Mapoly0038s0058



Description

STEROL REGULATORY ELEMENT-BINDING PROTEIN

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_153175
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR12565 STEROL REGULATORY ELEMENT-BINDING PROTEIN
PANTHER PTHR12565:SF70

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH15 transcription factor, bHLH Mapoly0038s0058.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0038s0058.1 scaffold_38:1009841..1015184  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0038s0058.1  

Gene structure:

mRNA scaffold_38:1009841..1015184  ( + strand )
five_prime_UTR scaffold_38:1009841..1011084  ( + strand )
CDS scaffold_38:1011085..1012497  ( + strand )
CDS scaffold_38:1012849..1013079  ( + strand )
CDS scaffold_38:1013197..1013262  ( + strand )
CDS scaffold_38:1013422..1013490  ( + strand )
CDS scaffold_38:1013682..1013753  ( + strand )
CDS scaffold_38:1013918..1014136  ( + strand )
CDS scaffold_38:1014291..1014375  ( + strand )
CDS scaffold_38:1014535..1014572  ( + strand )
three_prime_UTR scaffold_38:1014573..1015184  ( + strand )

Sequences:

Gene

>Mapoly0038s0058.1
GCGAGATTTGTGACCGGGGCGGCGGAGGAGCTCGGCTTTCTTTCTTCCTCTCACGTATCCTGTCCTCGCTCGCAGAGGAGAGGAGAGTGAAAGAGAGGAGAGGAGGAAGCGAAGAGAGCGTGGCGGTCTTTCCCACTGGCTCTCCTGCTCTCTCCTCTGCTGCTCTCTGCTCAGTAGTGAGTGTCTGGCGTTTGTTGGGTTGTTTCGTTGGGTTGTTGTTAAGTTACATTTATCTCGTCCTCTTTTTCTCGCCCTTCTACCCTACGCTTGTCACGGAGGGAGAGCAGGGCAGTGGTCTCGGAATTTGTGTATAAAAATATAATATGAGTCCAGTATCTCGCTTTGCCGACAGGACCTGGGAACAAGCGGAGAGCTGAGGAGAGGAGAGGAGACGAGAGGTGAAGAGAGAAGAGAGAAGAGTGGCGAAGAGAGAGAAAGCCCGGCGAGGCAGGGCGAGGTGTGAAGTGAAGTGAAGTGAAGTGAAGAATTGTTGATCGCATTGCATTGTGTAAGACCGGAAGTTTAGAGTAGAGAAGGGCAGCAGCCGCGCGGTGATTCGTCATGCGGTTTGTTGTTGGAGTCCTGCGCCTCCTCGCCCGCATGCAATTAGCCAGTAGCGAGCTGATGGGAGATACGTTCGGCTCCAACAAGACTGTATCATAGCTCGAGGGGTGTGTGTAGGAGATTTGTGTACGATGTGTGTTGGGTAGAAGGTTTTTTCGAAAATTTATTCTCCGTGACACCTGTTTCGGAATCCCTGCCTTCGTACTTTCCGAGAAAAGGGAGCTAATGGCAATTGAGCACTCTAGTTCTTTCTGATTAATGCTTCTGCCTCTCAGTACCTTTACTTCTACTCGTCGCACTTCTCGATTCTCACGTCTCTCTGCGCCCTCCGTTATCTGATTTGTACTCGCGCGCTGCTCTCTCCATCTCTCTCACTCTCTCCCTCTCCCTCTCTCACTCTCTCTGTTGGAAAGAACGAACGGCGGTGCTATAGAGGAAATATAGAGGGCTGCTCGTGGCAGCTTGAACAGCTAGCAACAGAGCCTGTCTCCGAACAATCGAGGGACTGCTACGATGAGTATGCGTTGTCGATGCAAATTGAGTGTGCAAGCTACCCAATCTCTGGCAAAGAGAAGAGAAATTGCCGTGCTCGCGACCGTGTACTCTGAGGGAGAAGTATGATCAGCCGCCTGTAACTGAGGAATACTGGCGGCTGCCGCAAGAGTTTTCGAGTTTATGAAATGGCATCCATGGGCCAAGCAGATCACCTTCCCACACCTTGTCATCTCAATGGCATTTCCCGGCTGAACTGCTCTCCACCAACTGGTGCACTCAACTCAACTCCAATCTCCTCATTCTCGAACGCTCTGGCCGCCAACGATTACCGCGAGAAGTACACGATGGAGATGCACTCGGGATATGGCAGATTTTTCCGAAACGGCTCATCCGGCTACGGGAACCAGCCGTCGGAGATGGCCCAAGTGTGGCAGCTCGCAGGTCCAGCGGCAGAGATGCACGCTCTGGCGCAGCAGGAGAACAGCATGCGAGCAGCAGCAGCTGCGAACGGGATGGTGGCCAACGAATGCGGCTCGGACGCAGCCAGTCGAGGATCGCCGGGGCTACTGCCCACGTCGTCGTCCGAGCTGTATGGCAGCACGGTGGTGAGCGGCGACTGGGACCAGTTCGTGGATTCCAGCGTGCGCTACCAATCCGTGCTCTCGTCCTCGTCCAGTCCGCTCTCGCACAACAGCCCGCACGCCGGCGGCAGCCGCGCGGCGAATGAGGGCGCCATGATTCGCGAGCTCATCGGGCGCCTCGGAGGAAATGGCAACGGGGTCGCGTCGCTCGGAGGCTCGCCTCTCGTGGCGAGTCCACAGCGCTCAGGAACAGGGATGGACAAGGCGCTCAAGCTCGCGACCGGCTGGGGCTCGGGGGATGCGGCCAACTCCATGGGCCTTACCGTCGATCCCTCCAAGGGCGCGCTGGCTCTGCCCGGCGTGGGCCTGGCCGCCTCGCACTGCCTGGCGCATTTCGCCTCTGATCCAGGATTCGCCGAGCGCGCGGCCCGCTTCTCGTCCTTCAGCAACGGCAATTACTCGCAGCCGTTCCCAACGTCCGACGGCGGCAAGGCCCGGTCCAGGCAGGGCAGCGCCCAATCGTCCGACGCAACCAATAACAGGCAGCTGCCGAAGACTTCCAGTTGCCCGTCCATGAGCGACACCGCTGCCGGAGCCAAAAGTCCCAAGGACGATCCGGCCTCGTCCGACATCGACGACCCCGCTCCGGAGCCCGGCGCCGGGGCGGCGGGCGCTGGAGCCGATATGGAGCAGTACGCGCGCGATGGAGACGTTGGGGTCAAGGCAGGGGACAAAAATCTGTGTAGGACTGCGAGCAGTGTCGCCGCGGGCGACGACGACGAGAGAATGCAAGCTGCGTCGCCCGTCGACGAGGCGAACGACGCCGATGAGGCCACCACCGTCGCGCAAGACATGTCCAGCGTTGGGGACGCCCCCGGCGAGACTTGCCCGTCGGGCGTCACCCATGTGACCACCGCCACCGAGAATCTTGTCAAGAAACGGAAGAGCACCCCCGACGAGAAGTCCAAGGATGCCACATCCGTCACTGTGTCGTCTCCAGGAGTGCGCGAGACCAAAGTAAGTGTCTCCCATCACCCGCAGGCAGAGTGATTCTTGTCTCGTGGCTTCGAGGAGCCGAGTTCAGTCGGTCTGTCGCAGTAGTCATTACCAGGCGTCCTCTGATTATGCATACTCTGTAGATCTTGCAATCGCGGCACCTTCCGCAATTCTGATCCTCCCCGGAGGAAGAGCGAGGGTCCAATTCTCACAAGAGCAAGTCCGCGACCTCGTGTTTCCGACCGCTTCTGGATTGAGTCCGGCTATTTGATGACTCGCCATGCACTGGATTTGGATACAGTATTTCGCATGCATTGGTCTTCGAATCCGTGTTCTAATCAGTTGACTCTGGCATATTGTCGTCGGCCACAGACATCGGACAGTGATGATGTGAAAGCCAAACGGTTCAAGCGTGGGGATGCTTCGAAAGACAAGGATGATGTGAAGCCCAAGGTAGAGAGGAGCAGTAGTGAGACTTCGGGGGAAACCAGTCCTCGATCGACGAAAGACCACTCCAAGCCTCAGGAACCGCCCAAGCCGGACTATATTCACGTGAGAGCGAGACGAGGCCAAGCCACCGACAGCCACAGTCTTGCCGAGAGGGTGAGATTCCGTCCCACGAACCCATCTGGGTCGCTCTGAATCTGATGTGCCATGTTTTCACGAGCCGTAAGAAGGTCTATGTACAGAGTCTGACGGACTGGTCGTTTGTCAATTCAGGTGCGTCGAGAGAAAATCAGTGAGCGCATGAAGTTCCTGCAAGATCTTGTGCCAGGCTGCAGCAAGGTGATTGACCCATATCCGCTCTATCAACGCAAACCCATCAAAATTTCACTTTCATGTTACAGCCGCGGAAATAGTTTTATGGTTACCGTATCAAAAGATAAGCTTTTACTCGTTTCGGCATCAGCTGTTTTCTCACCCAAACGTGTCTCTTCACTACAGGTCACGGGGAAAGCTGTGATGCTTGATGAAATAATCAATTATGTGCAATCCTTGCAGCATCAAGTTCAGGTAGCTTCCTGACTCCAATCTTTCGTTCTCGGCTCTTACGTCAAGCCATTAAGACTCTTTCGTCATTTGTCAGCAGCATTTGGCTTATTCTGTATGCGATTTATGTGATGGGATGAAGTTTAGGCAGTCGATTTCCGAGAGAGTAGTAATGTAATGTCCTGACATCGGATCATCGTTCTTCTCATTTGCAGTTTCTCTCGATGAAATTGGCCGCGGTTAATCCACGTCTAGACTTCAACATAGAGAACCTGCTTGCCAAAGAGGTAAATGCGAGGCCGTGTCAGTGCGCAGTCTACTCATCGCCACATAGGTGCTTCTGTTATCAGTCCCGCTTGAGGATGGCGTCTCCTGCATACGCGACCAGTCGGTCAGTCAGTCAGTCACGGTCTTCGTCCGCCCACTAACCCGATCTCTCTCGTTCGTCCAGGTTTCGCGATCTCAGGGAATGATAATGGGACCCGAGACGTCCTATCCTCAACTTCATCCACCGCATCAGCCCCAATTACAGCATGGAGTACCATGTGGACTGGAATACCCAGTTCAGTCATTGGGGAATCCCTCACAGGTGGCTCTCAGAAGATCCATAAGCGCTCCCATTCCCGCCGTAATCCCTCGTGAAGATGGGTTCGCGGATGGCGTGCCCACGGTATGAGATTTGCATCCAATTCCAGCTGTCTGTTGTCGGCCGAGTCGACTAGATTGTTGAAGCCGCAATTATCGACTCTGATAGCAAAATTTTCGAATCGTCGAAATTCTACGCGTCCTAACACGAGCTGACCTCCCTCTCCGTTGTCGTACAGGGTGTATGGGATGACGGTGAGCTACAAAGCATTGTCATGGGTTTCGGACAACTCCGTTCATTGTCATCTCAGGCACTACTACATGGTAATGTGACAAATCTCTCGACTGGTGGTGTTCCAAGCAAGTGGTCCAAATTTCATCCTAAGCGGAATTCCCATTTCTGAATAGGCAGAATTTCTTGTGAGGAATGTCACCAAATCGAATCTGGGCAAGGAACTGACGGAAATCCGCGCTGTTTTGCAGGACATCTTCCACCTGGACATATGAAGGTTGAGCTATGATAGTGTACCTGATCTTCTTTTTTGTGATTAATGTGCATCAGCTGGAAATACGAGAAAATTTTTACGATACTATAGAACTTGAGAAGTACCGGGCACGGAGTTCTGGCATGGCATAAATGCCAGAGGCGTGTACAACTAGTTCGTCTTCTCAGTCTTCACAGTTCCCGACTTATTGAGTGAAGCCACCACTTTGCTGAACCAGAAACTTGTGATCTCCGTCAGTGTAAAATAGAACGGGAGTAAGTCACGGAGTGATGTTTTTGGGAAATGTGGAGAGGGATTGTGACACCTGAGAGGTTTGTACGAGTCACATATCTCCATCTCTATCATAGACCTTGGAGAGAGTGCTTTAGAAAGAAAGGGTGCTCCTTGGGTCCTAAAGCAATGGAAATCAAACCATTTATCAGGGGCCGTTATGCTAAGCTGTACTGGTGTGTGGGAATGATCCAAGAGTTTCTAGGTGAAGTTGCATACTGTAATACTAAGTACCTTACATTTAAAATTTTACATCTTTGATGTAGCAACCTATCCGTAGTCCACTCCTCAAACTGTATATCAACCGAACTGTCACCCTTTTGTTCATAAATTTTTTTTCTATGTATCTATCTGGGT

mRNA

>Mapoly0038s0058.1
GCGAGATTTGTGACCGGGGCGGCGGAGGAGCTCGGCTTTCTTTCTTCCTCTCACGTATCCTGTCCTCGCTCGCAGAGGAGAGGAGAGTGAAAGAGAGGAGAGGAGGAAGCGAAGAGAGCGTGGCGGTCTTTCCCACTGGCTCTCCTGCTCTCTCCTCTGCTGCTCTCTGCTCAGTAGTGAGTGTCTGGCGTTTGTTGGGTTGTTTCGTTGGGTTGTTGTTAAGTTACATTTATCTCGTCCTCTTTTTCTCGCCCTTCTACCCTACGCTTGTCACGGAGGGAGAGCAGGGCAGTGGTCTCGGAATTTGTGTATAAAAATATAATATGAGTCCAGTATCTCGCTTTGCCGACAGGACCTGGGAACAAGCGGAGAGCTGAGGAGAGGAGAGGAGACGAGAGGTGAAGAGAGAAGAGAGAAGAGTGGCGAAGAGAGAGAAAGCCCGGCGAGGCAGGGCGAGGTGTGAAGTGAAGTGAAGTGAAGTGAAGAATTGTTGATCGCATTGCATTGTGTAAGACCGGAAGTTTAGAGTAGAGAAGGGCAGCAGCCGCGCGGTGATTCGTCATGCGGTTTGTTGTTGGAGTCCTGCGCCTCCTCGCCCGCATGCAATTAGCCAGTAGCGAGCTGATGGGAGATACGTTCGGCTCCAACAAGACTGTATCATAGCTCGAGGGGTGTGTGTAGGAGATTTGTGTACGATGTGTGTTGGGTAGAAGGTTTTTTCGAAAATTTATTCTCCGTGACACCTGTTTCGGAATCCCTGCCTTCGTACTTTCCGAGAAAAGGGAGCTAATGGCAATTGAGCACTCTAGTTCTTTCTGATTAATGCTTCTGCCTCTCAGTACCTTTACTTCTACTCGTCGCACTTCTCGATTCTCACGTCTCTCTGCGCCCTCCGTTATCTGATTTGTACTCGCGCGCTGCTCTCTCCATCTCTCTCACTCTCTCCCTCTCCCTCTCTCACTCTCTCTGTTGGAAAGAACGAACGGCGGTGCTATAGAGGAAATATAGAGGGCTGCTCGTGGCAGCTTGAACAGCTAGCAACAGAGCCTGTCTCCGAACAATCGAGGGACTGCTACGATGAGTATGCGTTGTCGATGCAAATTGAGTGTGCAAGCTACCCAATCTCTGGCAAAGAGAAGAGAAATTGCCGTGCTCGCGACCGTGTACTCTGAGGGAGAAGTATGATCAGCCGCCTGTAACTGAGGAATACTGGCGGCTGCCGCAAGAGTTTTCGAGTTTATGAAATGGCATCCATGGGCCAAGCAGATCACCTTCCCACACCTTGTCATCTCAATGGCATTTCCCGGCTGAACTGCTCTCCACCAACTGGTGCACTCAACTCAACTCCAATCTCCTCATTCTCGAACGCTCTGGCCGCCAACGATTACCGCGAGAAGTACACGATGGAGATGCACTCGGGATATGGCAGATTTTTCCGAAACGGCTCATCCGGCTACGGGAACCAGCCGTCGGAGATGGCCCAAGTGTGGCAGCTCGCAGGTCCAGCGGCAGAGATGCACGCTCTGGCGCAGCAGGAGAACAGCATGCGAGCAGCAGCAGCTGCGAACGGGATGGTGGCCAACGAATGCGGCTCGGACGCAGCCAGTCGAGGATCGCCGGGGCTACTGCCCACGTCGTCGTCCGAGCTGTATGGCAGCACGGTGGTGAGCGGCGACTGGGACCAGTTCGTGGATTCCAGCGTGCGCTACCAATCCGTGCTCTCGTCCTCGTCCAGTCCGCTCTCGCACAACAGCCCGCACGCCGGCGGCAGCCGCGCGGCGAATGAGGGCGCCATGATTCGCGAGCTCATCGGGCGCCTCGGAGGAAATGGCAACGGGGTCGCGTCGCTCGGAGGCTCGCCTCTCGTGGCGAGTCCACAGCGCTCAGGAACAGGGATGGACAAGGCGCTCAAGCTCGCGACCGGCTGGGGCTCGGGGGATGCGGCCAACTCCATGGGCCTTACCGTCGATCCCTCCAAGGGCGCGCTGGCTCTGCCCGGCGTGGGCCTGGCCGCCTCGCACTGCCTGGCGCATTTCGCCTCTGATCCAGGATTCGCCGAGCGCGCGGCCCGCTTCTCGTCCTTCAGCAACGGCAATTACTCGCAGCCGTTCCCAACGTCCGACGGCGGCAAGGCCCGGTCCAGGCAGGGCAGCGCCCAATCGTCCGACGCAACCAATAACAGGCAGCTGCCGAAGACTTCCAGTTGCCCGTCCATGAGCGACACCGCTGCCGGAGCCAAAAGTCCCAAGGACGATCCGGCCTCGTCCGACATCGACGACCCCGCTCCGGAGCCCGGCGCCGGGGCGGCGGGCGCTGGAGCCGATATGGAGCAGTACGCGCGCGATGGAGACGTTGGGGTCAAGGCAGGGGACAAAAATCTGTGTAGGACTGCGAGCAGTGTCGCCGCGGGCGACGACGACGAGAGAATGCAAGCTGCGTCGCCCGTCGACGAGGCGAACGACGCCGATGAGGCCACCACCGTCGCGCAAGACATGTCCAGCGTTGGGGACGCCCCCGGCGAGACTTGCCCGTCGGGCGTCACCCATGTGACCACCGCCACCGAGAATCTTGTCAAGAAACGGAAGAGCACCCCCGACGAGAAGTCCAAGGATGCCACATCCGTCACTGTGTCGTCTCCAGGAGTGCGCGAGACCAAAACATCGGACAGTGATGATGTGAAAGCCAAACGGTTCAAGCGTGGGGATGCTTCGAAAGACAAGGATGATGTGAAGCCCAAGGTAGAGAGGAGCAGTAGTGAGACTTCGGGGGAAACCAGTCCTCGATCGACGAAAGACCACTCCAAGCCTCAGGAACCGCCCAAGCCGGACTATATTCACGTGAGAGCGAGACGAGGCCAAGCCACCGACAGCCACAGTCTTGCCGAGAGGGTGCGTCGAGAGAAAATCAGTGAGCGCATGAAGTTCCTGCAAGATCTTGTGCCAGGCTGCAGCAAGGTCACGGGGAAAGCTGTGATGCTTGATGAAATAATCAATTATGTGCAATCCTTGCAGCATCAAGTTCAGTTTCTCTCGATGAAATTGGCCGCGGTTAATCCACGTCTAGACTTCAACATAGAGAACCTGCTTGCCAAAGAGGTTTCGCGATCTCAGGGAATGATAATGGGACCCGAGACGTCCTATCCTCAACTTCATCCACCGCATCAGCCCCAATTACAGCATGGAGTACCATGTGGACTGGAATACCCAGTTCAGTCATTGGGGAATCCCTCACAGGTGGCTCTCAGAAGATCCATAAGCGCTCCCATTCCCGCCGTAATCCCTCGTGAAGATGGGTTCGCGGATGGCGTGCCCACGGGTGTATGGGATGACGGTGAGCTACAAAGCATTGTCATGGGTTTCGGACAACTCCGTTCATTGTCATCTCAGGCACTACTACATGGACATCTTCCACCTGGACATATGAAGGTTGAGCTATGATAGTGTACCTGATCTTCTTTTTTGTGATTAATGTGCATCAGCTGGAAATACGAGAAAATTTTTACGATACTATAGAACTTGAGAAGTACCGGGCACGGAGTTCTGGCATGGCATAAATGCCAGAGGCGTGTACAACTAGTTCGTCTTCTCAGTCTTCACAGTTCCCGACTTATTGAGTGAAGCCACCACTTTGCTGAACCAGAAACTTGTGATCTCCGTCAGTGTAAAATAGAACGGGAGTAAGTCACGGAGTGATGTTTTTGGGAAATGTGGAGAGGGATTGTGACACCTGAGAGGTTTGTACGAGTCACATATCTCCATCTCTATCATAGACCTTGGAGAGAGTGCTTTAGAAAGAAAGGGTGCTCCTTGGGTCCTAAAGCAATGGAAATCAAACCATTTATCAGGGGCCGTTATGCTAAGCTGTACTGGTGTGTGGGAATGATCCAAGAGTTTCTAGGTGAAGTTGCATACTGTAATACTAAGTACCTTACATTTAAAATTTTACATCTTTGATGTAGCAACCTATCCGTAGTCCACTCCTCAAACTGTATATCAACCGAACTGTCACCCTTTTGTTCATAAATTTTTTTTCTATGTATCTATCTGGGT

