Mapoly0037s0014



Description

Multidrug/pheromone exporter, ABC superfamily

Reference DB

Database ID Description
GO GO:0005524 ATP binding
GO GO:0006810 Transport
GO GO:0016021 Integral to membrane
GO GO:0016887 ATPase activity
GO GO:0042626 ATPase activity, coupled to transmembrane movement of substances
GO GO:0055085 Transmembrane transport
KOG KOG0055 Multidrug/pheromone exporter, ABC superfamily
OrthoMCL OG5_126596
PFAM PF00005 ABC transporter
PFAM PF00664 ABC transporter transmembrane region
PANTHER PTHR24221 FAMILY NOT NAMED
PANTHER PTHR24221:SF138

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpABCB3 Auxin transport Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0037s0014.1 scaffold_37:224241..231380  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0037s0014.1  

Gene structure:

mRNA scaffold_37:224241..231380  ( + strand )
five_prime_UTR scaffold_37:224241..224546  ( + strand )
CDS scaffold_37:224547..224936  ( + strand )
CDS scaffold_37:225260..225314  ( + strand )
CDS scaffold_37:225515..225690  ( + strand )
CDS scaffold_37:225867..226067  ( + strand )
CDS scaffold_37:226180..226439  ( + strand )
CDS scaffold_37:226553..226869  ( + strand )
CDS scaffold_37:226975..227198  ( + strand )
CDS scaffold_37:227789..228177  ( + strand )
CDS scaffold_37:228417..228877  ( + strand )
CDS scaffold_37:229036..229277  ( + strand )
CDS scaffold_37:229448..230662  ( + strand )
three_prime_UTR scaffold_37:230663..231380  ( + strand )

Sequences:

