Mapoly0037s0007



Description

STEROL REGULATORY ELEMENT-BINDING PROTEIN

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_153175
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR12565 STEROL REGULATORY ELEMENT-BINDING PROTEIN
PANTHER PTHR12565:SF70

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH21 transcription factor, bHLH Mapoly0037s0007.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0037s0007.1 scaffold_37:81749..85692  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0037s0007.1  

Gene structure:

mRNA scaffold_37:81749..85692  ( + strand )
five_prime_UTR scaffold_37:81749..82389  ( + strand )
five_prime_UTR scaffold_37:82649..82813  ( + strand )
CDS scaffold_37:82814..83629  ( + strand )
CDS scaffold_37:83811..84146  ( + strand )
CDS scaffold_37:84270..84341  ( + strand )
CDS scaffold_37:84471..84707  ( + strand )
CDS scaffold_37:84871..84961  ( + strand )
CDS scaffold_37:85134..85171  ( + strand )
three_prime_UTR scaffold_37:85172..85692  ( + strand )

Sequences:

Gene

>Mapoly0037s0007.1
GGGCTCGCTACTACTTCTTCCTTTACTTCAGAGACAGACAGAGCGGAAACAGAACAGAAGAGTGCAGCGGCCGAGGCTGAGAGAGCGCAGCAGCAGCAGCATCGAGCGATCACGCACCCCACCCCCCACTCTCATACATACAAGACTCCGACGGACGGACAGACGGACAGTTGCGAGAACCGGAGAACTCCCCACACCAAGCGCAGCAGTGGAAGAAGAAGGAGGAGGAGAATCGACATTTGTATTTTAAAGATTTTGTTTGCGCGGCGAGGAGCTCGTGAGGTGCGCGCACTATTTGACTTGCGGGTGCTGAAGCGGTGACTGAGGGAGCGTGGGATTTGCTTCTTCATTCATTCGGGCTGGTCAGGACGGAAGCCTTTGCTAAAACAGCGACCTGCTCTGTCGACTTCGTGGTAGAAGAGAACTCGGAGGTTTACTGATTCGTCAGGTGTCGGCAATTTCATAGTCGTGGAGCATTTTATCTGCATCGATAAGCTGTAGCAGCTGTTGAACTCCAGGGAGGGTGACATTACAGAAGTTAGCAACGGGTGGATAAGCATTGACCCTAAGCCGCTGCTGCGAGTGTGTTGGTGGCCGAATTCCTCGCCCATCTGCACGGATTATGTGCCTTCTGCATCTCGGTATGTCTTACTCTCATCCTCTTTCCAATTTGAAGCTACCAAACTCGCTCCCTCACCTTCTCAGTCTTAGGTGCTCCTCGACTGTAACTGAAAACCGCTCTAATTCTACAGGTGTTGTGATTGGATTTCTCTTCCATTATGATCCACTTGTATACTTCGACCAATTTCATACTATCCACATTAGCTCCTATTATAAAACATGCACATATTAATCTTTTGAAAGTATTTTCACTGAATCACGTGCTCTGGCGGTTTTCAGGTCGAAACTAGGAGATGGCTTTGTAATTTGGAGGACTTATACTCTCGGGACATGGTTAAGAGTCACATAGCCATTTTAATGCCACTTGCCACCATCTTCGGTGCCTTCTTTCTTCTCAGAACTTTGGAAGCTCAGTCGTAAGAAATCGATTGGCAACAACACTTGATGGATGTCAGCGAGTGTTACCCATCTTCTCTCACATCCCTACTTCCGAATGTTACTGGTGCCTTGCCCTATCCTTGCAGTCCAGGAGTAAATGCAGGTCCCATAAATCAAGATTTCAGATTGACGCGCAGCGTATCTGGTTCCCTAATTCCCAGTTCACAACAACGTCTGGGAATGGAGAAATCCATGCCTCTCGGCAGTGGTTGGAATTCCGTGGACCATGGGAATCTCGGTCTTACCGTCGATCCTGCCAAAGGTGGTTTTGCACTCCAAGGAGTCGGTCTTCCATCATCTCCCATTGCACGATTCTCGTCTAACCCTGGGTTTGCAGAACGTGCAGCGAGGTTTTCTGCTTTTGGAAATGGTCATTTTTCCCAATCTTACTCTCACAGCGATAACGGTAGTGTGAGGTCTGGTTCTTATGAAAACGAGAACAAAGCGACCAAACTCTCCGCAAGGGGCGAGATCTCTACGGGAGGCATCGGCTCACCTGAAGTTTCTGGCAGAAGTCAAGCTAATGCCTTGGATGTTGGCAACGATGGAGAGGATACAAAAAGTAGACTCTATCGCAGCACTTCTGCTGCTTGCTCACCAGCTCAAACTGATGAAGGATGTAATGCCCATGACAACGAGAGACCTGTAGTCGGCAGCCCTTCCGAGTCTGGTGCTACCAATGGCAGCGGAGGTCAAGAAACATCCAAAACCGACGCGGATCAAGGTCGATCAACCGCCGCTCAGTTGAGTGGGAAGAAGAGAAAAGCTTCCGGTGATGAGGCCGTCAAAGAAACAGCTTCACCTGTTACCAAGGAGCAAAAGGTGAGCGGAGTAGTTTCAACTTCAAAGAGTGTAAGATGATGATTATGATTTGCATAAGTAGTGATAGTGTTTTCGCCCTTCTCCTATATTGTAGTTCTGCATGTGCTTCGAACACGTTTTAGATCAGAGGTTGATTCCCACTGCGGAAACTCACCCATTTGCTTCTCTATGTATGTTCCAGAATTCCGGTGCTCAGTCAAAGCGCTCAAAAGGTGCCGAAGATAAAGAAGATCAAAAGTCGAAAGCTGAACGTAGCGACAACTCGAGCTCCAGCTCTCTAGCAGCCAAGGATTCCAAACATGTTGATCATCCCAAAACTGACTACATCCACGTTAGAGCGAGGAGGGGTCAAGCCACAGATAGTCACAGTTTGGCTGAACGAGTTCGGAGGGAAAAGATAAGTGAACGCATGAAGTTTCTACAAGATCTTGTACCTGGCTGCAGCAAGGTCACTGGAAAGGCAGTGATGTTGGATGAAATCATCAACTATGTACAATCGATTCAACGGCAAGTCGAGGTGAGATTTCTACTTCAGTGTAGACTTGTCAGGCTTTTGTGCACCTTACAATCCCAACTTTGGAGATGTGAGACGTTGATGTACATGAATGGGACCTGACCTTTAACTTGTTTTGTCATGCAGTTGCTTTCCATGAAACTGGCAGCTGTGACTCCTCGACCCGATTTCAACATTGACAACTTTTTGACCAAACAAGTAGGTACCATCGCCGTCATCGATCTTCTTTATACCTTCACTAGGAATGTATTCGAGATTATATCGCAGTCAATCTACTTAACTGTATATCCACAACCTTGTCTAATTATTTCTTTCTTGTGCTTGCAGCTCCAGATAGGACAAAATTGTGGTCTCCCAAACATGGTCGAGCACACAGAATCTACCATCCAATATCCCCAGCTCCCCTCACTTCACTCCCAACAATCACTGCACATGCAGCAGGTCCTCAGCAATGTTTTGGACAACTCACAGTCTGTGGAATCAAAGCTGATGAGAATGAACAGCGCTCCTCCAATGTCTCTACCTAGGGCTCACATGGACATATTCGGAGATGGATTGTCTCAGGTTAGTTGACAATATCCTTCTTTGTGATGGTAATGTTATGATCTCTTCAAACATTTGTCGCTATCATGTACAGGCAACAGGAGGAGGATGTCAGAGCATGCCTTTCTTTGGGATACATGTCTTGTCCTCAACTCTAACTTCCATTTTGATGTGGTGGCTGCAGCTTACAGGGCTTTGGGAAGGTGACCTCCAGAGCGTTGTTCAAATGGGTTTCACCCAAGGGAGGCCAATGACGGGTCTTGGGGGATTTCAATGTAAGACTCAAGCCTTGAAACCTCGTTGTATTCCACTTCATCTCCGCTTAATGCATTATTTCAAGTTCAATACACACACTGGGAAAGATATAATTTGAAGCACATGATGCACGTGGTGATTGAATTAAATCTCTGAAAGTTACTCATAAAATTCTTGGTATCTCCTGAACAGGTGACTTGCCACCAGGCCACATGAAGATAGAGATCTGACAACTTCTGCGGCTTGAAAACCACTATTCGCACACTGGCTCAACGGTGTTGGTGCTTGAGAATATCTCTTGGCGGTGTTCACAAGGACCAGAAGTTCTGTTCGCACTTTACCATATCTGTTTCTTCCATCAGTCATATAAATGCGTGAGTCCTTCTTTGAAGCTCAATTCAGAAGAGAGCTGGGTATCACAAGAATATGAGCTGTTGATCAAAAGTACTGTGGAGGAATCGATGTCGAGCAAGGGATGCTACCATTGAAATAAAATGAAGGGCAACCTTGATCTGAGGCTAAGTCGCCATTCCAAGGTGCTGTCGGAATGTGAATACTATCAGGGGTCCCATAAATTAGTTATGGAGTTTCATCTCAAAAACTACAGTAGACAATTCGACAAATTGAGTTACAAGAGGCATGTTTAGTGAGAAAATTTAGTTCCTATCGTGTACAGAGATCTGAGTAAGGCCAGTGAGCCCAGTATTTGGCTCCTTGTGGAATCATATGATCTACATTAATTGAAACTGGT

