Mapoly0039s0003



Description

Helix-loop-helix DNA-binding domain

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR16223 FAMILY NOT NAMED
PANTHER PTHR16223:SF19

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH14 transcription factor, bHLH Mapoly0039s0003.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0039s0003.1 scaffold_39:25538..31552  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0039s0003.1  

Gene structure:

mRNA scaffold_39:25538..31552  ( - strand )
three_prime_UTR scaffold_39:25538..26188  ( - strand )
CDS scaffold_39:26189..26416  ( - strand )
CDS scaffold_39:27044..27109  ( - strand )
CDS scaffold_39:27311..27376  ( - strand )
CDS scaffold_39:27551..27784  ( - strand )
CDS scaffold_39:28108..29634  ( - strand )
five_prime_UTR scaffold_39:29635..29853  ( - strand )
five_prime_UTR scaffold_39:30926..31552  ( - strand )

Sequences:

Gene

>Mapoly0039s0003.1
GGAGATGGCCTGAGGAGGTGAAGTCGGTGGTGTGGAGGAGTCGTTGTTTTGCGGCCCCTCGTCTTCAATATTTTGGTTATAACCCTCAATGCATCGCCCGTCCTCTCTTTCTTCCGTCAGAGTCTCTCTCCGCCCCGGCCTTTCCTCGTTCGGGGATCCTTTCCCTTCTGTGTTCTCTCTCTCTCTTTCTCTCTCTCCTGCCGGAGAACCCAGTAGTCTCTTTCTCCCGAGAATTTTTACTCGGTCTCTTGCGCATTTTGCCTTCTCTCAGGCATAGGACCCCGGTGGGTCCTCGCAGCCTCTTCTCCCTTTCTATGTGCAAGACTTGAAGTAGCGGTAGAATGAGGAGGGGGTCAACATAGAATTGAGCTTGACTTCATACTCTACTTCACATTCATCCCCTCGCTCAAGTAGATTGCCATTGGCAGTTCATGTTCTAAGGCATGGAAGTGCCTAGATAACGGTGACCGAGGAAGACCAGAGAGCGAACACTGATATGGCTTGAGATGAGAAGAGATCAACTTGTTTATCGAACGAACTGACCGTCACGTTTGCGCTGCGATGGTACCGCTGGTGTGTTTCCACCTAATCACATCGATTCTCGGAGTCAAGCTTCCAATAATCCATGTGAGCTGCCGACTGTATCCTATCAAGGTCTTGCATGCAGTATGAATCCAATCAAAAATGGTTTCATGTACTATATAGACGATGGACAGGAATGAAAACTCACACACCTGCCTTCCTTCTTCCTTCGGCTTGATACGATACTGGCCTTGGATTGAGAAGTTTAGCATGTGCATATCTGGGCACCTCCGAAGTCCGTACTTGTCCGTCCAAATTGTTCAGGAAGGTCCTGGCAAGCGTTTTGCGTCTAGATGACAGTAAGAACTAGCCCATTCCCACCTGCATCCAGAACTCTCAGTGTTTTTCCCGGACATGTGTTCTTCCCGCAATATGTATTTGGGAGCAATTGGTATCAACTAATAAGTTTTGCATTGTTACAACAGTACGACTGCGAGTGAACTGCAGTAATGTGTACACCACTAAACACCATCTTTATACGTGAAGTCAGAATTCTGCCCTATTCTTATATCAGCTGCCTCGACCACCTGACCATTTGGAAGATGCATCATATTCCGATGATAGACATTAGACAATTTGAGCAATCAGCCTAGTACAGATACGGTCGTCCGACAGACGTTTCACTGTAAATCTCGTGTCTCAGTGTCAATTGTGTAAGTTGTTTGACGCGCATAGATCATTCGGCAGCTCGAAGTTGTCTTTCGATTGAATCAACCAGCTGACCCATACGCGTCCATCCAGTTAGCCCAGAGTCCCGCGTTGGTGCGATTGAAGGGCCTCGGGTTGTGATACATCAGTTTTTGAGCAACCTTCTCGATGAACGTGATCTGCTGTCTCAAACGAGCTCTTCTTACCTGCCTTAAGGCTCGTTAGACTGTTATCGTGGATCTAATCGTGATCTTGGAAAGATTATGTCCATCTATTTTTTTTTCTGCGGGTGAATATCTTACAGCGCTATACACTTTTTGTGTCTGTCGAGGTAGATGTATCCAATAACTTGGTTTCGTGATTTCTCACGACTCTGGTGGACCACCAGAAGACTATATTGGCACCATTTGATCCACATTGTGCGTTCTTTGACTTCCAGCTTACCTCTTCTTTCAATTTCTGTGTGTAGATTCAACTCTCTGCGTAATACGAGCTCACTGCGATCTTCGACGGAGCTGCGTTCGGCTATTGTGGCGGCCAATGCACGGGTTTTACTGGCTGCATTCCACAAAGTTACAGCTTTATATGGCTTGCATTGCCAGATTCAGACGACAAACTTTGCTGTTTTACCCACATTCTGTCGCATTCGTGGATCCGGCTTGTACTCAAGCTCAAGTGTAGGTGCAGTATGATGAGCTCGAGAACGCTGACACTGAGCAGGAGGAACAACATGGAGGGAGTTCTTCAAGTGGCGAAAAGTCCGAATCACGAAAACCAATCCTCGTTACAAACATGGCAATGTGATCAAGAGTCTACCGAGTTCGATACAGGGTCAGCTGGAAATCTTCTGAGCGCACAAGTTGCTGCAGCCAGTCTTGCCAGTTCGTCGCCTGAGTCTGGGCCTGAGAGTGATCTGCTCCCTTCCGAGTTGCAGAACCTAGAATCGGGTAACCTTCTTTCTAACGATGTTCCCTCCTCCAATCCAACGGCAAACTTTCTATTACCCAAGTCATCAATATGGGGAACAGGTGACTCCGAGTATAGCTGGGCACAAGAAAGTCTGTCGCGGTCTTCCGGCTCCATGGATGATAGTTCTCTTTTGACCAGTGACACTCTCGGGAATGACACTTCCAGGTTGGTGGAGACGCCGAAAACTGATCCTCTCTTGCCCCAGTGGGCGAGTCAGCTACCCAATACAACTCAGTCATCGGCATCTATACAACCGCCTACGCAGATGTTCCAGCGACGATCATGGCAGACGTCGGATGATCACACTTCTTTGGGTCTCATACCCACTATCAATATGCAGGCGTACAACACGTCGTTTCCAGCTCTCTCGTCTTCTTCTGGAGGGGGTATGAGTCTCGATGCGACGAAATTCAACATGGACTACTTGGGTGGAGAAAGGAGCTGCAATATGGGAAACTTCGAGGGGACATCGGTCTACGACTCTGTGGCAAGGAAGCTACACTGTCAGATGTCCGGTTTAGAAACAAGCTCTGGAAGTGATTTTTCTAGCGGATCTGGGATTTCAACGCTTGGTTTCGCTAGTCTTCAGATGGGGCAAAGTCAGGGTATAACCGATTCGAGCGAGAATAATGTTTCTAGCGGATTGTTCTTACAGCAGGGACTCATGCAGCAGAAGAATTATAATGGTGTATCTACGATGAATCACGACAAAAGCAGCTACTTGAGCAGTAATTCCCGTGTGTACTTCAACCAATCTTCTAGTTCCACTTTAGATACTACTAACACTATTATGAATACATCTACTTCGAATCAGAGGTTTGGTGAGAACATGCACAGCCCAAAATTGTTGCTCGAGTCATTGTCCGGTAACTCAGTGTTGCGTAACTTGGAGACAAATATCTCCGGTAGTCATAATCCATCGGAGTCCGTCTTAGGTTCACATGGCTATTTGTATTCTACGCAGAAAAAAGTGGACACCCTTGAAAGCTTGAGGAAGTGGCCGAACAATGCCAGTGGGAATGGGGTGAAAGATGTCACTGCTAACCCAACCATAGGTAATTTGGGAAGGTTTTCGTCCTACAATAGTAACGGAGATAAGGAAGATGCTTTGTACGACACTTGGCCACCATCGAGCGTCGGACAAAACCATGCCTTGGATCCGGTACCCGAGACCGATTCTAGGAAGCGATTTCTCCAGATGAGTCTGGGGCAACCCAACGATACGAATCACAAGCGCCTGCATTTGGTGAGTTCGCAGAGACTAATTTGATTTTGCACATTTGTGGTGGACATCGATTCGCGCCTCATACTCTTTCAATTGCTCTTTGAGCTCTGGCTGGAGTATGAATCAGTTGACAATCTTCCATTCCAGTTTTCCAGTTTGGCCATCATGTTGTTTTCCATGCGTGTCCGGTTTCTGCTGAACAATCGTCCACCAGCAAGTTACGACACCACTTCAAGAATGGCCTGTGTGAGAGTAGGAATGTGATTAACCTGACCAAAATCCGAAATTTGTTTAGGAATTTTTCTTCGTCTACTGACATTCTCGAAACGATCAAACCCATGCAGGACACGTCTCCAAACGTGCAGACAACGGTTGCGCCTACCACTCTAAAGCGCTCATCCTCATGGGCCTCTTCTCTCACATCCACCTGTTCTAAGACTGTAGACGCCATTAACCCTGGGCCTCTACCTTACACCAAGTCGAATTCACGACATGCCGTCGGGCCGGCTTTGAACACCAATCTGAAGCCGCGAGCCCGGCAGGGCAGTGCGAACGATCCTCAGAGCATAGCAGCTCGCGTAAGTTTCCATTATCTGTGCTAAAGCCGACATCGAGTTCTGAGCTCACAGTAGACGTTTCAATGAGAAGTGGATGTCCAATATGTTAAGTCCGTTGTCGTGCTTCTCCGTATGTGTATGGGCCGAAAGCGTATCATGCATCTAACGACCTATTTTCGCGACATTTGTTTGCAGCATCGGAGGGAACGCATCAGCGAGCGACTGAAGACTCTACAAGATCTTGTTCCTAATGGTTCCAAGGTAATCGATCAGGAAAGGACGAAGATTGTTTCTGCTGCTGGGTTAAGAGCGAATATCAGTGGAACTGAGCAAGTTGTCGCGCGGAGTAGCCTATAATCTCAATTTTGAAATACTTTTCCCCGATTCTTGCAATTGAGATGTGCAATGGATGTTGCACTTTAATTTCTTGTAGCTGTTGACATTATCTTCTTCTACTCGCAGGTAGACTTGGTCACCATGCTTGAAAAGGCCATCAACTACGTCAAGTTTCTGCAACTTCAAGTGAAAGTAGGTACTCTTATACAGACTTAAATCAGCAAGCGCCGAACCGAAGTAGCTGCATTTCTTGTGACACACGCATCCTTAGTTCTTGAGATTTTTACGAGGATGGCTTTTTCTTTTCTTTTCTTTTGTCCTTGCCAACGTTTAGTACGTTTTCTTCGCTTCAGTTCAGAGCACTTTCTTTGTTTTATGGCCACAATTGTTCGTTTTGCAAGAGAAGTCTGGAAAATTGAAGCTAGTAGGTACTGAAAAAAGGATGTCTGGAAATCATCATCTCAATGGAGAAATCTCGTGTTGGAGGAAAACATCATCTGATTTTCACAAGCAGCTTCCACGAAATATGAACGTGGCTTCTGCAGTCCTAGATCTGAATTACCTTTACTGTACTACATGGGCAGTGCCGAGTTACCACTCGGCATAATCCTGTTCAGTGTCAAGGATGTGCTCATTCAGCATCTTCCATCGTGAACCTTCTTTTTCATCTGCGAGGTCGTTGCCGATACGGCATTGATAGATTGGGCTGTTTATCAATACCAAGGGAAGGCGGACGTTGGTTAAGACCTACTTATCCCAATCCTTAACATTGTTCGCACTTGAAGTGGACGAGTTTTAAGAGATTTTTTGTTCATGTAGGTGCTGACTACTGACGACTATTGGCCTTCCAACGAGAAGGGCGCTGCCCCATGTACTGCTCTTCCCAACTTTGAAGATATGGAGGGCGCTCTGAAAGTTCTGGTCGCGCAGGCTGAGAAAGAGGCAAATTCCAATTTGAGTAACACCACTAGCAACAACGGTGGCAATTCCAGCAGTAGCAGTCAAGAGAACAAATCACCGAATCAAGCAGACAACAACTCGTCCTGACAGTTGATGTGAGAAACACCGAATAATAGAGGCTTCGAAGTCAAGAATTCGCGATTGACGTCGAGGCTTTGGAGAAAACCTCCTCCCACTGTTTGAAATCTGAAGGATCTCGAGAGGCCTGCCGCGACTGTACGCCTACATGAACTTGTTAATGCGAGCCATCCTCATGGCTTGGTCTGCATGATGAGATGATGGCCTTAACTAGATGTAGTGTAGTGTACGTACATCTCGGAATCGAATTGCATGGAGGATTTACCAGTCGCTTTACAGCATAAGATTGTCCTGAAGTATACTGCTGTTTGAGATTCATACAAGTTAGACTTCCACGAGGATTGTCTAATGAGTGAAGTGGAAATCAATATTAGCACAGCTGTACTAGTGCTACTAGACTAAGGACAGGACTCGACGCTTTAGGACATTTGATTTATTCAGAAACTTAAAGCTCTTGCTTTACTAGCATAAGGGCCTTTGTTCAATCCCCTAATTAGCTTCTGATTAGCTCGTGATTAGCGGCTTGAACAGAGATAGGGAACCCTTAGTTAATTAATTAATTAATTAGGTGAACCGGTAATTAATTAATTAATTATTCTCACATGGTTGGTGTGATGACATGTACACGCATCATGTCTGCAACGCCCTAAGGAGTAGTGG

mRNA

>Mapoly0039s0003.1
GGAGATGGCCTGAGGAGGTGAAGTCGGTGGTGTGGAGGAGTCGTTGTTTTGCGGCCCCTCGTCTTCAATATTTTGGTTATAACCCTCAATGCATCGCCCGTCCTCTCTTTCTTCCGTCAGAGTCTCTCTCCGCCCCGGCCTTTCCTCGTTCGGGGATCCTTTCCCTTCTGTGTTCTCTCTCTCTCTTTCTCTCTCTCCTGCCGGAGAACCCAGTAGTCTCTTTCTCCCGAGAATTTTTACTCGGTCTCTTGCGCATTTTGCCTTCTCTCAGGCATAGGACCCCGGTGGGTCCTCGCAGCCTCTTCTCCCTTTCTATGTGCAAGACTTGAAGTAGCGGTAGAATGAGGAGGGGGTCAACATAGAATTGAGCTTGACTTCATACTCTACTTCACATTCATCCCCTCGCTCAAGTAGATTGCCATTGGCAGTTCATGTTCTAAGGCATGGAAGTGCCTAGATAACGGTGACCGAGGAAGACCAGAGAGCGAACACTGATATGGCTTGAGATGAGAAGAGATCAACTTGTTTATCGAACGAACTGACCGTCACGTTTGCGCTGCGATGGTACCGCTGGTGTGTTTCCACCTAATCACATCGATTCTCGGAGTCAAGCTTCCAATAATCCATATTCAACTCTCTGCGTAATACGAGCTCACTGCGATCTTCGACGGAGCTGCGTTCGGCTATTGTGGCGGCCAATGCACGGGTTTTACTGGCTGCATTCCACAAAGTTACAGCTTTATATGGCTTGCATTGCCAGATTCAGACGACAAACTTTGCTGTTTTACCCACATTCTGTCGCATTCGTGGATCCGGCTTGTACTCAAGCTCAAGTGTAGGTGCAGTATGATGAGCTCGAGAACGCTGACACTGAGCAGGAGGAACAACATGGAGGGAGTTCTTCAAGTGGCGAAAAGTCCGAATCACGAAAACCAATCCTCGTTACAAACATGGCAATGTGATCAAGAGTCTACCGAGTTCGATACAGGGTCAGCTGGAAATCTTCTGAGCGCACAAGTTGCTGCAGCCAGTCTTGCCAGTTCGTCGCCTGAGTCTGGGCCTGAGAGTGATCTGCTCCCTTCCGAGTTGCAGAACCTAGAATCGGGTAACCTTCTTTCTAACGATGTTCCCTCCTCCAATCCAACGGCAAACTTTCTATTACCCAAGTCATCAATATGGGGAACAGGTGACTCCGAGTATAGCTGGGCACAAGAAAGTCTGTCGCGGTCTTCCGGCTCCATGGATGATAGTTCTCTTTTGACCAGTGACACTCTCGGGAATGACACTTCCAGGTTGGTGGAGACGCCGAAAACTGATCCTCTCTTGCCCCAGTGGGCGAGTCAGCTACCCAATACAACTCAGTCATCGGCATCTATACAACCGCCTACGCAGATGTTCCAGCGACGATCATGGCAGACGTCGGATGATCACACTTCTTTGGGTCTCATACCCACTATCAATATGCAGGCGTACAACACGTCGTTTCCAGCTCTCTCGTCTTCTTCTGGAGGGGGTATGAGTCTCGATGCGACGAAATTCAACATGGACTACTTGGGTGGAGAAAGGAGCTGCAATATGGGAAACTTCGAGGGGACATCGGTCTACGACTCTGTGGCAAGGAAGCTACACTGTCAGATGTCCGGTTTAGAAACAAGCTCTGGAAGTGATTTTTCTAGCGGATCTGGGATTTCAACGCTTGGTTTCGCTAGTCTTCAGATGGGGCAAAGTCAGGGTATAACCGATTCGAGCGAGAATAATGTTTCTAGCGGATTGTTCTTACAGCAGGGACTCATGCAGCAGAAGAATTATAATGGTGTATCTACGATGAATCACGACAAAAGCAGCTACTTGAGCAGTAATTCCCGTGTGTACTTCAACCAATCTTCTAGTTCCACTTTAGATACTACTAACACTATTATGAATACATCTACTTCGAATCAGAGGTTTGGTGAGAACATGCACAGCCCAAAATTGTTGCTCGAGTCATTGTCCGGTAACTCAGTGTTGCGTAACTTGGAGACAAATATCTCCGGTAGTCATAATCCATCGGAGTCCGTCTTAGGTTCACATGGCTATTTGTATTCTACGCAGAAAAAAGTGGACACCCTTGAAAGCTTGAGGAAGTGGCCGAACAATGCCAGTGGGAATGGGGTGAAAGATGTCACTGCTAACCCAACCATAGGTAATTTGGGAAGGTTTTCGTCCTACAATAGTAACGGAGATAAGGAAGATGCTTTGTACGACACTTGGCCACCATCGAGCGTCGGACAAAACCATGCCTTGGATCCGGTACCCGAGACCGATTCTAGGAAGCGATTTCTCCAGATGAGTCTGGGGCAACCCAACGATACGAATCACAAGCGCCTGCATTTGGACACGTCTCCAAACGTGCAGACAACGGTTGCGCCTACCACTCTAAAGCGCTCATCCTCATGGGCCTCTTCTCTCACATCCACCTGTTCTAAGACTGTAGACGCCATTAACCCTGGGCCTCTACCTTACACCAAGTCGAATTCACGACATGCCGTCGGGCCGGCTTTGAACACCAATCTGAAGCCGCGAGCCCGGCAGGGCAGTGCGAACGATCCTCAGAGCATAGCAGCTCGCCATCGGAGGGAACGCATCAGCGAGCGACTGAAGACTCTACAAGATCTTGTTCCTAATGGTTCCAAGGTAGACTTGGTCACCATGCTTGAAAAGGCCATCAACTACGTCAAGTTTCTGCAACTTCAAGTGAAAGTGCTGACTACTGACGACTATTGGCCTTCCAACGAGAAGGGCGCTGCCCCATGTACTGCTCTTCCCAACTTTGAAGATATGGAGGGCGCTCTGAAAGTTCTGGTCGCGCAGGCTGAGAAAGAGGCAAATTCCAATTTGAGTAACACCACTAGCAACAACGGTGGCAATTCCAGCAGTAGCAGTCAAGAGAACAAATCACCGAATCAAGCAGACAACAACTCGTCCTGACAGTTGATGTGAGAAACACCGAATAATAGAGGCTTCGAAGTCAAGAATTCGCGATTGACGTCGAGGCTTTGGAGAAAACCTCCTCCCACTGTTTGAAATCTGAAGGATCTCGAGAGGCCTGCCGCGACTGTACGCCTACATGAACTTGTTAATGCGAGCCATCCTCATGGCTTGGTCTGCATGATGAGATGATGGCCTTAACTAGATGTAGTGTAGTGTACGTACATCTCGGAATCGAATTGCATGGAGGATTTACCAGTCGCTTTACAGCATAAGATTGTCCTGAAGTATACTGCTGTTTGAGATTCATACAAGTTAGACTTCCACGAGGATTGTCTAATGAGTGAAGTGGAAATCAATATTAGCACAGCTGTACTAGTGCTACTAGACTAAGGACAGGACTCGACGCTTTAGGACATTTGATTTATTCAGAAACTTAAAGCTCTTGCTTTACTAGCATAAGGGCCTTTGTTCAATCCCCTAATTAGCTTCTGATTAGCTCGTGATTAGCGGCTTGAACAGAGATAGGGAACCCTTAGTTAATTAATTAATTAATTAGGTGAACCGGTAATTAATTAATTAATTATTCTCACATGGTTGGTGTGATGACATGTACACGCATCATGTCTGCAACGCCCTAAGGAGTAGTGG

