATGGCCAGATTCAGCGCTGTCGCTGTCATCGTCGTCGTCTGCGCATGCCTCAGCACCATGCGCCACATTTGATCATTTCAACGTGAACGAGCACGAAAATGTTGTGGTGAATGAGATGTTCTCGTCACGCGAGGCTCCTGCTTATGAACCGTCGATGCCTCACAGCCTGAACTTGCAGTACCTCGGCAGCAGCAGCCCAGCGCAGTTAGACGAGCTCTATGGCGGTTATCATGGTGGAAGATGGCAAGCAGCTCCAGATCCAAACGGCCCTTGCAACAGCAGTGATGTGCTGGTTGTTGTACCCGGGAACACGCAAGACACAACAAAACCTCTTACCTATCACTTGGCCTCCTCCAACACTTCATGCGACAGTTCTGCGGATTCGTTTAGCTTTCAAAAATTTAGCCCACATTCGACAAGGCTCTCAGCAGCCTCAGGGACACTCCCAGGCAGCATGTCCGGGGCACCACTTGCGATGGCAGACTCTCTGGGCCAGAACAATAAAGCAACAGCACCGTTTAGGAATTCCTTCAGGCCTCCGACAGCTGATCTCAGAAGATTCCAAGCTAGGGGACGAGGGCGAGGAGATTTTAGAGCTGCAGCATCGACCTCGAGAATTGAACAGCAAATGTCTCTAGGAATGAGCTCGCAGTCCTTGGCCGCCAATTATCATCAAGCTCTACGAGTGGCAAAGACACCGACGGACTTCACTCTCGGCAAGCGACAGCTGAACGGTTCCCGAGTTCCCGACATGTTGTCTGGACATTTAGAGCATGTCCAGAGAGAACGCCAACGACGGGACGACATGAGTGCTAAAATTGCCACACTGGAAACTCTTCTCCCGCCTGCTTCCAAACGGGACAGGGTCTCCATTGTGCACGACGGCATACACTACGTGAGGGCCTTGCAGGAGAAGGTGAAAGCGCTGCAAGGTCAGCTGCAAGAGGCGAAGCGCAGAGCAGAAGCTGGGGCGCAAGATAAGAAATGGTCATGCTTAGGTAGCAGTAGTAACGTGGATTTTGCTAGCAGTAGTAGAAACCTTTCTAGTTCTCGGGCCGTGCTTAACGCCTCGAGGACTTCGGGTAGATTTCGCCTGGGGCCCATGACGAGGACGACATCGACCACTTCTTTCAACATAGGTGGCACTCAGAGCGGCCGGGCTGAATTCGAAGGAAGCGGTGGCTTCTCAGATTCACCATTGCTGGGTCTAACGCCTAAAAGCGAACCTCTTCCAAGCCGCGGTCCAATTTCTGTGGAGCTTCACGTGCAAGTAGACAGACCGGGTGAACAGGTGCAAGTTGTCAAGTGTGAATGCAGATATAGCTACTTGAGCAGTGTCATGAGAACTCTCGACCAGCTGCAGCTGAGTCTCCACCGGTGCAGTGTTACGAAGCTGCATGACTACGTGATCTGCGTCATAGTAATTAAGCCAACTTCAAATTGCTCTACTGCTCACGCTGTTTCGTCGGCCCAAATAGCAACTCTGTTGAAGATAGCTGCTGTGGACTCCTGAGAAAGCATTCCTGTGAACAGTTTTATTGGAATGGCTACATCGGCTTTTGGAACAATCCATGGCTAGTTAGCCATCCACTGGAAGAAAACGTATTTAGTACTAAGTGACATTGTCCCTCTCAGTACGTTGAGCATTGTTCATCTGCACATTTCACGTTCCAGATAAAAAGGCATGCGCAGGAAGCGGTATCGAATCTGCTGAACCTGGCGCAATTGGGTTGCAATTTAGAAAAGCTGGGGCCACTCCTCTTATAGAGTGCGTTTAAATCCTGGAGGTCAAATAGAGAACAATGATCTCACATGTAGATTCGCATTTATTCTTTCGATACTTTATAATAGTGTATCTGTTCGAGCCAAGAAATTAATAGAATGGA

CDS

>Mapoly0035s0146.1
ATGTCATCGGTTGTCTTCGTTGCCCAAGACGCGCTAGAGTACAGGTCCCGAATTATGTCCGAGTTCTCGTCAGGAGCATTCAAACCATTTGGAAGTGGTGCTCAGTTCGTTTTGCCCCAGCAGAAATTCGGCGTCCGAGCACCAGCAGCCGAAGACGAGAGCTATCAGGATGTTAAATGGAGGGTCCAGGACAACATGCCCATGGACGGGGATAGTTCCGACCACTCCGGTTTCCGCTCATGGCCAGATTCAGCGCTGTCGCTGTCATCGTCGTCGTCTGCGCATGCCTCAGCACCATGCGCCACATTTGATCATTTCAACGTGAACGAGCACGAAAATGTTGTGGTGAATGAGATGTTCTCGTCACGCGAGGCTCCTGCTTATGAACCGTCGATGCCTCACAGCCTGAACTTGCAGTACCTCGGCAGCAGCAGCCCAGCGCAGTTAGACGAGCTCTATGGCGGTTATCATGGTGGAAGATGGCAAGCAGCTCCAGATCCAAACGGCCCTTGCAACAGCAGTGATGTGCTGGTTGTTGTACCCGGGAACACGCAAGACACAACAAAACCTCTTACCTATCACTTGGCCTCCTCCAACACTTCATGCGACAGTTCTGCGGATTCGTTTAGCTTTCAAAAATTTAGCCCACATTCGACAAGGCTCTCAGCAGCCTCAGGGACACTCCCAGGCAGCATGTCCGGGGCACCACTTGCGATGGCAGACTCTCTGGGCCAGAACAATAAAGCAACAGCACCGTTTAGGAATTCCTTCAGGCCTCCGACAGCTGATCTCAGAAGATTCCAAGCTAGGGGACGAGGGCGAGGAGATTTTAGAGCTGCAGCATCGACCTCGAGAATTGAACAGCAAATGTCTCTAGGAATGAGCTCGCAGTCCTTGGCCGCCAATTATCATCAAGCTCTACGAGTGGCAAAGACACCGACGGACTTCACTCTCGGCAAGCGACAGCTGAACGGTTCCCGAGTTCCCGACATGTTGTCTGGACATTTAGAGCATGTCCAGAGAGAACGCCAACGACGGGACGACATGAGTGCTAAAATTGCCACACTGGAAACTCTTCTCCCGCCTGCTTCCAAACGGGACAGGGTCTCCATTGTGCACGACGGCATACACTACGTGAGGGCCTTGCAGGAGAAGGTGAAAGCGCTGCAAGGTCAGCTGCAAGAGGCGAAGCGCAGAGCAGAAGCTGGGGCGCAAGATAAGAAATGGTCATGCTTAGGTAGCAGTAGTAACGTGGATTTTGCTAGCAGTAGTAGAAACCTTTCTAGTTCTCGGGCCGTGCTTAACGCCTCGAGGACTTCGGGTAGATTTCGCCTGGGGCCCATGACGAGGACGACATCGACCACTTCTTTCAACATAGGTGGCACTCAGAGCGGCCGGGCTGAATTCGAAGGAAGCGGTGGCTTCTCAGATTCACCATTGCTGGGTCTAACGCCTAAAAGCGAACCTCTTCCAAGCCGCGGTCCAATTTCTGTGGAGCTTCACGTGCAAGTAGACAGACCGGGTGAACAGGTGCAAGTTGTCAAGTGTGAATGCAGATATAGCTACTTGAGCAGTGTCATGAGAACTCTCGACCAGCTGCAGCTGAGTCTCCACCGGTGCAGTGTTACGAAGCTGCATGACTACGTGATCTGCGTCATAGTAATTAAGCCAACTTCAAATTGCTCTACTGCTCACGCTGTTTCGTCGGCCCAAATAGCAACTCTGTTGAAGATAGCTGCTGTGGACTCCTGA