CDS

>Mapoly0038s0058.1
ATGGCATCCATGGGCCAAGCAGATCACCTTCCCACACCTTGTCATCTCAATGGCATTTCCCGGCTGAACTGCTCTCCACCAACTGGTGCACTCAACTCAACTCCAATCTCCTCATTCTCGAACGCTCTGGCCGCCAACGATTACCGCGAGAAGTACACGATGGAGATGCACTCGGGATATGGCAGATTTTTCCGAAACGGCTCATCCGGCTACGGGAACCAGCCGTCGGAGATGGCCCAAGTGTGGCAGCTCGCAGGTCCAGCGGCAGAGATGCACGCTCTGGCGCAGCAGGAGAACAGCATGCGAGCAGCAGCAGCTGCGAACGGGATGGTGGCCAACGAATGCGGCTCGGACGCAGCCAGTCGAGGATCGCCGGGGCTACTGCCCACGTCGTCGTCCGAGCTGTATGGCAGCACGGTGGTGAGCGGCGACTGGGACCAGTTCGTGGATTCCAGCGTGCGCTACCAATCCGTGCTCTCGTCCTCGTCCAGTCCGCTCTCGCACAACAGCCCGCACGCCGGCGGCAGCCGCGCGGCGAATGAGGGCGCCATGATTCGCGAGCTCATCGGGCGCCTCGGAGGAAATGGCAACGGGGTCGCGTCGCTCGGAGGCTCGCCTCTCGTGGCGAGTCCACAGCGCTCAGGAACAGGGATGGACAAGGCGCTCAAGCTCGCGACCGGCTGGGGCTCGGGGGATGCGGCCAACTCCATGGGCCTTACCGTCGATCCCTCCAAGGGCGCGCTGGCTCTGCCCGGCGTGGGCCTGGCCGCCTCGCACTGCCTGGCGCATTTCGCCTCTGATCCAGGATTCGCCGAGCGCGCGGCCCGCTTCTCGTCCTTCAGCAACGGCAATTACTCGCAGCCGTTCCCAACGTCCGACGGCGGCAAGGCCCGGTCCAGGCAGGGCAGCGCCCAATCGTCCGACGCAACCAATAACAGGCAGCTGCCGAAGACTTCCAGTTGCCCGTCCATGAGCGACACCGCTGCCGGAGCCAAAAGTCCCAAGGACGATCCGGCCTCGTCCGACATCGACGACCCCGCTCCGGAGCCCGGCGCCGGGGCGGCGGGCGCTGGAGCCGATATGGAGCAGTACGCGCGCGATGGAGACGTTGGGGTCAAGGCAGGGGACAAAAATCTGTGTAGGACTGCGAGCAGTGTCGCCGCGGGCGACGACGACGAGAGAATGCAAGCTGCGTCGCCCGTCGACGAGGCGAACGACGCCGATGAGGCCACCACCGTCGCGCAAGACATGTCCAGCGTTGGGGACGCCCCCGGCGAGACTTGCCCGTCGGGCGTCACCCATGTGACCACCGCCACCGAGAATCTTGTCAAGAAACGGAAGAGCACCCCCGACGAGAAGTCCAAGGATGCCACATCCGTCACTGTGTCGTCTCCAGGAGTGCGCGAGACCAAAACATCGGACAGTGATGATGTGAAAGCCAAACGGTTCAAGCGTGGGGATGCTTCGAAAGACAAGGATGATGTGAAGCCCAAGGTAGAGAGGAGCAGTAGTGAGACTTCGGGGGAAACCAGTCCTCGATCGACGAAAGACCACTCCAAGCCTCAGGAACCGCCCAAGCCGGACTATATTCACGTGAGAGCGAGACGAGGCCAAGCCACCGACAGCCACAGTCTTGCCGAGAGGGTGCGTCGAGAGAAAATCAGTGAGCGCATGAAGTTCCTGCAAGATCTTGTGCCAGGCTGCAGCAAGGTCACGGGGAAAGCTGTGATGCTTGATGAAATAATCAATTATGTGCAATCCTTGCAGCATCAAGTTCAGTTTCTCTCGATGAAATTGGCCGCGGTTAATCCACGTCTAGACTTCAACATAGAGAACCTGCTTGCCAAAGAGGTTTCGCGATCTCAGGGAATGATAATGGGACCCGAGACGTCCTATCCTCAACTTCATCCACCGCATCAGCCCCAATTACAGCATGGAGTACCATGTGGACTGGAATACCCAGTTCAGTCATTGGGGAATCCCTCACAGGTGGCTCTCAGAAGATCCATAAGCGCTCCCATTCCCGCCGTAATCCCTCGTGAAGATGGGTTCGCGGATGGCGTGCCCACGGGTGTATGGGATGACGGTGAGCTACAAAGCATTGTCATGGGTTTCGGACAACTCCGTTCATTGTCATCTCAGGCACTACTACATGGACATCTTCCACCTGGACATATGAAGGTTGAGCTATGA