mRNA

>Mapoly0037s0007.1
GGGCTCGCTACTACTTCTTCCTTTACTTCAGAGACAGACAGAGCGGAAACAGAACAGAAGAGTGCAGCGGCCGAGGCTGAGAGAGCGCAGCAGCAGCAGCATCGAGCGATCACGCACCCCACCCCCCACTCTCATACATACAAGACTCCGACGGACGGACAGACGGACAGTTGCGAGAACCGGAGAACTCCCCACACCAAGCGCAGCAGTGGAAGAAGAAGGAGGAGGAGAATCGACATTTGTATTTTAAAGATTTTGTTTGCGCGGCGAGGAGCTCGTGAGGTGCGCGCACTATTTGACTTGCGGGTGCTGAAGCGGTGACTGAGGGAGCGTGGGATTTGCTTCTTCATTCATTCGGGCTGGTCAGGACGGAAGCCTTTGCTAAAACAGCGACCTGCTCTGTCGACTTCGTGGTAGAAGAGAACTCGGAGGTTTACTGATTCGTCAGGTGTCGGCAATTTCATAGTCGTGGAGCATTTTATCTGCATCGATAAGCTGTAGCAGCTGTTGAACTCCAGGGAGGGTGACATTACAGAAGTTAGCAACGGGTGGATAAGCATTGACCCTAAGCCGCTGCTGCGAGTGTGTTGGTGGCCGAATTCCTCGCCCATCTGCACGGATTATGTGCCTTCTGCATCTCGGTCGAAACTAGGAGATGGCTTTGTAATTTGGAGGACTTATACTCTCGGGACATGGTTAAGAGTCACATAGCCATTTTAATGCCACTTGCCACCATCTTCGGTGCCTTCTTTCTTCTCAGAACTTTGGAAGCTCAGTCGTAAGAAATCGATTGGCAACAACACTTGATGGATGTCAGCGAGTGTTACCCATCTTCTCTCACATCCCTACTTCCGAATGTTACTGGTGCCTTGCCCTATCCTTGCAGTCCAGGAGTAAATGCAGGTCCCATAAATCAAGATTTCAGATTGACGCGCAGCGTATCTGGTTCCCTAATTCCCAGTTCACAACAACGTCTGGGAATGGAGAAATCCATGCCTCTCGGCAGTGGTTGGAATTCCGTGGACCATGGGAATCTCGGTCTTACCGTCGATCCTGCCAAAGGTGGTTTTGCACTCCAAGGAGTCGGTCTTCCATCATCTCCCATTGCACGATTCTCGTCTAACCCTGGGTTTGCAGAACGTGCAGCGAGGTTTTCTGCTTTTGGAAATGGTCATTTTTCCCAATCTTACTCTCACAGCGATAACGGTAGTGTGAGGTCTGGTTCTTATGAAAACGAGAACAAAGCGACCAAACTCTCCGCAAGGGGCGAGATCTCTACGGGAGGCATCGGCTCACCTGAAGTTTCTGGCAGAAGTCAAGCTAATGCCTTGGATGTTGGCAACGATGGAGAGGATACAAAAAGTAGACTCTATCGCAGCACTTCTGCTGCTTGCTCACCAGCTCAAACTGATGAAGGATGTAATGCCCATGACAACGAGAGACCTGTAGTCGGCAGCCCTTCCGAGTCTGGTGCTACCAATGGCAGCGGAGGTCAAGAAACATCCAAAACCGACGCGGATCAAGGTCGATCAACCGCCGCTCAGTTGAGTGGGAAGAAGAGAAAAGCTTCCGGTGATGAGGCCGTCAAAGAAACAGCTTCACCTGTTACCAAGGAGCAAAAGAATTCCGGTGCTCAGTCAAAGCGCTCAAAAGGTGCCGAAGATAAAGAAGATCAAAAGTCGAAAGCTGAACGTAGCGACAACTCGAGCTCCAGCTCTCTAGCAGCCAAGGATTCCAAACATGTTGATCATCCCAAAACTGACTACATCCACGTTAGAGCGAGGAGGGGTCAAGCCACAGATAGTCACAGTTTGGCTGAACGAGTTCGGAGGGAAAAGATAAGTGAACGCATGAAGTTTCTACAAGATCTTGTACCTGGCTGCAGCAAGGTCACTGGAAAGGCAGTGATGTTGGATGAAATCATCAACTATGTACAATCGATTCAACGGCAAGTCGAGTTGCTTTCCATGAAACTGGCAGCTGTGACTCCTCGACCCGATTTCAACATTGACAACTTTTTGACCAAACAACTCCAGATAGGACAAAATTGTGGTCTCCCAAACATGGTCGAGCACACAGAATCTACCATCCAATATCCCCAGCTCCCCTCACTTCACTCCCAACAATCACTGCACATGCAGCAGGTCCTCAGCAATGTTTTGGACAACTCACAGTCTGTGGAATCAAAGCTGATGAGAATGAACAGCGCTCCTCCAATGTCTCTACCTAGGGCTCACATGGACATATTCGGAGATGGATTGTCTCAGCTTACAGGGCTTTGGGAAGGTGACCTCCAGAGCGTTGTTCAAATGGGTTTCACCCAAGGGAGGCCAATGACGGGTCTTGGGGGATTTCAATGTGACTTGCCACCAGGCCACATGAAGATAGAGATCTGACAACTTCTGCGGCTTGAAAACCACTATTCGCACACTGGCTCAACGGTGTTGGTGCTTGAGAATATCTCTTGGCGGTGTTCACAAGGACCAGAAGTTCTGTTCGCACTTTACCATATCTGTTTCTTCCATCAGTCATATAAATGCGTGAGTCCTTCTTTGAAGCTCAATTCAGAAGAGAGCTGGGTATCACAAGAATATGAGCTGTTGATCAAAAGTACTGTGGAGGAATCGATGTCGAGCAAGGGATGCTACCATTGAAATAAAATGAAGGGCAACCTTGATCTGAGGCTAAGTCGCCATTCCAAGGTGCTGTCGGAATGTGAATACTATCAGGGGTCCCATAAATTAGTTATGGAGTTTCATCTCAAAAACTACAGTAGACAATTCGACAAATTGAGTTACAAGAGGCATGTTTAGTGAGAAAATTTAGTTCCTATCGTGTACAGAGATCTGAGTAAGGCCAGTGAGCCCAGTATTTGGCTCCTTGTGGAATCATATGATCTACATTAATTGAAACTGGT