Protein

>Mapoly0035s0146.1
MSSVVFVAQDALEYRSRIMSEFSSGAFKPFGSGAQFVLPQQKFGVRAPAAEDESYQDVKWRVQDNMPMDGDSSDHSGFRSWPDSALSLSSSSSAHASAPCATFDHFNVNEHENVVVNEMFSSREAPAYEPSMPHSLNLQYLGSSSPAQLDELYGGYHGGRWQAAPDPNGPCNSSDVLVVVPGNTQDTTKPLTYHLASSNTSCDSSADSFSFQKFSPHSTRLSAASGTLPGSMSGAPLAMADSLGQNNKATAPFRNSFRPPTADLRRFQARGRGRGDFRAAASTSRIEQQMSLGMSSQSLAANYHQALRVAKTPTDFTLGKRQLNGSRVPDMLSGHLEHVQRERQRRDDMSAKIATLETLLPPASKRDRVSIVHDGIHYVRALQEKVKALQGQLQEAKRRAEAGAQDKKWSCLGSSSNVDFASSSRNLSSSRAVLNASRTSGRFRLGPMTRTTSTTSFNIGGTQSGRAEFEGSGGFSDSPLLGLTPKSEPLPSRGPISVELHVQVDRPGEQVQVVKCECRYSYLSSVMRTLDQLQLSLHRCSVTKLHDYVICVIVIKPTSNCSTAHAVSSAQIATLLKIAAVDS

Mapoly0035s0146.2  

Gene structure:

mRNA scaffold_35:1536958..1544182  ( - strand )
three_prime_UTR scaffold_35:1536958..1537330  ( - strand )
CDS scaffold_35:1537331..1537414  ( - strand )
CDS scaffold_35:1537917..1538489  ( - strand )
CDS scaffold_35:1538990..1540084  ( - strand )
five_prime_UTR scaffold_35:1540085..1540177  ( - strand )
five_prime_UTR scaffold_35:1543161..1544182  ( - strand )

Sequences:

Gene

>Mapoly0035s0146.2
CCAAGGATTTCATCGTTTCACAGTCCCGCCTGCTCCCGGCCAGAATTCCGTCTCCTGTGACGAAGCGAAGATGACTGTGAAGCCGAGCCCGAGGCCGAGCCCCGGTGCATGCAGATGATTTTTTTGTCAAGCTAGGACTTTTTTTTACAGTCAACATTGTACTGGGAGGGAGGCCGAGCCCTTGCCATGGTCGCCTCGGGTGCTCGAGAATATACGCAGCTATACGAGGCACATGTGGAATTGATATGAGCCCCGATATAAAAAAGCAGTTATACTGCGAGATCTTCAATATAATGCAGAAGTGCACCGACCACAGATGCGAAGGGCATGGCTGGGTTGCCAGGCTACTGGCCGAGAATATTCAGACGAAGCAAACAAGCAAGGCAGACAGCAAGGGAGCGAGGGAGCGAGGGAGCGAGCAAGCAAGCAAGGACTCTAGGAGAACGAGCTCCCGTTCTACGGTGTAGAGCAGGCGTTTAGGCACACGACGAATAGGCTGGGCTCGGGTTACAGCAACTTACGCCAGCTCGCGGAGCTGGCGTGCCATCACAGGTTCAGGTTGAGGCTCACGGACGACGAATATGATGATTCAATTCGTGCAACAAATGTTCCTCAGGATGGGGATCCGTTCACGCCGGGTAGGGAGAGAGTAGGGCCTCATCGCCTGCGTCTGCTGCTGATTAGGCGTTGCCGATGTAGCTTCAGCTGGAGAAGCGAATCAAGGATGCAAAGATATGGCGGCCGCTCGCTGTCTTGACAACACCGTCGTCAGGACTTGCGGAATCTGAGTCTTCGATCTACCGCGGTAGAAGTACAAGTGGTTGCAGTCACTCTCGGTGTCGTGGTCGTAGAAGATTGTCGTAGCGGCCCCAGTAGAACATGAAGAAGGGCCTGACCTCTGTCGAAGATTCGTTTCGTGTGCTGCTGCATCGGGGACTTCATTCACTTGCGGTCAAACGTAGTGCCCCTGGAACGTGAGCGCTAGCGTCGTATAGGGTCCCAACTGTGACGACGACCGGGAGGTACATTGATTCGCGCTGCCCAGTAATTCGAGTAATTCGAGTATCAGTCACTGAGATACTGCTATGCATAAAATTATGATACGGGAAGAGGATAATGGAGTCACTCCAGGTGAGGATCGAGGAGTGTGAGAGAGGCGCTAGCTTCTGCGCATGCTTACAGCGCTGCTGCTGCAGCTTGAAGAAAATTTCTCTTGCCTTGGGTAGCTAGCTGAGCTGAAGCCGGCCGGTGTGGGGAAAGTCATCGTTATCGATGCGAGGTACGTGGAATTCGGCGGATATGAGAGTGAGTGAGGGATCATGAGTGAGGCTCGGCGGACGAGGGGAGGGACGAGAGAGTCAAATGCCGAGCGCAGTTCAGCGAGTGAGACATTTCGAGATCACGCACGCAGTCGTCGCCAAGGCGATGAAGCCAAGCTGAAAAGAAGGTCTGCACTGTGAAGTCACTCGATCACGTTGAGCATTGTCACATGACCCAAGAGCGGCATGTGCAGCCAGGCCCCAACTTGTTAAGAAAATCGGATGGAAAAGAATTTTCTTTTCACGGATTTATCCCTGCGCTGGGTGGCTTGGCCTGAACTGGGCCCTCCCCTCCCCTCTCATCTAGCTCTCCTCTCGCTCTCGCCTCCGATCTGAGGAGGGCGGGTTTAGATCTCAACTCTACGCTATAGGCCAGGCTTTGCGGTGCAGCAGTCGCAACTAGTAAGCAAAAGCGCATCCTTAGCGGGCGAGCATTCAGATGCAGCAGCTAATCAGAGCGACAAAGCAAGGATTGAACACAGACACAGTCGATTAGATCGAAAGTGTGTATCGTCTTGTGAGGTGTGGCTCCTGCTGCTGCAGCAGCCGAGCCAGAAGCCACCAAATTTGACCGCGCAGGCCATGCACATACATGATCGACAAGTTGATTCGAGCATGATCTGAGTGAGCTAGGTTTTGGGGCTGGGAAGAGGCCAGGGAGAGGGTTGGCTAATTAGCGCAAGCCGGGATCTGTCAGCTGTAATTCTCAAGGGTCCGGGAAGAATATTACTAGGACTGGGCGGGGAATCGCCATCAGCTTTAGCATATGCATCGGTTCGCTTCTTTTTGGACCTGGGTTGCTGATTACTGCCGTAAGCCGGGAGCAAAGGCGGAATTGTCCGTCGGGTCTCGCATTGTTCTGCGCTCTAAGTATCCTGTACGATCTCTTTTCTCAGTGCACACCAGACAGACGCAATCAGATGAGTTCCTGCACTCGCGCATGTTCATTAAATTATCAATCGTCATGGTTAGCACCATGCATAGTACGTCAGGCTGGGACTTTGTAGGCCCTCGCCTACGGATTAGCTGCCTAGTACGCATCGAATGGCTACTTTCAGTAAAGCCAAGGGGTGCTAGCTTCATATCTGGACAACAATTGAATACACTCGCCTCGTCTAAGCTTCGGGCCTGTCTGATCATTCTGCAGCTCTAGGGCGCATCTACTTTCCTGTCAGAGCTCGAGCTAAAACTAGCATTAGTCGTCAACTCGACCTTACATTTGACATCACTTCCTGTGCGCACGAGTCTCGAGGACCGAGATTGCGAGCAACAATAATTTTCAGTAAATCGGAATTCCTCCGCTACGTAGTTGTCACGCGTGAGCCTCTGAGACTCACTCTCACTGCGCCGGGGTGAAATATTTTCTCCACCCCGCCTCTCGTCTCCTCTCTCTCTCTCCCTCTCTCCCTCTCTGTGTCGATGGGAAAGCGTGACAGCAGCTAAAGACTGCTTCTCTCTCTGCTAGGACGCGCTTTTCTACACATGTTACTGCAGTTCGATAGAGCAGTCAGCCGGTCTCAGAAGCAGCAGGTTCATGGAATCTCGAAATTGGAGGTGTACTTCGTTCCATACTTGGCTGTCTCCCCTCTCACTTTCTTTCACTATCCTTTCCCTTTTTACGGGGGGGCGACCATTCTGATTTCATCCCGAAACGTACTAGTTTGTGTGACGTGCAATCATAGAAGGGCGCTATGTCTACTCCCCGTGAAACCTATCGAGGCTGTATTTGCACCGGTGGTGTCACGGCGTGCGCAACTAGTGTGGTGGAGAAATTGCTAGAAAGCTTCCCACGCAGGCCCAGGGTTTTTGGAACCGGGCATCTAGTCTTGCGAGAAGAGCTTCATCTGCCTTTCTATCCGGCTTTTTAGTTCCAGTGCACTAGAACTAAAATACACAGTTGCGCCTTCTCCGTCAACGCGACGCGTCTCGTTCCCTCTCATTTAAGCTTTCTTACTTCATCTCGATCTGGTGTTCCTCACAAACCACAAGACTACGCTCTCTCTCTCTTCATCTCTCTCTCCGGCGTAGATATCTTCGTGTCGTGACTGAGTCCGATCTGGGTCACGCAGTGCTGAAATTCGAGGAACATATACGTCCAATTGTAAGATCTTGCAATCACCTCGAAGATCTGGCCATTGGAGTTCTTCGGCTTGTTGATAGTGTCATGGTAGTCTGAACCTTTCGCGGTCCGGGTAGATATCCATACCTCTAATATCTCTGTTGAGCTGTCATCGTTCAAAGGAGTATCTCCGCCAGGTGCAGCAGGTTAGACTAGGCTTCCAGAGGGAAGGAGGGAGGGACGCACTGATCTAAACACATGCATAGACGTCTCGAGCTTGTTGATTCACAGCAGATGATGTTCAAGAAATGCTCGTCAAGCATACACTTTTGGTACTCGAAATTAGAGTTGCATTGAAATTCACCTTCCCGGTCCATATCCATAGAGACCAAATTGTTATGTCCAATCCTGTACACTCAGGCGAATGCGAGCTTGGGAAATGTAAATTTACAGCTCAAATCAACATGCCAAGCATAGGATCAATAGGAGGAAACTATAATTCTTCGTTAAGCCGAATGTGTTTGGAGCTGAGATTGTCCTTTGCAGCTGTGTATCGAGCAGTCGTGAAGCAGATGAATTCACACTAACTGGTTTTCGTCGGTTGTTTGGTGGGCCTGGCGTGTGCAGTGATCTGATCTAGACCACTGGGGCTTCAATTGGAGGAAACGGCCCTCAGCTTCTTTAGCGGATGACTTATGTTGGTGCAAGGCGGTGGTCATCATGTCATCGGTTGTCTTCGTTGCCCAAGACGCGCTAGAGTACAGGTCCCGAATTATGTCCGAGTTCTCGTCAGGAGCATTCAAACCATTTGGAAGTGGTGCTCAGTTCGTTTTGCCCCAGCAGAAATTCGGCGTCCGAGCACCAGCAGCCGAAGACGAGAGCTATCAGGATGTTAAATGGAGGGTCCAGGACAACATGCCCATGGACGGGGATAGTTCCGACCACTCCGGTTTCCGCTCATGGCCAGATTCAGCGCTGTCGCTGTCATCGTCGTCGTCTGCGCATGCCTCAGCACCATGCGCCACATTTGATCATTTCAACGTGAACGAGCACGAAAATGTTGTGGTGAATGAGATGTTCTCGTCACGCGAGGCTCCTGCTTATGAACCGTCGATGCCTCACAGCCTGAACTTGCAGTACCTCGGCAGCAGCAGCCCAGCGCAGTTAGACGAGCTCTATGGCGGTTATCATGGTGGAAGATGGCAAGCAGCTCCAGATCCAAACGGCCCTTGCAACAGCAGTGATGTGCTGGTTGTTGTACCCGGGAACACGCAAGACACAACAAAACCTCTTACCTATCACTTGGCCTCCTCCAACACTTCATGCGACAGTTCTGCGGATTCGTTTAGCTTTCAAAAATTTAGCCCACATTCGACAAGGCTCTCAGCAGCCTCAGGGACACTCCCAGGCAGCATGTCCGGGGCACCACTTGCGATGGCAGACTCTCTGGGCCAGAACAATAAAGCAACAGCACCGTTTAGGAATTCCTTCAGGCCTCCGACAGCTGATCTCAGAAGATTCCAAGCTAGGGGACGAGGGCGAGGAGATTTTAGAGCTGCAGCATCGACCTCGAGAATTGAACAGCAAATGTCTCTAGGAATGAGCTCGCAGTCCTTGGCCGCCAATTATCATCAAGCTCTACGAGTGGCAAAGACACCGACGGACTTCACTCTCGGCAAGCGACAGCTGAACGGTTCCCGAGTTCCCGACATGTTGTCTGGACATTTAGAGCATGTCCAGAGAGAACGCCAACGACGGGACGACATGAGTGCTAAAATTGCCACACTGGAAACTCTTCTCCCGCCTGCTTCCAAAGTTTGTTCCTTTCCCAAGGCGTCGTCCATTTGTTCTTCTTTTTAAATGCTCAGCTCAGTTCAGCTGAGGGTCCATTTCAGGCTCATGATAAGGACAGTCTCATGATCCAGTTCTCATCCGCCGTGCTTGAGTACGGAGCAGCTGACATCTGACACGTAGATAATTTCCGGCATGTATGGATGTACGTAGCGGAAGATCATGAGTTGCAATTGTGCCAAGGTGCAAATCCAATCTCCGCACCTCGGCACAATGCATTATGGTCTGAGCAGACCTTGCACTCTCTAGGTGCTGGCTGGAATTGTCATATCCAAATGCAATATGCTCGAGCCAAAAGTTGTGATGATCTCGTTCCTAGATCATCACTACTAAAATAGACGTCACGAGTCTAACTTTCCACATCTGACCTCTCGTGCGAGTGCGAGCGAGTGAGTGAGGAAGGCTCAGGATGAAGTCCAGTGCAGGAATGTTGATTCCCTTTGCAAATTTGTCGGTGTTTGCAGCGGGACAGGGTCTCCATTGTGCACGACGGCATACACTACGTGAGGGCCTTGCAGGAGAAGGTGAAAGCGCTGCAAGGTCAGCTGCAAGAGGCGAAGCGCAGAGCAGAAGCTGGGGCGCAAGATAAGAAATGGTCATGCTTAGGTAGCAGTAGTAACGTGGATTTTGCTAGCAGTAGTAGAAACCTTTCTAGTTCTCGGGCCGTGCTTAACGCCTCGAGGACTTCGGGTAGATTTCGCCTGGGGCCCATGACGAGGACGACATCGACCACTTCTTTCAACATAGGTGGCACTCAGAGCGGCCGGGCTGAATTCGAAGGAAGCGGTGGCTTCTCAGATTCACCATTGCTGGGTCTAACGCCTAAAAGCGAACCTCTTCCAAGCCGCGGTCCAATTTCTGTGGAGCTTCACGTGCAAGTAGACAGACCGGGTGAACAGGTGCAAGTTGTCAAGTGTGAATGCAGATATAGCTACTTGAGCAGTGTCATGAGAACTCTCGACCAGCTGCAGCTGAGTCTCCACCGGTGCAGTGTTACGAAGCTGCATGACTACGTGATCTGCGTCATAGTAATTAAGGTTCAAACGAGAACTTTAACTCCAACTGTGCTTGAACCTTGCATGATTTGCCTTCTAGAAATTTCGACAGCCACATGCACCAAGTTTCGTCCAGAAAGTAATATGGACCCTGAATTGCCTTCACTGCGTCGCACTCACCTTCTATCTTTGATGATTTACTCCCATTACTTGCTGTTACTTGGAATTGTGAGACCTCCTCTGAGGCCAAGTTCCAAAGCTGGTAGAGAGTTTGATGGTGCATATTTACGGTGTTGGACTCCACATACAGTAGTGAGTCAGTAACCCTTGCAGTCTTTCCTGAAACGTAGACAGCTAGCTCAAATGCGTGTAGCTGCCACATTGGAAGTTTCACTCCTGTAAGTTTCCCTTACGGAAAAGAAGTTTCACTAACTTCCAAAGAAGTGAAACTTACTCTAGAGCTGGCATAAGATAGCTGCAACTTACTCTATTTATTGCTAACACACTGTTTCGGTTGTGGTTGTGTGTTGGGGTTTGTGTGCAGCCAACTTCAAATTGCTCTACTGCTCACGCTGTTTCGTCGGCCCAAATAGCAACTCTGTTGAAGATAGCTGCTGTGGACTCCTGAGAAAGCATTCCTGTGAACAGTTTTATTGGAATGGCTACATCGGCTTTTGGAACAATCCATGGCTAGTTAGCCATCCACTGGAAGAAAACGTATTTAGTACTAAGTGACATTGTCCCTCTCAGTACGTTGAGCATTGTTCATCTGCACATTTCACGTTCCAGATAAAAAGGCATGCGCAGGAAGCGGTATCGAATCTGCTGAACCTGGCGCAATTGGGTTGCAATTTAGAAAAGCTGGGGCCACTCCTCTTATAGAGTGCGTTTAAATCCTGGAGGTCAAATAGAGAACAATGATCTCACATGTAGATTCGCATTTATTCTTTCGATACTTTATAATAGTGTATCTGTTCGAGCCAAGAAATTAATAGAATGGA

mRNA

>Mapoly0035s0146.2
CCAAGGATTTCATCGTTTCACAGTCCCGCCTGCTCCCGGCCAGAATTCCGTCTCCTGTGACGAAGCGAAGATGACTGTGAAGCCGAGCCCGAGGCCGAGCCCCGGTGCATGCAGATGATTTTTTTGTCAAGCTAGGACTTTTTTTTACAGTCAACATTGTACTGGGAGGGAGGCCGAGCCCTTGCCATGGTCGCCTCGGGTGCTCGAGAATATACGCAGCTATACGAGGCACATGTGGAATTGATATGAGCCCCGATATAAAAAAGCAGTTATACTGCGAGATCTTCAATATAATGCAGAAGTGCACCGACCACAGATGCGAAGGGCATGGCTGGGTTGCCAGGCTACTGGCCGAGAATATTCAGACGAAGCAAACAAGCAAGGCAGACAGCAAGGGAGCGAGGGAGCGAGGGAGCGAGCAAGCAAGCAAGGACTCTAGGAGAACGAGCTCCCGTTCTACGGTGTAGAGCAGGCGTTTAGGCACACGACGAATAGGCTGGGCTCGGGTTACAGCAACTTACGCCAGCTCGCGGAGCTGGCGTGCCATCACAGGTTCAGGTTGAGGCTCACGGACGACGAATATGATGATTCAATTCGTGCAACAAATGTTCCTCAGGATGGGGATCCGTTCACGCCGGGTAGGGAGAGAGTAGGGCCTCATCGCCTGCGTCTGCTGCTGATTAGGCGTTGCCGATGTAGCTTCAGCTGGAGAAGCGAATCAAGGATGCAAAGATATGGCGGCCGCTCGCTGTCTTGACAACACCGTCGTCAGGACTTGCGGAATCTGAGTCTTCGATCTACCGCGGTAGAAGTACAAGTGGTTGCAGTCACTCTCGGTGTCGTGGTCGTAGAAGATTGTCGTAGCGGCCCCAGTAGAACATGAAGAAGGGCCTGACCTCTGTCGAAGATTCGTTTCGTGTGCTGCTGCATCGGGGACTTCATTCACTTGCGGTCAAACGTAGTGCCCCTGGAACGTGAGCGCTAGCGTCGTATAGGGTCCCAACTGTGACGACGACCGGGAGTGATCTGATCTAGACCACTGGGGCTTCAATTGGAGGAAACGGCCCTCAGCTTCTTTAGCGGATGACTTATGTTGGTGCAAGGCGGTGGTCATCATGTCATCGGTTGTCTTCGTTGCCCAAGACGCGCTAGAGTACAGGTCCCGAATTATGTCCGAGTTCTCGTCAGGAGCATTCAAACCATTTGGAAGTGGTGCTCAGTTCGTTTTGCCCCAGCAGAAATTCGGCGTCCGAGCACCAGCAGCCGAAGACGAGAGCTATCAGGATGTTAAATGGAGGGTCCAGGACAACATGCCCATGGACGGGGATAGTTCCGACCACTCCGGTTTCCGCTCATGGCCAGATTCAGCGCTGTCGCTGTCATCGTCGTCGTCTGCGCATGCCTCAGCACCATGCGCCACATTTGATCATTTCAACGTGAACGAGCACGAAAATGTTGTGGTGAATGAGATGTTCTCGTCACGCGAGGCTCCTGCTTATGAACCGTCGATGCCTCACAGCCTGAACTTGCAGTACCTCGGCAGCAGCAGCCCAGCGCAGTTAGACGAGCTCTATGGCGGTTATCATGGTGGAAGATGGCAAGCAGCTCCAGATCCAAACGGCCCTTGCAACAGCAGTGATGTGCTGGTTGTTGTACCCGGGAACACGCAAGACACAACAAAACCTCTTACCTATCACTTGGCCTCCTCCAACACTTCATGCGACAGTTCTGCGGATTCGTTTAGCTTTCAAAAATTTAGCCCACATTCGACAAGGCTCTCAGCAGCCTCAGGGACACTCCCAGGCAGCATGTCCGGGGCACCACTTGCGATGGCAGACTCTCTGGGCCAGAACAATAAAGCAACAGCACCGTTTAGGAATTCCTTCAGGCCTCCGACAGCTGATCTCAGAAGATTCCAAGCTAGGGGACGAGGGCGAGGAGATTTTAGAGCTGCAGCATCGACCTCGAGAATTGAACAGCAAATGTCTCTAGGAATGAGCTCGCAGTCCTTGGCCGCCAATTATCATCAAGCTCTACGAGTGGCAAAGACACCGACGGACTTCACTCTCGGCAAGCGACAGCTGAACGGTTCCCGAGTTCCCGACATGTTGTCTGGACATTTAGAGCATGTCCAGAGAGAACGCCAACGACGGGACGACATGAGTGCTAAAATTGCCACACTGGAAACTCTTCTCCCGCCTGCTTCCAAACGGGACAGGGTCTCCATTGTGCACGACGGCATACACTACGTGAGGGCCTTGCAGGAGAAGGTGAAAGCGCTGCAAGGTCAGCTGCAAGAGGCGAAGCGCAGAGCAGAAGCTGGGGCGCAAGATAAGAAATGGTCATGCTTAGGTAGCAGTAGTAACGTGGATTTTGCTAGCAGTAGTAGAAACCTTTCTAGTTCTCGGGCCGTGCTTAACGCCTCGAGGACTTCGGGTAGATTTCGCCTGGGGCCCATGACGAGGACGACATCGACCACTTCTTTCAACATAGGTGGCACTCAGAGCGGCCGGGCTGAATTCGAAGGAAGCGGTGGCTTCTCAGATTCACCATTGCTGGGTCTAACGCCTAAAAGCGAACCTCTTCCAAGCCGCGGTCCAATTTCTGTGGAGCTTCACGTGCAAGTAGACAGACCGGGTGAACAGGTGCAAGTTGTCAAGTGTGAATGCAGATATAGCTACTTGAGCAGTGTCATGAGAACTCTCGACCAGCTGCAGCTGAGTCTCCACCGGTGCAGTGTTACGAAGCTGCATGACTACGTGATCTGCGTCATAGTAATTAAGCCAACTTCAAATTGCTCTACTGCTCACGCTGTTTCGTCGGCCCAAATAGCAACTCTGTTGAAGATAGCTGCTGTGGACTCCTGAGAAAGCATTCCTGTGAACAGTTTTATTGGAATGGCTACATCGGCTTTTGGAACAATCCATGGCTAGTTAGCCATCCACTGGAAGAAAACGTATTTAGTACTAAGTGACATTGTCCCTCTCAGTACGTTGAGCATTGTTCATCTGCACATTTCACGTTCCAGATAAAAAGGCATGCGCAGGAAGCGGTATCGAATCTGCTGAACCTGGCGCAATTGGGTTGCAATTTAGAAAAGCTGGGGCCACTCCTCTTATAGAGTGCGTTTAAATCCTGGAGGTCAAATAGAGAACAATGATCTCACATGTAGATTCGCATTTATTCTTTCGATACTTTATAATAGTGTATCTGTTCGAGCCAAGAAATTAATAGAATGGA

