Mapoly0036s0107



Description

myb proto-oncogene protein, plant

Reference DB

Database ID Description
GO GO:0003682 Chromatin binding
KEGGORTH K09422 Myb proto-oncogene protein, plant
KOG KOG0048 Transcription factor, Myb superfamily
OrthoMCL OG5_127030
PFAM PF00249 Myb-like DNA-binding domain
PFAM PF13921 Myb-like DNA-binding domain
PANTHER PTHR10641 MYB-LIKE DNA-BINDING PROTEIN MYB
PANTHER PTHR10641:SF221

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp3R-MYB1 transcription factor, MYB Mapoly0036s0107.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0036s0107.1 scaffold_36:982545..990958  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0036s0107.1  

Gene structure:

mRNA scaffold_36:982545..990958  ( - strand )
three_prime_UTR scaffold_36:982545..983606  ( - strand )
CDS scaffold_36:983607..983789  ( - strand )
CDS scaffold_36:984254..984517  ( - strand )
CDS scaffold_36:984901..985000  ( - strand )
CDS scaffold_36:985221..985600  ( - strand )
CDS scaffold_36:985778..987602  ( - strand )
CDS scaffold_36:987849..987977  ( - strand )
CDS scaffold_36:988088..988191  ( - strand )
CDS scaffold_36:988307..988401  ( - strand )
CDS scaffold_36:988845..988902  ( - strand )
CDS scaffold_36:989246..989300  ( - strand )
CDS scaffold_36:989565..989698  ( - strand )
five_prime_UTR scaffold_36:989699..990958  ( - strand )

Sequences:

Gene

>Mapoly0036s0107.1
CCCGAGGCAAGCGCGAGCCAGGTTCGGGAGCCGGGCGCTACTGAAACGGAGCAGCTAGGGTTTGGCACCATACGTGCGAGGTGCCACGATGCACACCCCCAACGGCTAAGTGTCGCGCGTGCGTACTTGAGGAAAATTTGAATTCGGGCTTAAGAGTAATATGGGGTAGCTTTAGGTAGGCAGATCGCTCGTCGCAGGAGCGTCGCCGGGCCTTGCCTTCGTTCCTTCGTTCGTTGCGCTGATCGATTTCCATTTTCCACGAGCGATACGAAACGGACCGAAACGACGAGGTCGAGGGCGACGAAGAAGAGGAAGAGAGCGGGCGCGGTAGTGGTGTAGATTAGGGTCGATGGTTGGCAAGCAACCAGGCAAGGTTGTCGAGAGAAAGATTGTGTGAAAGGGTCTTCTTCTCTCTGCGAAGCGCAACGGACAGCTCTGCGACGACCTCCTCGTTCGGTCGGAAGGGGTGGTGGTGCTTGTGGGTTGTAGGGCTTTGTAGCATCTGCTCGGCCGCGCTACGGAGCGCTCGTTCGTCGTTGGTGTTTTTGATTTGGATACAAGGACTGGGGGAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAACGGTCTTGCGTTGAGGAGGGCCGAGGAGAGGCGGTGGGCAGGGCGGGGGAGGGCAGGGGGTTGCAAGGAGAGAAGTCGGAAAAGTCGGTTGCAGATTTTTGAAACGGACCGAGGAAATGAGTGAACCGGTATATTGTCTCAACGTTCGACGATGGAGAGGTGTAAGAGGCAAAAGCAAGCACGAGGAGGGTCGAAGGAAAGAATGTTTTCTGTCACTGATGCGTTAGCTTTGGATACGTAGAGATTCACAGGAAGGGGCATCGACTACAAGGATGAGTCAATGGGAACAAAAGCATAGAAGAGGTGTTGTAAGTAGTATAAAGTGGCGGATACTGAGGTTGTCGGGATCGAAGACAGGGGTGGAGTTTCGTGTGGTTAGAGCAGGTAGGCATGCGACTAGTTGACATACAGAGGCAACAGCAAGTGGTTAGAACTTGGTCGAGTAGATTGTCATTAAAGGTTACCCGTGCAGGTACAGACCGGAAGATATCCCCAGCTTCTTAATCTGCAACTGCAGCACATTGTAGCAGGTTGCTGAGCAGAAGAAAGAGGGCCTAATTTGTAAAATACAGGAAATTGCAGGGAGAGGGAATAATGCTGAGGTTTTTGATTGTTGGCCAAGCGGTGCGAGAGGCGTTAGGAGCTTCCGGGTCTAAGATATGTTTATGATTCGAGCTGGGGGAGCTATGGCTACTCAGGACTCTCAGAATAAGATGCGCACAGGTCCTGTTCCCAGTTCGTCGGGAGCAGAATCGGAGGACGATGCTATTCATCAGTTACCTCCTGTGCATGGGTGAGCGTTCTCTCTGTTTGTCAGTATGTCCTCCTTTCTTTGAGCATACATTTTTTCTATTCGCACATACACAGAGATTTCGTGCCCTGGACATCTGTTATAGAAGATTAGGAATCAAATAAAATCTCAAATCTGGAGGGAAGGTTGATGAGAGTTCCAGCTTCTATTCTAATTGAGGGCAGGAGTCCAGATTTTCTCCTCCACTGCCGAGTGTAGTTAAGATCCCAGTGCTGAAAGTTTTGCCAATTGGTTAATGTTGAACAGCCGGACCGGTGGGCCTACCCGGCGATCTTCGAAAGGAGGATGGACGCCGGAGGAGGTATGAGCCGTCAGATTTCCTGTTGTGTTCTATGTCATGGTTGGAAAGACCGCTAGGCTCCTTACTCGATTGATTGATTGATTGACATCTCGTGAAGCCATTTTTGACGGTGCTGAAGACTTCGTTGTGTCAAGGACTTGGAATGCTGAAGGAGATGACCCGGCATATGTTGTGTCGTACTGAGGGCTCTGTCATGATGTTAGTTGATACCGTCTGTCGTGAAGAGGGCCCTCTCACGTCCTTTCACCTGCCTTTCGATACCATGAACTCTCAATGTGTCCAGCGAATGTCACTCTCTGTACACACCCTGTTCTTAAGTGCTGCCAATGTCGATCTGATCCAGGACGAGATTCTTCGGCGAGCTGTGCAGTGTTTCAAAGGGAAGAATTGGAAAAAAATTGGTAAGTTTTTTTCTACATGTCGATGTCCCAAACGTCAGTGATGTATGGATATCTCCTTCTGCTGGCTGCCGGCTATGTCAGGACCAGACTCGCTTAAGTTTACGTATCGCGAGTCTTAGTGTGGATATATTTTTTGTTGAGAGCGTGAGTAATAACACTCGCTCACAATACACTGGGAGTTGTGATACTAGCACTGTTTAGTCTTATATTGCTAGTCATACAGCGAGTCTCATGAGCGTGTTTATCGGAAGACATTATCCGAGGTTAATGTGCCCCTTCGCTTTCTATATCGATGGGTTTGTCTTTCTGTTGTTCTGATTATAAATCTCCTAGATCATTGATGGCAGGATGTTTACTATCAAATGCCAAACTGCAATTGATTTCCTGCTTACCGTCATTATTCTCAATTATTAAGGCCGAGCGGAAACTGTAATTTTTTTCAGCGGAGTTTTTCCAAGATCGAACCGATGTTCAGTGTTTGCACCGATGGCAAAAGGTGCTGAACCCGGACCTTGTTAAGGGTCCTTGGACAAAAGAGGTACGAAGTACTGATCTGTTAGACCTTCTTCTGAAATCTTCTGGTATGCTTCAGATCCATTTGACATGTGTTTTGACAACATCTAACGAGACCAATTTCTGCATTGGTCTGTCAGGAAGACGATCGAATAATGGAGTTGGTTGGCAAGTATGGGGCGAAGAAATGGTCTGTTATCGCTCAGAACTTGCCCGGTAGAATAGGCAAGCAGTGCAGGGAAAGGTAAGCATGAGAGATGAATTTCCATGAAAGGATTGCGTTTGTATCGATCATGCCGCAAATGTTGGAGCTTTCTTGTTCCACTTTACTTACGAGAACCGAGATTGTATCAGATGGCACAATCATCTGAACCCAAACATCAAGAGGGATGCATGGACGCAACAGGAGGACCTGGCTCTGATACACGCTCATCAAATCTATGGAAACAAATGGGCAGAGATTGCCAAATTTCTTCCTGGCAGGTATTATTTTTATGCTTGACATTTTGACCATAATTTTCCTGGGATTAGAAATCTGTTTCTAGGGGGGCGAGACTTCGATGAACGTTGTGTCTTTGCGCTTGCTTGGATGTGGGGTGAATTGAAATAGGTCGCACGACTCCTCAGAAATGTGCAACAGCGGTTCTGTATAGCAATTTGAGTGCATCATAAGCTTACCGTGCAGTGAACGCACAATAATCTCCATGTCTTCATTGGTTTGTCTTGCAGAACGGATAACTCCATAAAAAACCATTGGAACAGTACAATGAAGAAGAAGGTGGATCCTATGTCAGCCACAGATCCTATCTCGAGGGCTTTGGCTGCATATCAAGCACAGCAAGACTCTTTGAAGTCCGGAGGATCCGCGAACTCCGAGCAATCTATGTGTCTGTCGAATACAGTGGACGTCGTTTTGCCATCTACAAGTGGAGTTTCGAATTCGAACTTATCTGCTAGGATAATGGCGTCTTCGACGGTACCACCGTCGGTTCGAACTTGCGATGTAGCAGAAGATTCTGCGGTGGACTCCAAACCTGCTATACAATTGGCTGCCCCAGCAGGATCTCAGGTTCCCGAAAAGGACGATATAAAGGCTGTGAAATCTGGGTCAAGAAAGGAATTAGGCACAGCGTCCAAACCCCCCCTTCTTCCTCCTCCTCCCCCTCCTCGAGCATCATGTGCTGGAAATCCACTCACTCAATCGACCTGTGACACAGTAAACTGCACGCCAATGGCAGTACCAGTTGTTAGCACATCGTCTTCCTCTCTTCAGCGTCAGCCTTCTAGTATCGATGAGAATGTCTGTGTTCCTTCTTCGGTCGAACTTTGCCGTGTTCCCAGTTTTTCCCGAATGTATCCTCTTGCCTGCTCTTTACCTGAAAGCACCACGTGCTCTGGCCAGTCCACTCCTGCTCTTACCTCTCTACCCTTGACGTCCTCTGTTTTTGGAAACGGAACAATGATTGGTGATGTAGATTCTGTATCCGGCTCTGTCATCGAGTCTGTAAACATGATGGCCCAACCTATGACGCCAATGGGATATATGACCTTACACGAATGCCATTACAGCCAACATCAACGAGCAGAAGAATTGTCTGGTCCTTGTTTACCTCCTTACTCGAACAATCAGAAATTGTGTCTGAGGGGTGATATCTCAAAGGTAGGAACAGAGGAGTACTCAGATGAGCTGCTTAAAGCAGCCACACAGGTAGTCAGTGATTACCAGCCTTTGTCCATGTTCGCAGAACTTGAACCAGAAGTTGAAGACACCGAGGGAGATGCCGGATTTTTTTATGAACCTCCACGTCTCCCAAACTCAGACATGCCTTTTCTGAACTACGATCTTATCAGTCCAAACGGCACCTCTCTACAAGCGTACAGTCCTTTGGGAGTTCGGCAAATGATCATGCCTTCTGTCAACTGCTCTACTCCTCCAAGTTATCCCAGTTCTTCTCCATTCAGAGGCGGTAGCCCACAGTCTACGCTGCGAAGAGCTGCTCAAAGTTTTGGGGGAACGCCGTCAATTTTACGGAAAAGGCCCCGGCCACTTGTATCCATCTCACGAGGGAATAAGGAAGGGGAAGCATCTGGGTTACAAGTTCGTGACTCCAATATGAGTGGAGGTTGTGTACAATCATCTGATAATGCTGCTGACATGGCCCATGATTCTGCATGTACAGTGACACCTGATCGAAATACAAGTAATGAAAATTCTTTTTTATGCCGATCATTTGGTTCGGATTCTTTGATGTCTGCCGATATATCTCCTTGTCACGCGAGACGATTTGCTTCCCCTGCCTATGATCTTACCAGCAAGAACCTGATGAAGATCAACAGACTGGAAATTGAGAATGACTTTCAGTCAGGGTCAGGATATCCCTCTCCAGGGAGCAACAGCAGTGGAGGTGCTCATACCAGGACCAAAGGCGGGGATGGTAAGAGCGGAGGATGTGTAAGTGGAATAAAGTGTAATAAGAGGGGAAGATTTCGGGCAATCAATCCGGATTATGAGTCAAAAGCCATCAAGGGAGGAGGAAATCAACCGTCTCCAAAGGTACATGGATATTCTGCCATCTGACCTCGCCACTACTGGTTTTCGCTACTCCATTTGCCACCTAGACAGACATCAGCTTGTGTGTATGTTGAAAACGTAGCTGCGTTTGTCGATATGGCTCGTTATGTCTTTCAGTTGTGTAGGTGTTGATGGCAAGCGTATGTTGTGACTTTGCAGACGCAGGATCTCCCTGTCCTAGTAGAGCAGCGTCAAAATGGTCAACAAGCTTGTTTCTCGGTAGAAGCAAGCTCCATGACATCCTGCGTTTTGATGGCTCCTGGTGCAGAAGCCTATGGTGGAGCCGGTAGTTTTGGGGGGGTCACTGGGAGATATGGATGTTGTGATTCAAAGTCCCAATATGAAGCAGGTCATGTTGGATCACATGCTGCCGTAGTTGGCTCCCAGCCGAAGGGATCCGACAAGAGGGAGAATATGGCTCTGAATTCTGTTTCTTCTTTTAATGCATGGGGCTCAGCAATAAGTCCCACGGTTTCAGGGTCAAATCATGGAGGCAAGGATTGGTTCAACGCACTCGCCGACTTCGACACTTTCAACTTGTATGTTGTTTTCTCTAACTCACCTTTAAATTGTTCTTCCTGAGCCAGTGCTTCTTGAGATTGAAGTTCAAAACTGGTTGCGGTAATTTATGTCCATTAGAGTTGCAGCTGTATCTTGTTTTCTTCTGTCATCCTTTTATCATGCTCTGCACGGTGACTTGTAAATAAAAGTAAGTGTATTGGTAAGCTTTTTTGAAGACTTCTGGCTGTTTTTCGGCAGTGCTTTGAGTGGTGATGGGAATTCTCCGTCTGCCATCTGGAGGTCACCGTGGAAGCTGGATCCTGCCGTACCGAAGGATGGTGTGATGTCTTTGCTGGAGGTTAGTACGTAATGTTTAATGCCTTTTGGTCACATGTTGATGCGGCTTTTGTTCGGCAAATACGTCTTGTTGTCTTCTTTTCAAGAGTTTGAGTTTGATTTAGTTTCCAAAGCCAAATGGTGTGGCTTACATCTTTTCCCGACCGGAGTTGATGTTTCGGGCTGTACTCTTTGACAACTTTCGTAGACTTTGATTTGTAGTCCCCACTTGGTAGTCCAGACTCTTACGTTAGTTGTATCACAGCTAATTGTCATGATGAGCAGTTCAGTTACGTACAACAGAAACCTTTACTCGGTTTACTCGTCTGAACTTGCTTTGTTAGGGTCAAGAACCTCTTTTCTAAAACTGATTTTCTAATAATTACCTCTACTTCACGCCGTCAGGGTATGGATATGCTTGTGGAAGACGGATCAGACGATGCTTTAGGGATCATGAAGCATATTAGTGAGCACGCTGCGCCTGCTTATTCTGAAGCTCAAGAGGTTTTAGCAAAATCCGTTCTTATGGAGTGCCATGGTCGCGCGGCTTCTCCGAATCCCGTTCACAGATCTCGCCAGGAAGGATCCAATGAGTACAAAGAGAATGTGAGAAGCATGAACGAGCACGTTGATAATTGCCCGTCATCACCTTTTGTCAGCTGGATTGTGGTATGTGCTATTCTCTCTGCACCTCTGGGCATTTTAGCTCAAAATCTTGAGAAGTTTTCAGGATCAAAAGAGGATTTTGCCTATCTAGAATCTGGACCCACAGAGGCTCCTAAGTAGATACAGGTTGGAATGCTGTTTATTGTCTAACCGACATATTTCAGTAGATCTTTGTTTACAACTGTCGCAGTTCTGCTGAATGTGTGTATGAGTTGTGTCTTTCTCTACTAAATTCACTGAAATTATTCTAGTAAAGTGAATTTTTTATGACCTTAGGCAAGGTCGAGTCGTTGTGCCTCAGGTTTGGAATTATGTTTGGTTGATTTTGAGCGCCAGCTCCAGTCCGGCTAGTTCAGTTGATTTTGAATCATAATTTTTTGTTTTATTTATTTATATGGGTAATGTTCGTGCAACACGAGATGATGCATGATGGTCGGGTTAAGTGTTTTGCCGTTGGGGAATTGCAGCCTTTCCCTGCAGAGATGCTGTCACCAGATGCAGCTGCCGGAGGGACCCCATTGCGAGGAAGTTCCTTGGGGCACAGCTTGCAGGTTGCCGGAGGTGTTGACGATAACCAACTGACCTTTGGAGGGGTCAGCATGGTGGATCCTTTCAGCCCTTCTTTGTATCTGCTCAGGGAATGTAGGTAGTTCGTAGTATAGAATATCTTCGGCCAGCCCCTCCATATATATTCTTTATATATGTTTGTAATGTTTTTCAAATAAGGTTTTGGTTAAGAGAAGTTGATCGACATCTGTGTAGCGGTCCCGCTTCTCGTGTTTAGGTTCTATCAGGTGAGTATGTGCTGCACTTTCTTTCCGCGAGACCTCACCCAACTGGAACAGATTGTCGCTGTCGAGAGCTCATAAGGCAGCAACGGATATGTGTGCGGAGAATAATGAGCAGTCTGTGTTTTGATCTCCCAGTTTTGTAGATGAATTTGAATCTAGTAGTATTCTTGGGGCATCCGTGCCGCTGGGGTGTATGTGTATTTTGTGCATCACCTTTCTTTCTGTTCTATCGAAAGACTTAATTTTTTGACGCTGGTAGCTGCTGGCAATTGCTACATTTCGTTTTTTTGTTTTTCCTCACTGGATCTCTTACAAGAATTGTCAGTTGTTAAAATGCATGTAATGAAGTAGCATGTTGGCACACCATAGTTGTGGGATCTGTATGCCATTCAAGAGTGTCTATCATTTTTCGCAGATGAACCACCACTATCTCTTCTGCTTTCAATTCAGAAACTCGCTTTTGTTCGTGAAGCATCCTTGACAACTGATGAACAAAACGTCTATTTGGAGTAATGAAATGGTCAATTAGATAGCTCTTCTTCCCTGGTTCCGGTTGTCGTGTTTTAAGAAACCCGCCTGCCGCGAAAACATATCGAACGAATAAGATTTGTATCAAAGTTAGCTCTTGCGACTCATACTGGTCCTTCTCTACCTTACTGGCCTTCTCGTTGTTCACACAGTTTGTCGTTCACATCACATTCATTGTGAAGATTAGAATTAAACTTCACTTGGCTAAGGCTCCGTCTTCGAGACTTTCATTTCAACCTCGTCTTGAATATACTTCAGCTTCACAATTGTGTATGAAATGAAATATTCGTCGCGATCGCCTTTTCCTCCTTGTGGATGTCCTGAATACCAAAAAGTAGATTTGAAGACTTGCACAGAAACTTACTTGAAAACTGCGTGAGAGACCCGTTGTAC