CDS

>Mapoly0037s0007.1
ATGGATGTCAGCGAGTGTTACCCATCTTCTCTCACATCCCTACTTCCGAATGTTACTGGTGCCTTGCCCTATCCTTGCAGTCCAGGAGTAAATGCAGGTCCCATAAATCAAGATTTCAGATTGACGCGCAGCGTATCTGGTTCCCTAATTCCCAGTTCACAACAACGTCTGGGAATGGAGAAATCCATGCCTCTCGGCAGTGGTTGGAATTCCGTGGACCATGGGAATCTCGGTCTTACCGTCGATCCTGCCAAAGGTGGTTTTGCACTCCAAGGAGTCGGTCTTCCATCATCTCCCATTGCACGATTCTCGTCTAACCCTGGGTTTGCAGAACGTGCAGCGAGGTTTTCTGCTTTTGGAAATGGTCATTTTTCCCAATCTTACTCTCACAGCGATAACGGTAGTGTGAGGTCTGGTTCTTATGAAAACGAGAACAAAGCGACCAAACTCTCCGCAAGGGGCGAGATCTCTACGGGAGGCATCGGCTCACCTGAAGTTTCTGGCAGAAGTCAAGCTAATGCCTTGGATGTTGGCAACGATGGAGAGGATACAAAAAGTAGACTCTATCGCAGCACTTCTGCTGCTTGCTCACCAGCTCAAACTGATGAAGGATGTAATGCCCATGACAACGAGAGACCTGTAGTCGGCAGCCCTTCCGAGTCTGGTGCTACCAATGGCAGCGGAGGTCAAGAAACATCCAAAACCGACGCGGATCAAGGTCGATCAACCGCCGCTCAGTTGAGTGGGAAGAAGAGAAAAGCTTCCGGTGATGAGGCCGTCAAAGAAACAGCTTCACCTGTTACCAAGGAGCAAAAGAATTCCGGTGCTCAGTCAAAGCGCTCAAAAGGTGCCGAAGATAAAGAAGATCAAAAGTCGAAAGCTGAACGTAGCGACAACTCGAGCTCCAGCTCTCTAGCAGCCAAGGATTCCAAACATGTTGATCATCCCAAAACTGACTACATCCACGTTAGAGCGAGGAGGGGTCAAGCCACAGATAGTCACAGTTTGGCTGAACGAGTTCGGAGGGAAAAGATAAGTGAACGCATGAAGTTTCTACAAGATCTTGTACCTGGCTGCAGCAAGGTCACTGGAAAGGCAGTGATGTTGGATGAAATCATCAACTATGTACAATCGATTCAACGGCAAGTCGAGTTGCTTTCCATGAAACTGGCAGCTGTGACTCCTCGACCCGATTTCAACATTGACAACTTTTTGACCAAACAACTCCAGATAGGACAAAATTGTGGTCTCCCAAACATGGTCGAGCACACAGAATCTACCATCCAATATCCCCAGCTCCCCTCACTTCACTCCCAACAATCACTGCACATGCAGCAGGTCCTCAGCAATGTTTTGGACAACTCACAGTCTGTGGAATCAAAGCTGATGAGAATGAACAGCGCTCCTCCAATGTCTCTACCTAGGGCTCACATGGACATATTCGGAGATGGATTGTCTCAGCTTACAGGGCTTTGGGAAGGTGACCTCCAGAGCGTTGTTCAAATGGGTTTCACCCAAGGGAGGCCAATGACGGGTCTTGGGGGATTTCAATGTGACTTGCCACCAGGCCACATGAAGATAGAGATCTGA

Protein

>Mapoly0037s0007.1
MDVSECYPSSLTSLLPNVTGALPYPCSPGVNAGPINQDFRLTRSVSGSLIPSSQQRLGMEKSMPLGSGWNSVDHGNLGLTVDPAKGGFALQGVGLPSSPIARFSSNPGFAERAARFSAFGNGHFSQSYSHSDNGSVRSGSYENENKATKLSARGEISTGGIGSPEVSGRSQANALDVGNDGEDTKSRLYRSTSAACSPAQTDEGCNAHDNERPVVGSPSESGATNGSGGQETSKTDADQGRSTAAQLSGKKRKASGDEAVKETASPVTKEQKNSGAQSKRSKGAEDKEDQKSKAERSDNSSSSSLAAKDSKHVDHPKTDYIHVRARRGQATDSHSLAERVRREKISERMKFLQDLVPGCSKVTGKAVMLDEIINYVQSIQRQVELLSMKLAAVTPRPDFNIDNFLTKQLQIGQNCGLPNMVEHTESTIQYPQLPSLHSQQSLHMQQVLSNVLDNSQSVESKLMRMNSAPPMSLPRAHMDIFGDGLSQLTGLWEGDLQSVVQMGFTQGRPMTGLGGFQCDLPPGHMKIEI

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>