CDS

>Mapoly0035s0146.2
ATGTCATCGGTTGTCTTCGTTGCCCAAGACGCGCTAGAGTACAGGTCCCGAATTATGTCCGAGTTCTCGTCAGGAGCATTCAAACCATTTGGAAGTGGTGCTCAGTTCGTTTTGCCCCAGCAGAAATTCGGCGTCCGAGCACCAGCAGCCGAAGACGAGAGCTATCAGGATGTTAAATGGAGGGTCCAGGACAACATGCCCATGGACGGGGATAGTTCCGACCACTCCGGTTTCCGCTCATGGCCAGATTCAGCGCTGTCGCTGTCATCGTCGTCGTCTGCGCATGCCTCAGCACCATGCGCCACATTTGATCATTTCAACGTGAACGAGCACGAAAATGTTGTGGTGAATGAGATGTTCTCGTCACGCGAGGCTCCTGCTTATGAACCGTCGATGCCTCACAGCCTGAACTTGCAGTACCTCGGCAGCAGCAGCCCAGCGCAGTTAGACGAGCTCTATGGCGGTTATCATGGTGGAAGATGGCAAGCAGCTCCAGATCCAAACGGCCCTTGCAACAGCAGTGATGTGCTGGTTGTTGTACCCGGGAACACGCAAGACACAACAAAACCTCTTACCTATCACTTGGCCTCCTCCAACACTTCATGCGACAGTTCTGCGGATTCGTTTAGCTTTCAAAAATTTAGCCCACATTCGACAAGGCTCTCAGCAGCCTCAGGGACACTCCCAGGCAGCATGTCCGGGGCACCACTTGCGATGGCAGACTCTCTGGGCCAGAACAATAAAGCAACAGCACCGTTTAGGAATTCCTTCAGGCCTCCGACAGCTGATCTCAGAAGATTCCAAGCTAGGGGACGAGGGCGAGGAGATTTTAGAGCTGCAGCATCGACCTCGAGAATTGAACAGCAAATGTCTCTAGGAATGAGCTCGCAGTCCTTGGCCGCCAATTATCATCAAGCTCTACGAGTGGCAAAGACACCGACGGACTTCACTCTCGGCAAGCGACAGCTGAACGGTTCCCGAGTTCCCGACATGTTGTCTGGACATTTAGAGCATGTCCAGAGAGAACGCCAACGACGGGACGACATGAGTGCTAAAATTGCCACACTGGAAACTCTTCTCCCGCCTGCTTCCAAACGGGACAGGGTCTCCATTGTGCACGACGGCATACACTACGTGAGGGCCTTGCAGGAGAAGGTGAAAGCGCTGCAAGGTCAGCTGCAAGAGGCGAAGCGCAGAGCAGAAGCTGGGGCGCAAGATAAGAAATGGTCATGCTTAGGTAGCAGTAGTAACGTGGATTTTGCTAGCAGTAGTAGAAACCTTTCTAGTTCTCGGGCCGTGCTTAACGCCTCGAGGACTTCGGGTAGATTTCGCCTGGGGCCCATGACGAGGACGACATCGACCACTTCTTTCAACATAGGTGGCACTCAGAGCGGCCGGGCTGAATTCGAAGGAAGCGGTGGCTTCTCAGATTCACCATTGCTGGGTCTAACGCCTAAAAGCGAACCTCTTCCAAGCCGCGGTCCAATTTCTGTGGAGCTTCACGTGCAAGTAGACAGACCGGGTGAACAGGTGCAAGTTGTCAAGTGTGAATGCAGATATAGCTACTTGAGCAGTGTCATGAGAACTCTCGACCAGCTGCAGCTGAGTCTCCACCGGTGCAGTGTTACGAAGCTGCATGACTACGTGATCTGCGTCATAGTAATTAAGCCAACTTCAAATTGCTCTACTGCTCACGCTGTTTCGTCGGCCCAAATAGCAACTCTGTTGAAGATAGCTGCTGTGGACTCCTGA