mRNA

>Mapoly0036s0107.1
CCCGAGGCAAGCGCGAGCCAGGTTCGGGAGCCGGGCGCTACTGAAACGGAGCAGCTAGGGTTTGGCACCATACGTGCGAGGTGCCACGATGCACACCCCCAACGGCTAAGTGTCGCGCGTGCGTACTTGAGGAAAATTTGAATTCGGGCTTAAGAGTAATATGGGGTAGCTTTAGGTAGGCAGATCGCTCGTCGCAGGAGCGTCGCCGGGCCTTGCCTTCGTTCCTTCGTTCGTTGCGCTGATCGATTTCCATTTTCCACGAGCGATACGAAACGGACCGAAACGACGAGGTCGAGGGCGACGAAGAAGAGGAAGAGAGCGGGCGCGGTAGTGGTGTAGATTAGGGTCGATGGTTGGCAAGCAACCAGGCAAGGTTGTCGAGAGAAAGATTGTGTGAAAGGGTCTTCTTCTCTCTGCGAAGCGCAACGGACAGCTCTGCGACGACCTCCTCGTTCGGTCGGAAGGGGTGGTGGTGCTTGTGGGTTGTAGGGCTTTGTAGCATCTGCTCGGCCGCGCTACGGAGCGCTCGTTCGTCGTTGGTGTTTTTGATTTGGATACAAGGACTGGGGGAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAACGGTCTTGCGTTGAGGAGGGCCGAGGAGAGGCGGTGGGCAGGGCGGGGGAGGGCAGGGGGTTGCAAGGAGAGAAGTCGGAAAAGTCGGTTGCAGATTTTTGAAACGGACCGAGGAAATGAGTGAACCGGTATATTGTCTCAACGTTCGACGATGGAGAGGTGTAAGAGGCAAAAGCAAGCACGAGGAGGGTCGAAGGAAAGAATGTTTTCTGTCACTGATGCGTTAGCTTTGGATACGTAGAGATTCACAGGAAGGGGCATCGACTACAAGGATGAGTCAATGGGAACAAAAGCATAGAAGAGGTGTTGTAAGTAGTATAAAGTGGCGGATACTGAGGTTGTCGGGATCGAAGACAGGGGTGGAGTTTCGTGTGGTTAGAGCAGGTAGGCATGCGACTAGTTGACATACAGAGGCAACAGCAAGTGGTTAGAACTTGGTCGAGTAGATTGTCATTAAAGGTTACCCGTGCAGGTACAGACCGGAAGATATCCCCAGCTTCTTAATCTGCAACTGCAGCACATTGTAGCAGGTTGCTGAGCAGAAGAAAGAGGGCCTAATTTGTAAAATACAGGAAATTGCAGGGAGAGGGAATAATGCTGAGGTTTTTGATTGTTGGCCAAGCGGTGCGAGAGGCGTTAGGAGCTTCCGGGTCTAAGATATGTTTATGATTCGAGCTGGGGGAGCTATGGCTACTCAGGACTCTCAGAATAAGATGCGCACAGGTCCTGTTCCCAGTTCGTCGGGAGCAGAATCGGAGGACGATGCTATTCATCAGTTACCTCCTGTGCATGGCCGGACCGGTGGGCCTACCCGGCGATCTTCGAAAGGAGGATGGACGCCGGAGGAGGACGAGATTCTTCGGCGAGCTGTGCAGTGTTTCAAAGGGAAGAATTGGAAAAAAATTGCGGAGTTTTTCCAAGATCGAACCGATGTTCAGTGTTTGCACCGATGGCAAAAGGTGCTGAACCCGGACCTTGTTAAGGGTCCTTGGACAAAAGAGGAAGACGATCGAATAATGGAGTTGGTTGGCAAGTATGGGGCGAAGAAATGGTCTGTTATCGCTCAGAACTTGCCCGGTAGAATAGGCAAGCAGTGCAGGGAAAGATGGCACAATCATCTGAACCCAAACATCAAGAGGGATGCATGGACGCAACAGGAGGACCTGGCTCTGATACACGCTCATCAAATCTATGGAAACAAATGGGCAGAGATTGCCAAATTTCTTCCTGGCAGAACGGATAACTCCATAAAAAACCATTGGAACAGTACAATGAAGAAGAAGGTGGATCCTATGTCAGCCACAGATCCTATCTCGAGGGCTTTGGCTGCATATCAAGCACAGCAAGACTCTTTGAAGTCCGGAGGATCCGCGAACTCCGAGCAATCTATGTGTCTGTCGAATACAGTGGACGTCGTTTTGCCATCTACAAGTGGAGTTTCGAATTCGAACTTATCTGCTAGGATAATGGCGTCTTCGACGGTACCACCGTCGGTTCGAACTTGCGATGTAGCAGAAGATTCTGCGGTGGACTCCAAACCTGCTATACAATTGGCTGCCCCAGCAGGATCTCAGGTTCCCGAAAAGGACGATATAAAGGCTGTGAAATCTGGGTCAAGAAAGGAATTAGGCACAGCGTCCAAACCCCCCCTTCTTCCTCCTCCTCCCCCTCCTCGAGCATCATGTGCTGGAAATCCACTCACTCAATCGACCTGTGACACAGTAAACTGCACGCCAATGGCAGTACCAGTTGTTAGCACATCGTCTTCCTCTCTTCAGCGTCAGCCTTCTAGTATCGATGAGAATGTCTGTGTTCCTTCTTCGGTCGAACTTTGCCGTGTTCCCAGTTTTTCCCGAATGTATCCTCTTGCCTGCTCTTTACCTGAAAGCACCACGTGCTCTGGCCAGTCCACTCCTGCTCTTACCTCTCTACCCTTGACGTCCTCTGTTTTTGGAAACGGAACAATGATTGGTGATGTAGATTCTGTATCCGGCTCTGTCATCGAGTCTGTAAACATGATGGCCCAACCTATGACGCCAATGGGATATATGACCTTACACGAATGCCATTACAGCCAACATCAACGAGCAGAAGAATTGTCTGGTCCTTGTTTACCTCCTTACTCGAACAATCAGAAATTGTGTCTGAGGGGTGATATCTCAAAGGTAGGAACAGAGGAGTACTCAGATGAGCTGCTTAAAGCAGCCACACAGGTAGTCAGTGATTACCAGCCTTTGTCCATGTTCGCAGAACTTGAACCAGAAGTTGAAGACACCGAGGGAGATGCCGGATTTTTTTATGAACCTCCACGTCTCCCAAACTCAGACATGCCTTTTCTGAACTACGATCTTATCAGTCCAAACGGCACCTCTCTACAAGCGTACAGTCCTTTGGGAGTTCGGCAAATGATCATGCCTTCTGTCAACTGCTCTACTCCTCCAAGTTATCCCAGTTCTTCTCCATTCAGAGGCGGTAGCCCACAGTCTACGCTGCGAAGAGCTGCTCAAAGTTTTGGGGGAACGCCGTCAATTTTACGGAAAAGGCCCCGGCCACTTGTATCCATCTCACGAGGGAATAAGGAAGGGGAAGCATCTGGGTTACAAGTTCGTGACTCCAATATGAGTGGAGGTTGTGTACAATCATCTGATAATGCTGCTGACATGGCCCATGATTCTGCATGTACAGTGACACCTGATCGAAATACAAGTAATGAAAATTCTTTTTTATGCCGATCATTTGGTTCGGATTCTTTGATGTCTGCCGATATATCTCCTTGTCACGCGAGACGATTTGCTTCCCCTGCCTATGATCTTACCAGCAAGAACCTGATGAAGATCAACAGACTGGAAATTGAGAATGACTTTCAGTCAGGGTCAGGATATCCCTCTCCAGGGAGCAACAGCAGTGGAGGTGCTCATACCAGGACCAAAGGCGGGGATGGTAAGAGCGGAGGATGTGTAAGTGGAATAAAGTGTAATAAGAGGGGAAGATTTCGGGCAATCAATCCGGATTATGAGTCAAAAGCCATCAAGGGAGGAGGAAATCAACCGTCTCCAAAGACGCAGGATCTCCCTGTCCTAGTAGAGCAGCGTCAAAATGGTCAACAAGCTTGTTTCTCGGTAGAAGCAAGCTCCATGACATCCTGCGTTTTGATGGCTCCTGGTGCAGAAGCCTATGGTGGAGCCGGTAGTTTTGGGGGGGTCACTGGGAGATATGGATGTTGTGATTCAAAGTCCCAATATGAAGCAGGTCATGTTGGATCACATGCTGCCGTAGTTGGCTCCCAGCCGAAGGGATCCGACAAGAGGGAGAATATGGCTCTGAATTCTGTTTCTTCTTTTAATGCATGGGGCTCAGCAATAAGTCCCACGGTTTCAGGGTCAAATCATGGAGGCAAGGATTGGTTCAACGCACTCGCCGACTTCGACACTTTCAACTTTGCTTTGAGTGGTGATGGGAATTCTCCGTCTGCCATCTGGAGGTCACCGTGGAAGCTGGATCCTGCCGTACCGAAGGATGGTGTGATGTCTTTGCTGGAGGGTATGGATATGCTTGTGGAAGACGGATCAGACGATGCTTTAGGGATCATGAAGCATATTAGTGAGCACGCTGCGCCTGCTTATTCTGAAGCTCAAGAGGTTTTAGCAAAATCCGTTCTTATGGAGTGCCATGGTCGCGCGGCTTCTCCGAATCCCGTTCACAGATCTCGCCAGGAAGGATCCAATGAGTACAAAGAGAATGTGAGAAGCATGAACGAGCACGTTGATAATTGCCCGTCATCACCTTTTGTCAGCTGGATTGTGCCTTTCCCTGCAGAGATGCTGTCACCAGATGCAGCTGCCGGAGGGACCCCATTGCGAGGAAGTTCCTTGGGGCACAGCTTGCAGGTTGCCGGAGGTGTTGACGATAACCAACTGACCTTTGGAGGGGTCAGCATGGTGGATCCTTTCAGCCCTTCTTTGTATCTGCTCAGGGAATGTAGGTAGTTCGTAGTATAGAATATCTTCGGCCAGCCCCTCCATATATATTCTTTATATATGTTTGTAATGTTTTTCAAATAAGGTTTTGGTTAAGAGAAGTTGATCGACATCTGTGTAGCGGTCCCGCTTCTCGTGTTTAGGTTCTATCAGGTGAGTATGTGCTGCACTTTCTTTCCGCGAGACCTCACCCAACTGGAACAGATTGTCGCTGTCGAGAGCTCATAAGGCAGCAACGGATATGTGTGCGGAGAATAATGAGCAGTCTGTGTTTTGATCTCCCAGTTTTGTAGATGAATTTGAATCTAGTAGTATTCTTGGGGCATCCGTGCCGCTGGGGTGTATGTGTATTTTGTGCATCACCTTTCTTTCTGTTCTATCGAAAGACTTAATTTTTTGACGCTGGTAGCTGCTGGCAATTGCTACATTTCGTTTTTTTGTTTTTCCTCACTGGATCTCTTACAAGAATTGTCAGTTGTTAAAATGCATGTAATGAAGTAGCATGTTGGCACACCATAGTTGTGGGATCTGTATGCCATTCAAGAGTGTCTATCATTTTTCGCAGATGAACCACCACTATCTCTTCTGCTTTCAATTCAGAAACTCGCTTTTGTTCGTGAAGCATCCTTGACAACTGATGAACAAAACGTCTATTTGGAGTAATGAAATGGTCAATTAGATAGCTCTTCTTCCCTGGTTCCGGTTGTCGTGTTTTAAGAAACCCGCCTGCCGCGAAAACATATCGAACGAATAAGATTTGTATCAAAGTTAGCTCTTGCGACTCATACTGGTCCTTCTCTACCTTACTGGCCTTCTCGTTGTTCACACAGTTTGTCGTTCACATCACATTCATTGTGAAGATTAGAATTAAACTTCACTTGGCTAAGGCTCCGTCTTCGAGACTTTCATTTCAACCTCGTCTTGAATATACTTCAGCTTCACAATTGTGTATGAAATGAAATATTCGTCGCGATCGCCTTTTCCTCCTTGTGGATGTCCTGAATACCAAAAAGTAGATTTGAAGACTTGCACAGAAACTTACTTGAAAACTGCGTGAGAGACCCGTTGTAC