Gene

>Mapoly0037s0014.1
GGATTGCACTGCTTTCCACAGTGGCTGTCTGCGCGAATCGCTCGCAATGAGCATTTCGTATGCTCCAAGTTTAAGCTCCTGCATATAGAGCCTTGCGTCGGGGCGAGTGTAGTAGTAGTTGAAGGAGAATGCGAGCTGAGCCTGAGTCGGCCAGCCCATCTCAGTCCAGCGCCAATGTAGCTAGAGCAGAAGTAGTACTGGTAGTGTGGTTGGTTTCAATTCACTCGACGAAGATTTGAATCGGGCAGATTGACACTCCGAGAGATTAGAATTTGGGCGGGAGATTTGCGGCTCAATTCTTTGGAGATGCCCGCAACGGGGGAGATGACGGGCTCGGGAGTGGATGAGAGTGAGCGGATGGAAGCAGCCAATGTCACAGGTCGAGATGGCGGCGGGGTGGAGAAGAGTGGAGCTCTGATAGCCGTTGCGGAGGTGGGTGAAGTCGACGGGAAAGGAAAGAAGAAGACGAAGGGGAAGAAGGAGAAGGGCGATGAAGCTGAGCCTATTCCGCAGGTGTCCTTCTTCCGGCTCTTCGCCTTCGCCGACGGCTTGGACATCATTCTCATGGTGTTCGGCACGCTCGGCGCTATAGTCCACGGCGCAGCTCTTCCGGTCTTCTTTCTGTTTTTTGGAAAACTGCTCAATGGTATCGGAGGGAGCATTAGTCCCGAAATCGGTAAACAAACCGTCGACAAGGTACGAAAGATTTCGTATGACACTACCGGTGTCATGAATTGCCCCTTCCTCTTCCTCCCGTCTTACATCTGTCATTTACGGTCTCGAGATTCTCTCGCTTCTCGTCTGCCATTCCAGATTCACAACTCTCGCCTGCTGAATCACCACATTGACTTCATGTTCACTGGTATTGAAGTACTTTTTGGGCACGATGGTAGATTTTAATTCGAGTAATAAACTGCCAACTCGTTCATGGATTTGAAGGAATTTTGATCAGAGCTCGTCGAACATGTGTTCTGACTCTTAATCTATTCTGAACGACTATTTGCTTCATTCTTTCGCAGTATTCGTTGTACTTTCTATGGCTCGGTTTGGCGACACTCTTCTCATCGTGGATGGGTGAGTGGGGATTCCAGCTCTTGGCTTATGTCGTATGTGTGAATCGCTCGACAATAAGTCTCAACGAGTCCGTAGGTACAATTAGGACATTACTCTGAATCGCTGACTCCGTGACTGATGTTGCGGAGGTTTCCAATCTGAGTAGTAACCTAGTTGTCCATTTACTCACCTCCACTGCACGTGGTGGTTGACGTGAGCAGAGGTTTCGTTTTGGATGCAAACCGGAGAGAGGCAGTCTGCAAGATTGAGAGCGAAGTATTTGGAAGCATTGTTGAAGCAAGATGTCGGATTTTTCGACACCGACACCAGTACGGGAAAATTCGTCCAGAGCATCTCTTCCGACCCCCTGATGGTTCAGGATGCAATCAGCGAGAAGGTAAGAAAGCAAGCACCAAGTGATTCAATTGTCGCCACAGCAGTGACTAAAACTGGCGAGCCAAAAGAGCTATCGATTGATTCGAGTTCATTTCATCGTTAAGGAAGGGAACAATTTATTGATCCGATTCTGGTCTCTGAGAGATTGCAGTGCCTCCGTCCGTCTCCGTTCTGCAGATGGGAAATTTCGTGCATTACATGTCGACGTTCGTAGCGGGCTTCGTCGTGGGATTCGTTAACGAGTGGACCATAGCTGTGGTGACTCTGGCAGTTTTGCCTCTCATTGCTGCGGCAGGAGGCTACTACGCTATTGCACTGACGGGATTGACGAGCAAAAGTGCAGAAGCCTACGAAAGAGCCGGAAGCATCGCTGAGGAGGTAATGTATTGCACTGGACTCTATGGTCTCGTGCACGCCGTTCAGTCAAAGTCAGTCGAGTTCGTCATCGTCGGGGGTTTAACGTGTCACCCGATTGTGTCCACCGATGCAGACGATCGGCCAAGTTCGGACCGTCTACTCTTTCGTCGGCGAGCAGAGATCCGTCCAGCATTACAGCCTTTCTCTGGAGAGCACTCTGAAGCTCGGCTACAAATCGGGCTGGGCCAAGGGAATTGGAATGGGTGGCACTTACGGAGTTCTCTTCGGCTGCTGGGCCTTGCTTCTGTGGTACGGAGGTACCCTGGTGCGCAAGGGGAATCTCAATGGAGGCGAGGCTCTCTCGTCCATCTTTCCTGTCATCATCGGAGGCCTGTAAGATTTGCTTACCCTCTTGCTACCCTTTGGCTTTGAAAGATATCAATGTGCTTGTTTTTGTCATCGGGGTTCGTGTGCTTTTTTCTGATGGAAGTGGGTTCCGGGGCCAGGTCTCTGGGGCAAGCGATGCCGAATGTGTCGGCCTTCGGCAAAGGGAGGGCCGCTGCCTACAAGATTTTCCAGATGATCGATCACGAACCCACGATCAACAAGGTCGACCCGACGGCCAAGAGGCTCGAGTCGGTCCAAGGGCTCATCGAACTTCGTAATGTGGAATTCGTGTACCCGTCGAGGCCCGACACGAAAATTTTCCAGGATTTTTCTCTCGTCATTCCTCCCGGGAAGACGGTCGCCATCGTGGGCAGCAGTGGATCCGGCAAGAGTACCGTGGTGTCCCTCATCGAGCGTTTTTACGACCCTATCGGAGGTACGAACACGCGCACCTTCGTGTCAACTGATGATCTGAAGAGTAGTGCCGAGGGACCCCAGGCCGAATGAATTCGTGGTGCTGTCTTTGTCTTACGCTCCGCAGGGCAGGTTTTGTTGGACGGGCATGATCTTAAGAGCTTGGACCTGAAGTGGCTCCGAGGGCAAATCGGGCTCGTCAACCAGGAGCCCGCCCTGTTCGCAACGACAATAGCGGCGAATATCCTCTACGGGAAGGAAGGAGCCAGCGAGAAGGAAATCGAGGAAGCAGCAAAAGCCGCTAATGCTCATTCTTTCATTGACCAGCTTCCACAACGTTACATGACACAGGTTGGTCCGCCAGTTCCCCTCTCCCGACCTGAATCAATTTGCACGAAACGGCCCTATTGCCTCCTCTGTGCAACAACTCTCACATTCTCGAATTTCGTCCTCTTCCCCACTCGTACTCGTTATCCCTGTCCTGTAGCTCTATCTGCGGCCATGATCGTCAAATCATCACCAGCATTACTTCGGTCATATTACTCCAGACGCCGGAGTAGGATGGCAGTGCATTTGGTCGTATCTGCTTGATTGGTTTTATGTGTGCAAAGATTGACCTGAAACGAATAGCGGATAATTTGAAGTAGCCATTGCTGGAACTGAGCTGCAGCTGTCGAGTTGCTAGTAGCTGTCCCCATTCCAATGTACATTGTCATCGTTCATGGAATCCAATACACACGAATGAGTTCTGGTTTTTCCCGGGGAGATTTAGCCTTTGAATAAATAGAAACGCCCAGATACAGGAAGGTGTGATTCCATGACAGAACGTTGTTCGTTGGCCGCGATGGTAATTCTGACACCGACTCTCACGTGCCGGGCCAGTTCGGCCCAGAGGTGTGGCAGTGACCGCTTACATGTATATGGATAATTTGGGAATGCAGGTCGGGGAGAGAGGAGTGCAGTTGTCTGGAGGACAGAAGCAGCGTGTGGCAATAGCCAGAGCTATGCTGAAGAACCCCACGGTTTTGCTGCTGGATGAGGCTACCAGTGCACTGGATGCTGGGTCCGAGCAGATAGTGCAAGAAGCACTGGACCGTCTGATGGTGGGAAGGACGACTGTTGTGGTCGCCCATCGTCTGTCCACTATCCGGAATGCCGACTCCATCGCGGTGGTTCAAGAAGGGCGCATCGTGGAGAGAGGGAACCACGCAACTCTCATCGCGGACCCCAATGGAGCGTACACTGCCCTCGTCCGCCTTCAGGAGATGGCAGCAACCAGAGGAGATGGCGGCAGCATGAAACGAGCCACATCCGGCAGACAATCCCAAATGTACGAGCCTGTCTTCTCGATTCAATTCTCAATTCTCGTCCCTGTCCAGTCTTCTGCAAGACTCTTCCATTTCATTTTAATTCTGACATTTTACCAGAAATAAAAAATTGCTAGCGTTATAAGCTTCCAAAGGAATTTCGATGTGAATCATTTTGTAACTGTTAACGAAAGCGCCGAACGTTCAAAATCGATTCCGATGACTGCTTCTGATGCTCGTAAAATCTGAACAAATCGTGCAGCAGCTTATCACGAAGTGAATCTCGCGGTGGATCTCGACGTACTTCTCGAGGTGCATCGTTCTCGTTGTACAGAAGTGGATCTGTTCGGTCGACGACCAGCGTCGAGGAGTCGGATGTGGGAACACGAGAGATCGACCTTCCGCCTCCTCCTCCCCCTCCCAAAGCTACACTTAAGCGTCTCATAGCAATGAGCAAGCAGGACTGGATATACGGCGTCTTTGGAGCCATAGGATCGATCTTAGCAGGAGCTATTAACCCGGCATTCGCACTCATCATCAGCCAGGTCCTGAATGCCTACTACAACCCGGACTTCGGGGCCATGAAGACGGAGGTTTCCAAGTGGGCCCTCGTGTTTGTGGGGGTCGGTGTAGCCTCGCCTTTCGTCTACGTTTGTCAGCATTACTCGCTGGGAGTTTTTGGCGAGAATTTGGTGAAGAGCGTCCGCGTGAAGATGTTCTCATGTAAGTGTGAAGAGGCGACCGCTTTTGTGTTGCCCAGTTTCTTCGGCAAGGAAGAATATCTCGTATCACTGAGGGTGTGGTCTTCTTGTCTTGTCTTGTATTGTCTTGCCCGTGAGGAGCCGGTCTGATTATGTGTCACCCGATTTTGGCCTTGGCAGCGATTCTGCGCAACGAAATGGCATGGTTCGACCGGGATGAGAACAACAGCAGTCGGGTGGCGGCTCGTCTTTCGTCCGATGCCACGCAAGTGAGGGCAGCTCTCGGGGACCGCTTGGCGGTGATTCTGCAAAACGCCTCTCTTATGACCATCGCCGTCGTCATCTCGTTCGTTCTGCAATGGAAGTTGACTCTGGTCATGCTCTCCATCTTCCCGGCTCTCGTCGGTTCTGCCTTCGGCGAGGTAAGCCCCACTGCAGCTTCCACTCATCTCCATGATTTCCATGCCGCCCCGTCCGTAGCCAATGCCAGTGATCTCCTTACATCTCGAGGCTGATCGGATCTGCTAGAGGTGTTTATGCTAAGGGGAACGAAAGTCCTGATGGGGAATGTATCGTGGAAATGTTTGTGCAGAACTTGTTTTTGAAAGGATTCGCAGGAGACGTGGCCAAAGCGTACGCGAGAGCCACGCAAGTCGCGGGAGAGGCCGTGGCGAACATCAGAACGGTGGCCGCATTCAACGCCGAGGACAAAGTGAGGGGCCTGTTCGATCAAGAGCTGGTGGGTCCGAACAAGCGCAGTTTCTACAGGGGACAGGTCGCAGGCTTCGGTTTCGGGATCTCGCAATTGTTCATGTACGGCTCGTACGGGCTAGGATTGTGGTACTCCGGCAGATTGGTGCAGAAAGGGGAGGCGCAGTTTGGAGACGTGATCAAAGTTTTCCTGGTGCTCATCGTCTCGGCGTTCGCCGTGGCTGAGACTCTGGCCCTCACACCGGACTTCGTAAAAGGAAGTCAAGCCGTGGGGTCGGTGTTCGAGGTTCTCGACCGCAAGACGGCAATCGACCCCGAAGATTCCAGCGTTGAGAAAGTGGAGAAGATGACGGGGGAGATCGAGCTGAAGCACGTCGCCTTCGCATATCCCTCCAGGCCCGACGTGATTATCTTCAAGGATTTGAACTTGAGAGTGCGCTCCGGCCAGAGCCTTGCGCTGGTGGGCTCCAGCGGCTCGGGCAAAAGCTCGGTCATAGCTCTCCTCGAGAGATTCTACGATCCCTTGTCCGGACGGGTCATGATCGACGGGAAAGACATTCGCTCGTACAACTTGAAGTCTCTCCGCCAGCACATCGCCCTCGTGCAACAAGAGCCTGCGCTTTTCGCCACCACCATCTATGAAAACATCGTCTACGGAAGAGCCGGAGCCTCGGAGGCCGAAGTGATCGAGGCAGCAAAAGCTGCCAATGCTCACAACTACATCAGTGGTCTGCCGATGGGGTACCAAACGGAGGTCGGGGAACGAGGGGTGCAGCTCTCTGGAGGTCAGAAACAGAGAGTGGCCATCGCCAGAGCCGTGCTGAAGGACCCGGCCATCCTGCTCCTGGACGAGGCTACGTCTGCTTTGGATGCCGAGTCTGAGAAGATCGTGCAGGAGGCCCTGGATCGGCTGATGAACAACAGGACGACCGTCATGATCGCCCACAGACTCTCCACAATCCGCAACGCGCACTCCATTGCCGTGATTCAAGAGGGAACCATCCTGGAGCAAGGGTCTCACGCCGAACTTTTGTCGAAGAACGGGGGTTACTCCCGTTTGATCAATTTACAAAACAATAGCCAAGACAACGAATGATCTGAACGCAGCATCTCGTAGAAATGAGCATCGACACGAACTAACATATTGTGAATCTAAACCTCACCATCGGCAACCTTCAACCTCCACGACCCTTCGTTGCGAAGGGGATGATGCAATAGTGTACAATATGTTCATACTGTCCGCAGTTGTAATTAGTCATCTCTCTTCGCCCGACAGCCAACCTGTCCCGCCCCTTTACGGAGCGCTCTGGATTCCCCATCTCCACTGCTTTTCCTTGAGACCATCTCCAACACCTGTCCTCTAAGCCCCGCTAGTCGAAGAGAAAGAGCTACTTGGTGATTTTTTTCAACCTTGCCTTGCCTCGTTGAGGTGAGTAACTAGGCTATACGAATTCAGCTAATTGTTGGTCACTTAGCATCTATTCAAAGATGTGTAATACGCAGGTCCCAATTGGTTTTTCAATCTGAAATTGAACAGACCGATTTATAACGCAGGCATGTGCGTGTGACGTTAGCAATGTGACGAGTATTGTCGATTGATTATTGGTCTCACTGCGGAAGATATCCGTGCTTGCGTTCTGGTCGTCAGTGTCAGAAGTGACCTTCGAGCAAACAGAGGCGACGAGCCCCCTGTTGAAATACAAACGGATTTTGATCTCCAAGAGTGCAACAGCGCAAGAACGCTATTATGAATCTCTCGTAGTCCACTCAATGAAAGAGTCACTCTGCGACGAATCCGAGATGGACGAGTTCCT