Protein

>Mapoly0035s0146.2
MSSVVFVAQDALEYRSRIMSEFSSGAFKPFGSGAQFVLPQQKFGVRAPAAEDESYQDVKWRVQDNMPMDGDSSDHSGFRSWPDSALSLSSSSSAHASAPCATFDHFNVNEHENVVVNEMFSSREAPAYEPSMPHSLNLQYLGSSSPAQLDELYGGYHGGRWQAAPDPNGPCNSSDVLVVVPGNTQDTTKPLTYHLASSNTSCDSSADSFSFQKFSPHSTRLSAASGTLPGSMSGAPLAMADSLGQNNKATAPFRNSFRPPTADLRRFQARGRGRGDFRAAASTSRIEQQMSLGMSSQSLAANYHQALRVAKTPTDFTLGKRQLNGSRVPDMLSGHLEHVQRERQRRDDMSAKIATLETLLPPASKRDRVSIVHDGIHYVRALQEKVKALQGQLQEAKRRAEAGAQDKKWSCLGSSSNVDFASSSRNLSSSRAVLNASRTSGRFRLGPMTRTTSTTSFNIGGTQSGRAEFEGSGGFSDSPLLGLTPKSEPLPSRGPISVELHVQVDRPGEQVQVVKCECRYSYLSSVMRTLDQLQLSLHRCSVTKLHDYVICVIVIKPTSNCSTAHAVSSAQIATLLKIAAVDS

Mapoly0035s0146.3  

Gene structure:

mRNA scaffold_35:1536958..1541234  ( - strand )
three_prime_UTR scaffold_35:1536958..1537330  ( - strand )
CDS scaffold_35:1537331..1537414  ( - strand )
CDS scaffold_35:1537917..1538489  ( - strand )
CDS scaffold_35:1538990..1540084  ( - strand )
five_prime_UTR scaffold_35:1540085..1540177  ( - strand )
five_prime_UTR scaffold_35:1540763..1541234  ( - strand )

Sequences:

Gene

>Mapoly0035s0146.3
ACCATTCTGATTTCATCCCGAAACGTACTAGTTTGTGTGACGTGCAATCATAGAAGGGCGCTATGTCTACTCCCCGTGAAACCTATCGAGGCTGTATTTGCACCGGTGGTGTCACGGCGTGCGCAACTAGTGTGGTGGAGAAATTGCTAGAAAGCTTCCCACGCAGGCCCAGGGTTTTTGGAACCGGGCATCTAGTCTTGCGAGAAGAGCTTCATCTGCCTTTCTATCCGGCTTTTTAGTTCCAGTGCACTAGAACTAAAATACACAGTTGCGCCTTCTCCGTCAACGCGACGCGTCTCGTTCCCTCTCATTTAAGCTTTCTTACTTCATCTCGATCTGGTGTTCCTCACAAACCACAAGACTACGCTCTCTCTCTCTTCATCTCTCTCTCCGGCGTAGATATCTTCGTGTCGTGACTGAGTCCGATCTGGGTCACGCAGTGCTGAAATTCGAGGAACATATACGTCCAATTGTAAGATCTTGCAATCACCTCGAAGATCTGGCCATTGGAGTTCTTCGGCTTGTTGATAGTGTCATGGTAGTCTGAACCTTTCGCGGTCCGGGTAGATATCCATACCTCTAATATCTCTGTTGAGCTGTCATCGTTCAAAGGAGTATCTCCGCCAGGTGCAGCAGGTTAGACTAGGCTTCCAGAGGGAAGGAGGGAGGGACGCACTGATCTAAACACATGCATAGACGTCTCGAGCTTGTTGATTCACAGCAGATGATGTTCAAGAAATGCTCGTCAAGCATACACTTTTGGTACTCGAAATTAGAGTTGCATTGAAATTCACCTTCCCGGTCCATATCCATAGAGACCAAATTGTTATGTCCAATCCTGTACACTCAGGCGAATGCGAGCTTGGGAAATGTAAATTTACAGCTCAAATCAACATGCCAAGCATAGGATCAATAGGAGGAAACTATAATTCTTCGTTAAGCCGAATGTGTTTGGAGCTGAGATTGTCCTTTGCAGCTGTGTATCGAGCAGTCGTGAAGCAGATGAATTCACACTAACTGGTTTTCGTCGGTTGTTTGGTGGGCCTGGCGTGTGCAGTGATCTGATCTAGACCACTGGGGCTTCAATTGGAGGAAACGGCCCTCAGCTTCTTTAGCGGATGACTTATGTTGGTGCAAGGCGGTGGTCATCATGTCATCGGTTGTCTTCGTTGCCCAAGACGCGCTAGAGTACAGGTCCCGAATTATGTCCGAGTTCTCGTCAGGAGCATTCAAACCATTTGGAAGTGGTGCTCAGTTCGTTTTGCCCCAGCAGAAATTCGGCGTCCGAGCACCAGCAGCCGAAGACGAGAGCTATCAGGATGTTAAATGGAGGGTCCAGGACAACATGCCCATGGACGGGGATAGTTCCGACCACTCCGGTTTCCGCTCATGGCCAGATTCAGCGCTGTCGCTGTCATCGTCGTCGTCTGCGCATGCCTCAGCACCATGCGCCACATTTGATCATTTCAACGTGAACGAGCACGAAAATGTTGTGGTGAATGAGATGTTCTCGTCACGCGAGGCTCCTGCTTATGAACCGTCGATGCCTCACAGCCTGAACTTGCAGTACCTCGGCAGCAGCAGCCCAGCGCAGTTAGACGAGCTCTATGGCGGTTATCATGGTGGAAGATGGCAAGCAGCTCCAGATCCAAACGGCCCTTGCAACAGCAGTGATGTGCTGGTTGTTGTACCCGGGAACACGCAAGACACAACAAAACCTCTTACCTATCACTTGGCCTCCTCCAACACTTCATGCGACAGTTCTGCGGATTCGTTTAGCTTTCAAAAATTTAGCCCACATTCGACAAGGCTCTCAGCAGCCTCAGGGACACTCCCAGGCAGCATGTCCGGGGCACCACTTGCGATGGCAGACTCTCTGGGCCAGAACAATAAAGCAACAGCACCGTTTAGGAATTCCTTCAGGCCTCCGACAGCTGATCTCAGAAGATTCCAAGCTAGGGGACGAGGGCGAGGAGATTTTAGAGCTGCAGCATCGACCTCGAGAATTGAACAGCAAATGTCTCTAGGAATGAGCTCGCAGTCCTTGGCCGCCAATTATCATCAAGCTCTACGAGTGGCAAAGACACCGACGGACTTCACTCTCGGCAAGCGACAGCTGAACGGTTCCCGAGTTCCCGACATGTTGTCTGGACATTTAGAGCATGTCCAGAGAGAACGCCAACGACGGGACGACATGAGTGCTAAAATTGCCACACTGGAAACTCTTCTCCCGCCTGCTTCCAAAGTTTGTTCCTTTCCCAAGGCGTCGTCCATTTGTTCTTCTTTTTAAATGCTCAGCTCAGTTCAGCTGAGGGTCCATTTCAGGCTCATGATAAGGACAGTCTCATGATCCAGTTCTCATCCGCCGTGCTTGAGTACGGAGCAGCTGACATCTGACACGTAGATAATTTCCGGCATGTATGGATGTACGTAGCGGAAGATCATGAGTTGCAATTGTGCCAAGGTGCAAATCCAATCTCCGCACCTCGGCACAATGCATTATGGTCTGAGCAGACCTTGCACTCTCTAGGTGCTGGCTGGAATTGTCATATCCAAATGCAATATGCTCGAGCCAAAAGTTGTGATGATCTCGTTCCTAGATCATCACTACTAAAATAGACGTCACGAGTCTAACTTTCCACATCTGACCTCTCGTGCGAGTGCGAGCGAGTGAGTGAGGAAGGCTCAGGATGAAGTCCAGTGCAGGAATGTTGATTCCCTTTGCAAATTTGTCGGTGTTTGCAGCGGGACAGGGTCTCCATTGTGCACGACGGCATACACTACGTGAGGGCCTTGCAGGAGAAGGTGAAAGCGCTGCAAGGTCAGCTGCAAGAGGCGAAGCGCAGAGCAGAAGCTGGGGCGCAAGATAAGAAATGGTCATGCTTAGGTAGCAGTAGTAACGTGGATTTTGCTAGCAGTAGTAGAAACCTTTCTAGTTCTCGGGCCGTGCTTAACGCCTCGAGGACTTCGGGTAGATTTCGCCTGGGGCCCATGACGAGGACGACATCGACCACTTCTTTCAACATAGGTGGCACTCAGAGCGGCCGGGCTGAATTCGAAGGAAGCGGTGGCTTCTCAGATTCACCATTGCTGGGTCTAACGCCTAAAAGCGAACCTCTTCCAAGCCGCGGTCCAATTTCTGTGGAGCTTCACGTGCAAGTAGACAGACCGGGTGAACAGGTGCAAGTTGTCAAGTGTGAATGCAGATATAGCTACTTGAGCAGTGTCATGAGAACTCTCGACCAGCTGCAGCTGAGTCTCCACCGGTGCAGTGTTACGAAGCTGCATGACTACGTGATCTGCGTCATAGTAATTAAGGTTCAAACGAGAACTTTAACTCCAACTGTGCTTGAACCTTGCATGATTTGCCTTCTAGAAATTTCGACAGCCACATGCACCAAGTTTCGTCCAGAAAGTAATATGGACCCTGAATTGCCTTCACTGCGTCGCACTCACCTTCTATCTTTGATGATTTACTCCCATTACTTGCTGTTACTTGGAATTGTGAGACCTCCTCTGAGGCCAAGTTCCAAAGCTGGTAGAGAGTTTGATGGTGCATATTTACGGTGTTGGACTCCACATACAGTAGTGAGTCAGTAACCCTTGCAGTCTTTCCTGAAACGTAGACAGCTAGCTCAAATGCGTGTAGCTGCCACATTGGAAGTTTCACTCCTGTAAGTTTCCCTTACGGAAAAGAAGTTTCACTAACTTCCAAAGAAGTGAAACTTACTCTAGAGCTGGCATAAGATAGCTGCAACTTACTCTATTTATTGCTAACACACTGTTTCGGTTGTGGTTGTGTGTTGGGGTTTGTGTGCAGCCAACTTCAAATTGCTCTACTGCTCACGCTGTTTCGTCGGCCCAAATAGCAACTCTGTTGAAGATAGCTGCTGTGGACTCCTGAGAAAGCATTCCTGTGAACAGTTTTATTGGAATGGCTACATCGGCTTTTGGAACAATCCATGGCTAGTTAGCCATCCACTGGAAGAAAACGTATTTAGTACTAAGTGACATTGTCCCTCTCAGTACGTTGAGCATTGTTCATCTGCACATTTCACGTTCCAGATAAAAAGGCATGCGCAGGAAGCGGTATCGAATCTGCTGAACCTGGCGCAATTGGGTTGCAATTTAGAAAAGCTGGGGCCACTCCTCTTATAGAGTGCGTTTAAATCCTGGAGGTCAAATAGAGAACAATGATCTCACATGTAGATTCGCATTTATTCTTTCGATACTTTATAATAGTGTATCTGTTCGAGCCAAGAAATTAATAGAATGGA