Protein

>Mapoly0038s0058.1
MASMGQADHLPTPCHLNGISRLNCSPPTGALNSTPISSFSNALAANDYREKYTMEMHSGYGRFFRNGSSGYGNQPSEMAQVWQLAGPAAEMHALAQQENSMRAAAAANGMVANECGSDAASRGSPGLLPTSSSELYGSTVVSGDWDQFVDSSVRYQSVLSSSSSPLSHNSPHAGGSRAANEGAMIRELIGRLGGNGNGVASLGGSPLVASPQRSGTGMDKALKLATGWGSGDAANSMGLTVDPSKGALALPGVGLAASHCLAHFASDPGFAERAARFSSFSNGNYSQPFPTSDGGKARSRQGSAQSSDATNNRQLPKTSSCPSMSDTAAGAKSPKDDPASSDIDDPAPEPGAGAAGAGADMEQYARDGDVGVKAGDKNLCRTASSVAAGDDDERMQAASPVDEANDADEATTVAQDMSSVGDAPGETCPSGVTHVTTATENLVKKRKSTPDEKSKDATSVTVSSPGVRETKTSDSDDVKAKRFKRGDASKDKDDVKPKVERSSSETSGETSPRSTKDHSKPQEPPKPDYIHVRARRGQATDSHSLAERVRREKISERMKFLQDLVPGCSKVTGKAVMLDEIINYVQSLQHQVQFLSMKLAAVNPRLDFNIENLLAKEVSRSQGMIMGPETSYPQLHPPHQPQLQHGVPCGLEYPVQSLGNPSQVALRRSISAPIPAVIPREDGFADGVPTGVWDDGELQSIVMGFGQLRSLSSQALLHGHLPPGHMKVEL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>