mRNA

>Mapoly0037s0014.1
GGATTGCACTGCTTTCCACAGTGGCTGTCTGCGCGAATCGCTCGCAATGAGCATTTCGTATGCTCCAAGTTTAAGCTCCTGCATATAGAGCCTTGCGTCGGGGCGAGTGTAGTAGTAGTTGAAGGAGAATGCGAGCTGAGCCTGAGTCGGCCAGCCCATCTCAGTCCAGCGCCAATGTAGCTAGAGCAGAAGTAGTACTGGTAGTGTGGTTGGTTTCAATTCACTCGACGAAGATTTGAATCGGGCAGATTGACACTCCGAGAGATTAGAATTTGGGCGGGAGATTTGCGGCTCAATTCTTTGGAGATGCCCGCAACGGGGGAGATGACGGGCTCGGGAGTGGATGAGAGTGAGCGGATGGAAGCAGCCAATGTCACAGGTCGAGATGGCGGCGGGGTGGAGAAGAGTGGAGCTCTGATAGCCGTTGCGGAGGTGGGTGAAGTCGACGGGAAAGGAAAGAAGAAGACGAAGGGGAAGAAGGAGAAGGGCGATGAAGCTGAGCCTATTCCGCAGGTGTCCTTCTTCCGGCTCTTCGCCTTCGCCGACGGCTTGGACATCATTCTCATGGTGTTCGGCACGCTCGGCGCTATAGTCCACGGCGCAGCTCTTCCGGTCTTCTTTCTGTTTTTTGGAAAACTGCTCAATGGTATCGGAGGGAGCATTAGTCCCGAAATCGGTAAACAAACCGTCGACAAGTATTCGTTGTACTTTCTATGGCTCGGTTTGGCGACACTCTTCTCATCGTGGATGGAGGTTTCGTTTTGGATGCAAACCGGAGAGAGGCAGTCTGCAAGATTGAGAGCGAAGTATTTGGAAGCATTGTTGAAGCAAGATGTCGGATTTTTCGACACCGACACCAGTACGGGAAAATTCGTCCAGAGCATCTCTTCCGACCCCCTGATGGTTCAGGATGCAATCAGCGAGAAGATGGGAAATTTCGTGCATTACATGTCGACGTTCGTAGCGGGCTTCGTCGTGGGATTCGTTAACGAGTGGACCATAGCTGTGGTGACTCTGGCAGTTTTGCCTCTCATTGCTGCGGCAGGAGGCTACTACGCTATTGCACTGACGGGATTGACGAGCAAAAGTGCAGAAGCCTACGAAAGAGCCGGAAGCATCGCTGAGGAGACGATCGGCCAAGTTCGGACCGTCTACTCTTTCGTCGGCGAGCAGAGATCCGTCCAGCATTACAGCCTTTCTCTGGAGAGCACTCTGAAGCTCGGCTACAAATCGGGCTGGGCCAAGGGAATTGGAATGGGTGGCACTTACGGAGTTCTCTTCGGCTGCTGGGCCTTGCTTCTGTGGTACGGAGGTACCCTGGTGCGCAAGGGGAATCTCAATGGAGGCGAGGCTCTCTCGTCCATCTTTCCTGTCATCATCGGAGGCCTGTCTCTGGGGCAAGCGATGCCGAATGTGTCGGCCTTCGGCAAAGGGAGGGCCGCTGCCTACAAGATTTTCCAGATGATCGATCACGAACCCACGATCAACAAGGTCGACCCGACGGCCAAGAGGCTCGAGTCGGTCCAAGGGCTCATCGAACTTCGTAATGTGGAATTCGTGTACCCGTCGAGGCCCGACACGAAAATTTTCCAGGATTTTTCTCTCGTCATTCCTCCCGGGAAGACGGTCGCCATCGTGGGCAGCAGTGGATCCGGCAAGAGTACCGTGGTGTCCCTCATCGAGCGTTTTTACGACCCTATCGGAGGGCAGGTTTTGTTGGACGGGCATGATCTTAAGAGCTTGGACCTGAAGTGGCTCCGAGGGCAAATCGGGCTCGTCAACCAGGAGCCCGCCCTGTTCGCAACGACAATAGCGGCGAATATCCTCTACGGGAAGGAAGGAGCCAGCGAGAAGGAAATCGAGGAAGCAGCAAAAGCCGCTAATGCTCATTCTTTCATTGACCAGCTTCCACAACGTTACATGACACAGGTCGGGGAGAGAGGAGTGCAGTTGTCTGGAGGACAGAAGCAGCGTGTGGCAATAGCCAGAGCTATGCTGAAGAACCCCACGGTTTTGCTGCTGGATGAGGCTACCAGTGCACTGGATGCTGGGTCCGAGCAGATAGTGCAAGAAGCACTGGACCGTCTGATGGTGGGAAGGACGACTGTTGTGGTCGCCCATCGTCTGTCCACTATCCGGAATGCCGACTCCATCGCGGTGGTTCAAGAAGGGCGCATCGTGGAGAGAGGGAACCACGCAACTCTCATCGCGGACCCCAATGGAGCGTACACTGCCCTCGTCCGCCTTCAGGAGATGGCAGCAACCAGAGGAGATGGCGGCAGCATGAAACGAGCCACATCCGGCAGACAATCCCAAATCAGCTTATCACGAAGTGAATCTCGCGGTGGATCTCGACGTACTTCTCGAGGTGCATCGTTCTCGTTGTACAGAAGTGGATCTGTTCGGTCGACGACCAGCGTCGAGGAGTCGGATGTGGGAACACGAGAGATCGACCTTCCGCCTCCTCCTCCCCCTCCCAAAGCTACACTTAAGCGTCTCATAGCAATGAGCAAGCAGGACTGGATATACGGCGTCTTTGGAGCCATAGGATCGATCTTAGCAGGAGCTATTAACCCGGCATTCGCACTCATCATCAGCCAGGTCCTGAATGCCTACTACAACCCGGACTTCGGGGCCATGAAGACGGAGGTTTCCAAGTGGGCCCTCGTGTTTGTGGGGGTCGGTGTAGCCTCGCCTTTCGTCTACGTTTGTCAGCATTACTCGCTGGGAGTTTTTGGCGAGAATTTGGTGAAGAGCGTCCGCGTGAAGATGTTCTCATCGATTCTGCGCAACGAAATGGCATGGTTCGACCGGGATGAGAACAACAGCAGTCGGGTGGCGGCTCGTCTTTCGTCCGATGCCACGCAAGTGAGGGCAGCTCTCGGGGACCGCTTGGCGGTGATTCTGCAAAACGCCTCTCTTATGACCATCGCCGTCGTCATCTCGTTCGTTCTGCAATGGAAGTTGACTCTGGTCATGCTCTCCATCTTCCCGGCTCTCGTCGGTTCTGCCTTCGGCGAGAACTTGTTTTTGAAAGGATTCGCAGGAGACGTGGCCAAAGCGTACGCGAGAGCCACGCAAGTCGCGGGAGAGGCCGTGGCGAACATCAGAACGGTGGCCGCATTCAACGCCGAGGACAAAGTGAGGGGCCTGTTCGATCAAGAGCTGGTGGGTCCGAACAAGCGCAGTTTCTACAGGGGACAGGTCGCAGGCTTCGGTTTCGGGATCTCGCAATTGTTCATGTACGGCTCGTACGGGCTAGGATTGTGGTACTCCGGCAGATTGGTGCAGAAAGGGGAGGCGCAGTTTGGAGACGTGATCAAAGTTTTCCTGGTGCTCATCGTCTCGGCGTTCGCCGTGGCTGAGACTCTGGCCCTCACACCGGACTTCGTAAAAGGAAGTCAAGCCGTGGGGTCGGTGTTCGAGGTTCTCGACCGCAAGACGGCAATCGACCCCGAAGATTCCAGCGTTGAGAAAGTGGAGAAGATGACGGGGGAGATCGAGCTGAAGCACGTCGCCTTCGCATATCCCTCCAGGCCCGACGTGATTATCTTCAAGGATTTGAACTTGAGAGTGCGCTCCGGCCAGAGCCTTGCGCTGGTGGGCTCCAGCGGCTCGGGCAAAAGCTCGGTCATAGCTCTCCTCGAGAGATTCTACGATCCCTTGTCCGGACGGGTCATGATCGACGGGAAAGACATTCGCTCGTACAACTTGAAGTCTCTCCGCCAGCACATCGCCCTCGTGCAACAAGAGCCTGCGCTTTTCGCCACCACCATCTATGAAAACATCGTCTACGGAAGAGCCGGAGCCTCGGAGGCCGAAGTGATCGAGGCAGCAAAAGCTGCCAATGCTCACAACTACATCAGTGGTCTGCCGATGGGGTACCAAACGGAGGTCGGGGAACGAGGGGTGCAGCTCTCTGGAGGTCAGAAACAGAGAGTGGCCATCGCCAGAGCCGTGCTGAAGGACCCGGCCATCCTGCTCCTGGACGAGGCTACGTCTGCTTTGGATGCCGAGTCTGAGAAGATCGTGCAGGAGGCCCTGGATCGGCTGATGAACAACAGGACGACCGTCATGATCGCCCACAGACTCTCCACAATCCGCAACGCGCACTCCATTGCCGTGATTCAAGAGGGAACCATCCTGGAGCAAGGGTCTCACGCCGAACTTTTGTCGAAGAACGGGGGTTACTCCCGTTTGATCAATTTACAAAACAATAGCCAAGACAACGAATGATCTGAACGCAGCATCTCGTAGAAATGAGCATCGACACGAACTAACATATTGTGAATCTAAACCTCACCATCGGCAACCTTCAACCTCCACGACCCTTCGTTGCGAAGGGGATGATGCAATAGTGTACAATATGTTCATACTGTCCGCAGTTGTAATTAGTCATCTCTCTTCGCCCGACAGCCAACCTGTCCCGCCCCTTTACGGAGCGCTCTGGATTCCCCATCTCCACTGCTTTTCCTTGAGACCATCTCCAACACCTGTCCTCTAAGCCCCGCTAGTCGAAGAGAAAGAGCTACTTGGTGATTTTTTTCAACCTTGCCTTGCCTCGTTGAGGTGAGTAACTAGGCTATACGAATTCAGCTAATTGTTGGTCACTTAGCATCTATTCAAAGATGTGTAATACGCAGGTCCCAATTGGTTTTTCAATCTGAAATTGAACAGACCGATTTATAACGCAGGCATGTGCGTGTGACGTTAGCAATGTGACGAGTATTGTCGATTGATTATTGGTCTCACTGCGGAAGATATCCGTGCTTGCGTTCTGGTCGTCAGTGTCAGAAGTGACCTTCGAGCAAACAGAGGCGACGAGCCCCCTGTTGAAATACAAACGGATTTTGATCTCCAAGAGTGCAACAGCGCAAGAACGCTATTATGAATCTCTCGTAGTCCACTCAATGAAAGAGTCACTCTGCGACGAATCCGAGATGGACGAGTTCCT

CDS

>Mapoly0037s0014.1
ATGCCCGCAACGGGGGAGATGACGGGCTCGGGAGTGGATGAGAGTGAGCGGATGGAAGCAGCCAATGTCACAGGTCGAGATGGCGGCGGGGTGGAGAAGAGTGGAGCTCTGATAGCCGTTGCGGAGGTGGGTGAAGTCGACGGGAAAGGAAAGAAGAAGACGAAGGGGAAGAAGGAGAAGGGCGATGAAGCTGAGCCTATTCCGCAGGTGTCCTTCTTCCGGCTCTTCGCCTTCGCCGACGGCTTGGACATCATTCTCATGGTGTTCGGCACGCTCGGCGCTATAGTCCACGGCGCAGCTCTTCCGGTCTTCTTTCTGTTTTTTGGAAAACTGCTCAATGGTATCGGAGGGAGCATTAGTCCCGAAATCGGTAAACAAACCGTCGACAAGTATTCGTTGTACTTTCTATGGCTCGGTTTGGCGACACTCTTCTCATCGTGGATGGAGGTTTCGTTTTGGATGCAAACCGGAGAGAGGCAGTCTGCAAGATTGAGAGCGAAGTATTTGGAAGCATTGTTGAAGCAAGATGTCGGATTTTTCGACACCGACACCAGTACGGGAAAATTCGTCCAGAGCATCTCTTCCGACCCCCTGATGGTTCAGGATGCAATCAGCGAGAAGATGGGAAATTTCGTGCATTACATGTCGACGTTCGTAGCGGGCTTCGTCGTGGGATTCGTTAACGAGTGGACCATAGCTGTGGTGACTCTGGCAGTTTTGCCTCTCATTGCTGCGGCAGGAGGCTACTACGCTATTGCACTGACGGGATTGACGAGCAAAAGTGCAGAAGCCTACGAAAGAGCCGGAAGCATCGCTGAGGAGACGATCGGCCAAGTTCGGACCGTCTACTCTTTCGTCGGCGAGCAGAGATCCGTCCAGCATTACAGCCTTTCTCTGGAGAGCACTCTGAAGCTCGGCTACAAATCGGGCTGGGCCAAGGGAATTGGAATGGGTGGCACTTACGGAGTTCTCTTCGGCTGCTGGGCCTTGCTTCTGTGGTACGGAGGTACCCTGGTGCGCAAGGGGAATCTCAATGGAGGCGAGGCTCTCTCGTCCATCTTTCCTGTCATCATCGGAGGCCTGTCTCTGGGGCAAGCGATGCCGAATGTGTCGGCCTTCGGCAAAGGGAGGGCCGCTGCCTACAAGATTTTCCAGATGATCGATCACGAACCCACGATCAACAAGGTCGACCCGACGGCCAAGAGGCTCGAGTCGGTCCAAGGGCTCATCGAACTTCGTAATGTGGAATTCGTGTACCCGTCGAGGCCCGACACGAAAATTTTCCAGGATTTTTCTCTCGTCATTCCTCCCGGGAAGACGGTCGCCATCGTGGGCAGCAGTGGATCCGGCAAGAGTACCGTGGTGTCCCTCATCGAGCGTTTTTACGACCCTATCGGAGGGCAGGTTTTGTTGGACGGGCATGATCTTAAGAGCTTGGACCTGAAGTGGCTCCGAGGGCAAATCGGGCTCGTCAACCAGGAGCCCGCCCTGTTCGCAACGACAATAGCGGCGAATATCCTCTACGGGAAGGAAGGAGCCAGCGAGAAGGAAATCGAGGAAGCAGCAAAAGCCGCTAATGCTCATTCTTTCATTGACCAGCTTCCACAACGTTACATGACACAGGTCGGGGAGAGAGGAGTGCAGTTGTCTGGAGGACAGAAGCAGCGTGTGGCAATAGCCAGAGCTATGCTGAAGAACCCCACGGTTTTGCTGCTGGATGAGGCTACCAGTGCACTGGATGCTGGGTCCGAGCAGATAGTGCAAGAAGCACTGGACCGTCTGATGGTGGGAAGGACGACTGTTGTGGTCGCCCATCGTCTGTCCACTATCCGGAATGCCGACTCCATCGCGGTGGTTCAAGAAGGGCGCATCGTGGAGAGAGGGAACCACGCAACTCTCATCGCGGACCCCAATGGAGCGTACACTGCCCTCGTCCGCCTTCAGGAGATGGCAGCAACCAGAGGAGATGGCGGCAGCATGAAACGAGCCACATCCGGCAGACAATCCCAAATCAGCTTATCACGAAGTGAATCTCGCGGTGGATCTCGACGTACTTCTCGAGGTGCATCGTTCTCGTTGTACAGAAGTGGATCTGTTCGGTCGACGACCAGCGTCGAGGAGTCGGATGTGGGAACACGAGAGATCGACCTTCCGCCTCCTCCTCCCCCTCCCAAAGCTACACTTAAGCGTCTCATAGCAATGAGCAAGCAGGACTGGATATACGGCGTCTTTGGAGCCATAGGATCGATCTTAGCAGGAGCTATTAACCCGGCATTCGCACTCATCATCAGCCAGGTCCTGAATGCCTACTACAACCCGGACTTCGGGGCCATGAAGACGGAGGTTTCCAAGTGGGCCCTCGTGTTTGTGGGGGTCGGTGTAGCCTCGCCTTTCGTCTACGTTTGTCAGCATTACTCGCTGGGAGTTTTTGGCGAGAATTTGGTGAAGAGCGTCCGCGTGAAGATGTTCTCATCGATTCTGCGCAACGAAATGGCATGGTTCGACCGGGATGAGAACAACAGCAGTCGGGTGGCGGCTCGTCTTTCGTCCGATGCCACGCAAGTGAGGGCAGCTCTCGGGGACCGCTTGGCGGTGATTCTGCAAAACGCCTCTCTTATGACCATCGCCGTCGTCATCTCGTTCGTTCTGCAATGGAAGTTGACTCTGGTCATGCTCTCCATCTTCCCGGCTCTCGTCGGTTCTGCCTTCGGCGAGAACTTGTTTTTGAAAGGATTCGCAGGAGACGTGGCCAAAGCGTACGCGAGAGCCACGCAAGTCGCGGGAGAGGCCGTGGCGAACATCAGAACGGTGGCCGCATTCAACGCCGAGGACAAAGTGAGGGGCCTGTTCGATCAAGAGCTGGTGGGTCCGAACAAGCGCAGTTTCTACAGGGGACAGGTCGCAGGCTTCGGTTTCGGGATCTCGCAATTGTTCATGTACGGCTCGTACGGGCTAGGATTGTGGTACTCCGGCAGATTGGTGCAGAAAGGGGAGGCGCAGTTTGGAGACGTGATCAAAGTTTTCCTGGTGCTCATCGTCTCGGCGTTCGCCGTGGCTGAGACTCTGGCCCTCACACCGGACTTCGTAAAAGGAAGTCAAGCCGTGGGGTCGGTGTTCGAGGTTCTCGACCGCAAGACGGCAATCGACCCCGAAGATTCCAGCGTTGAGAAAGTGGAGAAGATGACGGGGGAGATCGAGCTGAAGCACGTCGCCTTCGCATATCCCTCCAGGCCCGACGTGATTATCTTCAAGGATTTGAACTTGAGAGTGCGCTCCGGCCAGAGCCTTGCGCTGGTGGGCTCCAGCGGCTCGGGCAAAAGCTCGGTCATAGCTCTCCTCGAGAGATTCTACGATCCCTTGTCCGGACGGGTCATGATCGACGGGAAAGACATTCGCTCGTACAACTTGAAGTCTCTCCGCCAGCACATCGCCCTCGTGCAACAAGAGCCTGCGCTTTTCGCCACCACCATCTATGAAAACATCGTCTACGGAAGAGCCGGAGCCTCGGAGGCCGAAGTGATCGAGGCAGCAAAAGCTGCCAATGCTCACAACTACATCAGTGGTCTGCCGATGGGGTACCAAACGGAGGTCGGGGAACGAGGGGTGCAGCTCTCTGGAGGTCAGAAACAGAGAGTGGCCATCGCCAGAGCCGTGCTGAAGGACCCGGCCATCCTGCTCCTGGACGAGGCTACGTCTGCTTTGGATGCCGAGTCTGAGAAGATCGTGCAGGAGGCCCTGGATCGGCTGATGAACAACAGGACGACCGTCATGATCGCCCACAGACTCTCCACAATCCGCAACGCGCACTCCATTGCCGTGATTCAAGAGGGAACCATCCTGGAGCAAGGGTCTCACGCCGAACTTTTGTCGAAGAACGGGGGTTACTCCCGTTTGATCAATTTACAAAACAATAGCCAAGACAACGAATGA