mRNA

>Mapoly0035s0146.3
ACCATTCTGATTTCATCCCGAAACGTACTAGTTTGTGTGACGTGCAATCATAGAAGGGCGCTATGTCTACTCCCCGTGAAACCTATCGAGGCTGTATTTGCACCGGTGGTGTCACGGCGTGCGCAACTAGTGTGGTGGAGAAATTGCTAGAAAGCTTCCCACGCAGGCCCAGGGTTTTTGGAACCGGGCATCTAGTCTTGCGAGAAGAGCTTCATCTGCCTTTCTATCCGGCTTTTTAGTTCCAGTGCACTAGAACTAAAATACACAGTTGCGCCTTCTCCGTCAACGCGACGCGTCTCGTTCCCTCTCATTTAAGCTTTCTTACTTCATCTCGATCTGGTGTTCCTCACAAACCACAAGACTACGCTCTCTCTCTCTTCATCTCTCTCTCCGGCGTAGATATCTTCGTGTCGTGACTGAGTCCGATCTGGGTCACGCAGTGCTGAAATTCGAGGAACATATACGTCCAATTTGATCTGATCTAGACCACTGGGGCTTCAATTGGAGGAAACGGCCCTCAGCTTCTTTAGCGGATGACTTATGTTGGTGCAAGGCGGTGGTCATCATGTCATCGGTTGTCTTCGTTGCCCAAGACGCGCTAGAGTACAGGTCCCGAATTATGTCCGAGTTCTCGTCAGGAGCATTCAAACCATTTGGAAGTGGTGCTCAGTTCGTTTTGCCCCAGCAGAAATTCGGCGTCCGAGCACCAGCAGCCGAAGACGAGAGCTATCAGGATGTTAAATGGAGGGTCCAGGACAACATGCCCATGGACGGGGATAGTTCCGACCACTCCGGTTTCCGCTCATGGCCAGATTCAGCGCTGTCGCTGTCATCGTCGTCGTCTGCGCATGCCTCAGCACCATGCGCCACATTTGATCATTTCAACGTGAACGAGCACGAAAATGTTGTGGTGAATGAGATGTTCTCGTCACGCGAGGCTCCTGCTTATGAACCGTCGATGCCTCACAGCCTGAACTTGCAGTACCTCGGCAGCAGCAGCCCAGCGCAGTTAGACGAGCTCTATGGCGGTTATCATGGTGGAAGATGGCAAGCAGCTCCAGATCCAAACGGCCCTTGCAACAGCAGTGATGTGCTGGTTGTTGTACCCGGGAACACGCAAGACACAACAAAACCTCTTACCTATCACTTGGCCTCCTCCAACACTTCATGCGACAGTTCTGCGGATTCGTTTAGCTTTCAAAAATTTAGCCCACATTCGACAAGGCTCTCAGCAGCCTCAGGGACACTCCCAGGCAGCATGTCCGGGGCACCACTTGCGATGGCAGACTCTCTGGGCCAGAACAATAAAGCAACAGCACCGTTTAGGAATTCCTTCAGGCCTCCGACAGCTGATCTCAGAAGATTCCAAGCTAGGGGACGAGGGCGAGGAGATTTTAGAGCTGCAGCATCGACCTCGAGAATTGAACAGCAAATGTCTCTAGGAATGAGCTCGCAGTCCTTGGCCGCCAATTATCATCAAGCTCTACGAGTGGCAAAGACACCGACGGACTTCACTCTCGGCAAGCGACAGCTGAACGGTTCCCGAGTTCCCGACATGTTGTCTGGACATTTAGAGCATGTCCAGAGAGAACGCCAACGACGGGACGACATGAGTGCTAAAATTGCCACACTGGAAACTCTTCTCCCGCCTGCTTCCAAACGGGACAGGGTCTCCATTGTGCACGACGGCATACACTACGTGAGGGCCTTGCAGGAGAAGGTGAAAGCGCTGCAAGGTCAGCTGCAAGAGGCGAAGCGCAGAGCAGAAGCTGGGGCGCAAGATAAGAAATGGTCATGCTTAGGTAGCAGTAGTAACGTGGATTTTGCTAGCAGTAGTAGAAACCTTTCTAGTTCTCGGGCCGTGCTTAACGCCTCGAGGACTTCGGGTAGATTTCGCCTGGGGCCCATGACGAGGACGACATCGACCACTTCTTTCAACATAGGTGGCACTCAGAGCGGCCGGGCTGAATTCGAAGGAAGCGGTGGCTTCTCAGATTCACCATTGCTGGGTCTAACGCCTAAAAGCGAACCTCTTCCAAGCCGCGGTCCAATTTCTGTGGAGCTTCACGTGCAAGTAGACAGACCGGGTGAACAGGTGCAAGTTGTCAAGTGTGAATGCAGATATAGCTACTTGAGCAGTGTCATGAGAACTCTCGACCAGCTGCAGCTGAGTCTCCACCGGTGCAGTGTTACGAAGCTGCATGACTACGTGATCTGCGTCATAGTAATTAAGCCAACTTCAAATTGCTCTACTGCTCACGCTGTTTCGTCGGCCCAAATAGCAACTCTGTTGAAGATAGCTGCTGTGGACTCCTGAGAAAGCATTCCTGTGAACAGTTTTATTGGAATGGCTACATCGGCTTTTGGAACAATCCATGGCTAGTTAGCCATCCACTGGAAGAAAACGTATTTAGTACTAAGTGACATTGTCCCTCTCAGTACGTTGAGCATTGTTCATCTGCACATTTCACGTTCCAGATAAAAAGGCATGCGCAGGAAGCGGTATCGAATCTGCTGAACCTGGCGCAATTGGGTTGCAATTTAGAAAAGCTGGGGCCACTCCTCTTATAGAGTGCGTTTAAATCCTGGAGGTCAAATAGAGAACAATGATCTCACATGTAGATTCGCATTTATTCTTTCGATACTTTATAATAGTGTATCTGTTCGAGCCAAGAAATTAATAGAATGGA