CDS

>Mapoly0036s0107.1
ATGTTTATGATTCGAGCTGGGGGAGCTATGGCTACTCAGGACTCTCAGAATAAGATGCGCACAGGTCCTGTTCCCAGTTCGTCGGGAGCAGAATCGGAGGACGATGCTATTCATCAGTTACCTCCTGTGCATGGCCGGACCGGTGGGCCTACCCGGCGATCTTCGAAAGGAGGATGGACGCCGGAGGAGGACGAGATTCTTCGGCGAGCTGTGCAGTGTTTCAAAGGGAAGAATTGGAAAAAAATTGCGGAGTTTTTCCAAGATCGAACCGATGTTCAGTGTTTGCACCGATGGCAAAAGGTGCTGAACCCGGACCTTGTTAAGGGTCCTTGGACAAAAGAGGAAGACGATCGAATAATGGAGTTGGTTGGCAAGTATGGGGCGAAGAAATGGTCTGTTATCGCTCAGAACTTGCCCGGTAGAATAGGCAAGCAGTGCAGGGAAAGATGGCACAATCATCTGAACCCAAACATCAAGAGGGATGCATGGACGCAACAGGAGGACCTGGCTCTGATACACGCTCATCAAATCTATGGAAACAAATGGGCAGAGATTGCCAAATTTCTTCCTGGCAGAACGGATAACTCCATAAAAAACCATTGGAACAGTACAATGAAGAAGAAGGTGGATCCTATGTCAGCCACAGATCCTATCTCGAGGGCTTTGGCTGCATATCAAGCACAGCAAGACTCTTTGAAGTCCGGAGGATCCGCGAACTCCGAGCAATCTATGTGTCTGTCGAATACAGTGGACGTCGTTTTGCCATCTACAAGTGGAGTTTCGAATTCGAACTTATCTGCTAGGATAATGGCGTCTTCGACGGTACCACCGTCGGTTCGAACTTGCGATGTAGCAGAAGATTCTGCGGTGGACTCCAAACCTGCTATACAATTGGCTGCCCCAGCAGGATCTCAGGTTCCCGAAAAGGACGATATAAAGGCTGTGAAATCTGGGTCAAGAAAGGAATTAGGCACAGCGTCCAAACCCCCCCTTCTTCCTCCTCCTCCCCCTCCTCGAGCATCATGTGCTGGAAATCCACTCACTCAATCGACCTGTGACACAGTAAACTGCACGCCAATGGCAGTACCAGTTGTTAGCACATCGTCTTCCTCTCTTCAGCGTCAGCCTTCTAGTATCGATGAGAATGTCTGTGTTCCTTCTTCGGTCGAACTTTGCCGTGTTCCCAGTTTTTCCCGAATGTATCCTCTTGCCTGCTCTTTACCTGAAAGCACCACGTGCTCTGGCCAGTCCACTCCTGCTCTTACCTCTCTACCCTTGACGTCCTCTGTTTTTGGAAACGGAACAATGATTGGTGATGTAGATTCTGTATCCGGCTCTGTCATCGAGTCTGTAAACATGATGGCCCAACCTATGACGCCAATGGGATATATGACCTTACACGAATGCCATTACAGCCAACATCAACGAGCAGAAGAATTGTCTGGTCCTTGTTTACCTCCTTACTCGAACAATCAGAAATTGTGTCTGAGGGGTGATATCTCAAAGGTAGGAACAGAGGAGTACTCAGATGAGCTGCTTAAAGCAGCCACACAGGTAGTCAGTGATTACCAGCCTTTGTCCATGTTCGCAGAACTTGAACCAGAAGTTGAAGACACCGAGGGAGATGCCGGATTTTTTTATGAACCTCCACGTCTCCCAAACTCAGACATGCCTTTTCTGAACTACGATCTTATCAGTCCAAACGGCACCTCTCTACAAGCGTACAGTCCTTTGGGAGTTCGGCAAATGATCATGCCTTCTGTCAACTGCTCTACTCCTCCAAGTTATCCCAGTTCTTCTCCATTCAGAGGCGGTAGCCCACAGTCTACGCTGCGAAGAGCTGCTCAAAGTTTTGGGGGAACGCCGTCAATTTTACGGAAAAGGCCCCGGCCACTTGTATCCATCTCACGAGGGAATAAGGAAGGGGAAGCATCTGGGTTACAAGTTCGTGACTCCAATATGAGTGGAGGTTGTGTACAATCATCTGATAATGCTGCTGACATGGCCCATGATTCTGCATGTACAGTGACACCTGATCGAAATACAAGTAATGAAAATTCTTTTTTATGCCGATCATTTGGTTCGGATTCTTTGATGTCTGCCGATATATCTCCTTGTCACGCGAGACGATTTGCTTCCCCTGCCTATGATCTTACCAGCAAGAACCTGATGAAGATCAACAGACTGGAAATTGAGAATGACTTTCAGTCAGGGTCAGGATATCCCTCTCCAGGGAGCAACAGCAGTGGAGGTGCTCATACCAGGACCAAAGGCGGGGATGGTAAGAGCGGAGGATGTGTAAGTGGAATAAAGTGTAATAAGAGGGGAAGATTTCGGGCAATCAATCCGGATTATGAGTCAAAAGCCATCAAGGGAGGAGGAAATCAACCGTCTCCAAAGACGCAGGATCTCCCTGTCCTAGTAGAGCAGCGTCAAAATGGTCAACAAGCTTGTTTCTCGGTAGAAGCAAGCTCCATGACATCCTGCGTTTTGATGGCTCCTGGTGCAGAAGCCTATGGTGGAGCCGGTAGTTTTGGGGGGGTCACTGGGAGATATGGATGTTGTGATTCAAAGTCCCAATATGAAGCAGGTCATGTTGGATCACATGCTGCCGTAGTTGGCTCCCAGCCGAAGGGATCCGACAAGAGGGAGAATATGGCTCTGAATTCTGTTTCTTCTTTTAATGCATGGGGCTCAGCAATAAGTCCCACGGTTTCAGGGTCAAATCATGGAGGCAAGGATTGGTTCAACGCACTCGCCGACTTCGACACTTTCAACTTTGCTTTGAGTGGTGATGGGAATTCTCCGTCTGCCATCTGGAGGTCACCGTGGAAGCTGGATCCTGCCGTACCGAAGGATGGTGTGATGTCTTTGCTGGAGGGTATGGATATGCTTGTGGAAGACGGATCAGACGATGCTTTAGGGATCATGAAGCATATTAGTGAGCACGCTGCGCCTGCTTATTCTGAAGCTCAAGAGGTTTTAGCAAAATCCGTTCTTATGGAGTGCCATGGTCGCGCGGCTTCTCCGAATCCCGTTCACAGATCTCGCCAGGAAGGATCCAATGAGTACAAAGAGAATGTGAGAAGCATGAACGAGCACGTTGATAATTGCCCGTCATCACCTTTTGTCAGCTGGATTGTGCCTTTCCCTGCAGAGATGCTGTCACCAGATGCAGCTGCCGGAGGGACCCCATTGCGAGGAAGTTCCTTGGGGCACAGCTTGCAGGTTGCCGGAGGTGTTGACGATAACCAACTGACCTTTGGAGGGGTCAGCATGGTGGATCCTTTCAGCCCTTCTTTGTATCTGCTCAGGGAATGTAGGTAG