Protein

>Mapoly0037s0014.1
MPATGEMTGSGVDESERMEAANVTGRDGGGVEKSGALIAVAEVGEVDGKGKKKTKGKKEKGDEAEPIPQVSFFRLFAFADGLDIILMVFGTLGAIVHGAALPVFFLFFGKLLNGIGGSISPEIGKQTVDKYSLYFLWLGLATLFSSWMEVSFWMQTGERQSARLRAKYLEALLKQDVGFFDTDTSTGKFVQSISSDPLMVQDAISEKMGNFVHYMSTFVAGFVVGFVNEWTIAVVTLAVLPLIAAAGGYYAIALTGLTSKSAEAYERAGSIAEETIGQVRTVYSFVGEQRSVQHYSLSLESTLKLGYKSGWAKGIGMGGTYGVLFGCWALLLWYGGTLVRKGNLNGGEALSSIFPVIIGGLSLGQAMPNVSAFGKGRAAAYKIFQMIDHEPTINKVDPTAKRLESVQGLIELRNVEFVYPSRPDTKIFQDFSLVIPPGKTVAIVGSSGSGKSTVVSLIERFYDPIGGQVLLDGHDLKSLDLKWLRGQIGLVNQEPALFATTIAANILYGKEGASEKEIEEAAKAANAHSFIDQLPQRYMTQVGERGVQLSGGQKQRVAIARAMLKNPTVLLLDEATSALDAGSEQIVQEALDRLMVGRTTVVVAHRLSTIRNADSIAVVQEGRIVERGNHATLIADPNGAYTALVRLQEMAATRGDGGSMKRATSGRQSQISLSRSESRGGSRRTSRGASFSLYRSGSVRSTTSVEESDVGTREIDLPPPPPPPKATLKRLIAMSKQDWIYGVFGAIGSILAGAINPAFALIISQVLNAYYNPDFGAMKTEVSKWALVFVGVGVASPFVYVCQHYSLGVFGENLVKSVRVKMFSSILRNEMAWFDRDENNSSRVAARLSSDATQVRAALGDRLAVILQNASLMTIAVVISFVLQWKLTLVMLSIFPALVGSAFGENLFLKGFAGDVAKAYARATQVAGEAVANIRTVAAFNAEDKVRGLFDQELVGPNKRSFYRGQVAGFGFGISQLFMYGSYGLGLWYSGRLVQKGEAQFGDVIKVFLVLIVSAFAVAETLALTPDFVKGSQAVGSVFEVLDRKTAIDPEDSSVEKVEKMTGEIELKHVAFAYPSRPDVIIFKDLNLRVRSGQSLALVGSSGSGKSSVIALLERFYDPLSGRVMIDGKDIRSYNLKSLRQHIALVQQEPALFATTIYENIVYGRAGASEAEVIEAAKAANAHNYISGLPMGYQTEVGERGVQLSGGQKQRVAIARAVLKDPAILLLDEATSALDAESEKIVQEALDRLMNNRTTVMIAHRLSTIRNAHSIAVIQEGTILEQGSHAELLSKNGGYSRLINLQNNSQDNE

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>