CDS

>Mapoly0035s0146.3
ATGTCATCGGTTGTCTTCGTTGCCCAAGACGCGCTAGAGTACAGGTCCCGAATTATGTCCGAGTTCTCGTCAGGAGCATTCAAACCATTTGGAAGTGGTGCTCAGTTCGTTTTGCCCCAGCAGAAATTCGGCGTCCGAGCACCAGCAGCCGAAGACGAGAGCTATCAGGATGTTAAATGGAGGGTCCAGGACAACATGCCCATGGACGGGGATAGTTCCGACCACTCCGGTTTCCGCTCATGGCCAGATTCAGCGCTGTCGCTGTCATCGTCGTCGTCTGCGCATGCCTCAGCACCATGCGCCACATTTGATCATTTCAACGTGAACGAGCACGAAAATGTTGTGGTGAATGAGATGTTCTCGTCACGCGAGGCTCCTGCTTATGAACCGTCGATGCCTCACAGCCTGAACTTGCAGTACCTCGGCAGCAGCAGCCCAGCGCAGTTAGACGAGCTCTATGGCGGTTATCATGGTGGAAGATGGCAAGCAGCTCCAGATCCAAACGGCCCTTGCAACAGCAGTGATGTGCTGGTTGTTGTACCCGGGAACACGCAAGACACAACAAAACCTCTTACCTATCACTTGGCCTCCTCCAACACTTCATGCGACAGTTCTGCGGATTCGTTTAGCTTTCAAAAATTTAGCCCACATTCGACAAGGCTCTCAGCAGCCTCAGGGACACTCCCAGGCAGCATGTCCGGGGCACCACTTGCGATGGCAGACTCTCTGGGCCAGAACAATAAAGCAACAGCACCGTTTAGGAATTCCTTCAGGCCTCCGACAGCTGATCTCAGAAGATTCCAAGCTAGGGGACGAGGGCGAGGAGATTTTAGAGCTGCAGCATCGACCTCGAGAATTGAACAGCAAATGTCTCTAGGAATGAGCTCGCAGTCCTTGGCCGCCAATTATCATCAAGCTCTACGAGTGGCAAAGACACCGACGGACTTCACTCTCGGCAAGCGACAGCTGAACGGTTCCCGAGTTCCCGACATGTTGTCTGGACATTTAGAGCATGTCCAGAGAGAACGCCAACGACGGGACGACATGAGTGCTAAAATTGCCACACTGGAAACTCTTCTCCCGCCTGCTTCCAAACGGGACAGGGTCTCCATTGTGCACGACGGCATACACTACGTGAGGGCCTTGCAGGAGAAGGTGAAAGCGCTGCAAGGTCAGCTGCAAGAGGCGAAGCGCAGAGCAGAAGCTGGGGCGCAAGATAAGAAATGGTCATGCTTAGGTAGCAGTAGTAACGTGGATTTTGCTAGCAGTAGTAGAAACCTTTCTAGTTCTCGGGCCGTGCTTAACGCCTCGAGGACTTCGGGTAGATTTCGCCTGGGGCCCATGACGAGGACGACATCGACCACTTCTTTCAACATAGGTGGCACTCAGAGCGGCCGGGCTGAATTCGAAGGAAGCGGTGGCTTCTCAGATTCACCATTGCTGGGTCTAACGCCTAAAAGCGAACCTCTTCCAAGCCGCGGTCCAATTTCTGTGGAGCTTCACGTGCAAGTAGACAGACCGGGTGAACAGGTGCAAGTTGTCAAGTGTGAATGCAGATATAGCTACTTGAGCAGTGTCATGAGAACTCTCGACCAGCTGCAGCTGAGTCTCCACCGGTGCAGTGTTACGAAGCTGCATGACTACGTGATCTGCGTCATAGTAATTAAGCCAACTTCAAATTGCTCTACTGCTCACGCTGTTTCGTCGGCCCAAATAGCAACTCTGTTGAAGATAGCTGCTGTGGACTCCTGA

Protein

>Mapoly0035s0146.3
MSSVVFVAQDALEYRSRIMSEFSSGAFKPFGSGAQFVLPQQKFGVRAPAAEDESYQDVKWRVQDNMPMDGDSSDHSGFRSWPDSALSLSSSSSAHASAPCATFDHFNVNEHENVVVNEMFSSREAPAYEPSMPHSLNLQYLGSSSPAQLDELYGGYHGGRWQAAPDPNGPCNSSDVLVVVPGNTQDTTKPLTYHLASSNTSCDSSADSFSFQKFSPHSTRLSAASGTLPGSMSGAPLAMADSLGQNNKATAPFRNSFRPPTADLRRFQARGRGRGDFRAAASTSRIEQQMSLGMSSQSLAANYHQALRVAKTPTDFTLGKRQLNGSRVPDMLSGHLEHVQRERQRRDDMSAKIATLETLLPPASKRDRVSIVHDGIHYVRALQEKVKALQGQLQEAKRRAEAGAQDKKWSCLGSSSNVDFASSSRNLSSSRAVLNASRTSGRFRLGPMTRTTSTTSFNIGGTQSGRAEFEGSGGFSDSPLLGLTPKSEPLPSRGPISVELHVQVDRPGEQVQVVKCECRYSYLSSVMRTLDQLQLSLHRCSVTKLHDYVICVIVIKPTSNCSTAHAVSSAQIATLLKIAAVDS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>