Protein

>Mapoly0036s0107.1
MFMIRAGGAMATQDSQNKMRTGPVPSSSGAESEDDAIHQLPPVHGRTGGPTRRSSKGGWTPEEDEILRRAVQCFKGKNWKKIAEFFQDRTDVQCLHRWQKVLNPDLVKGPWTKEEDDRIMELVGKYGAKKWSVIAQNLPGRIGKQCRERWHNHLNPNIKRDAWTQQEDLALIHAHQIYGNKWAEIAKFLPGRTDNSIKNHWNSTMKKKVDPMSATDPISRALAAYQAQQDSLKSGGSANSEQSMCLSNTVDVVLPSTSGVSNSNLSARIMASSTVPPSVRTCDVAEDSAVDSKPAIQLAAPAGSQVPEKDDIKAVKSGSRKELGTASKPPLLPPPPPPRASCAGNPLTQSTCDTVNCTPMAVPVVSTSSSSLQRQPSSIDENVCVPSSVELCRVPSFSRMYPLACSLPESTTCSGQSTPALTSLPLTSSVFGNGTMIGDVDSVSGSVIESVNMMAQPMTPMGYMTLHECHYSQHQRAEELSGPCLPPYSNNQKLCLRGDISKVGTEEYSDELLKAATQVVSDYQPLSMFAELEPEVEDTEGDAGFFYEPPRLPNSDMPFLNYDLISPNGTSLQAYSPLGVRQMIMPSVNCSTPPSYPSSSPFRGGSPQSTLRRAAQSFGGTPSILRKRPRPLVSISRGNKEGEASGLQVRDSNMSGGCVQSSDNAADMAHDSACTVTPDRNTSNENSFLCRSFGSDSLMSADISPCHARRFASPAYDLTSKNLMKINRLEIENDFQSGSGYPSPGSNSSGGAHTRTKGGDGKSGGCVSGIKCNKRGRFRAINPDYESKAIKGGGNQPSPKTQDLPVLVEQRQNGQQACFSVEASSMTSCVLMAPGAEAYGGAGSFGGVTGRYGCCDSKSQYEAGHVGSHAAVVGSQPKGSDKRENMALNSVSSFNAWGSAISPTVSGSNHGGKDWFNALADFDTFNFALSGDGNSPSAIWRSPWKLDPAVPKDGVMSLLEGMDMLVEDGSDDALGIMKHISEHAAPAYSEAQEVLAKSVLMECHGRAASPNPVHRSRQEGSNEYKENVRSMNEHVDNCPSSPFVSWIVPFPAEMLSPDAAAGGTPLRGSSLGHSLQVAGGVDDNQLTFGGVSMVDPFSPSLYLLRECR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>