CDS

>Mapoly0039s0003.1
ATGATGAGCTCGAGAACGCTGACACTGAGCAGGAGGAACAACATGGAGGGAGTTCTTCAAGTGGCGAAAAGTCCGAATCACGAAAACCAATCCTCGTTACAAACATGGCAATGTGATCAAGAGTCTACCGAGTTCGATACAGGGTCAGCTGGAAATCTTCTGAGCGCACAAGTTGCTGCAGCCAGTCTTGCCAGTTCGTCGCCTGAGTCTGGGCCTGAGAGTGATCTGCTCCCTTCCGAGTTGCAGAACCTAGAATCGGGTAACCTTCTTTCTAACGATGTTCCCTCCTCCAATCCAACGGCAAACTTTCTATTACCCAAGTCATCAATATGGGGAACAGGTGACTCCGAGTATAGCTGGGCACAAGAAAGTCTGTCGCGGTCTTCCGGCTCCATGGATGATAGTTCTCTTTTGACCAGTGACACTCTCGGGAATGACACTTCCAGGTTGGTGGAGACGCCGAAAACTGATCCTCTCTTGCCCCAGTGGGCGAGTCAGCTACCCAATACAACTCAGTCATCGGCATCTATACAACCGCCTACGCAGATGTTCCAGCGACGATCATGGCAGACGTCGGATGATCACACTTCTTTGGGTCTCATACCCACTATCAATATGCAGGCGTACAACACGTCGTTTCCAGCTCTCTCGTCTTCTTCTGGAGGGGGTATGAGTCTCGATGCGACGAAATTCAACATGGACTACTTGGGTGGAGAAAGGAGCTGCAATATGGGAAACTTCGAGGGGACATCGGTCTACGACTCTGTGGCAAGGAAGCTACACTGTCAGATGTCCGGTTTAGAAACAAGCTCTGGAAGTGATTTTTCTAGCGGATCTGGGATTTCAACGCTTGGTTTCGCTAGTCTTCAGATGGGGCAAAGTCAGGGTATAACCGATTCGAGCGAGAATAATGTTTCTAGCGGATTGTTCTTACAGCAGGGACTCATGCAGCAGAAGAATTATAATGGTGTATCTACGATGAATCACGACAAAAGCAGCTACTTGAGCAGTAATTCCCGTGTGTACTTCAACCAATCTTCTAGTTCCACTTTAGATACTACTAACACTATTATGAATACATCTACTTCGAATCAGAGGTTTGGTGAGAACATGCACAGCCCAAAATTGTTGCTCGAGTCATTGTCCGGTAACTCAGTGTTGCGTAACTTGGAGACAAATATCTCCGGTAGTCATAATCCATCGGAGTCCGTCTTAGGTTCACATGGCTATTTGTATTCTACGCAGAAAAAAGTGGACACCCTTGAAAGCTTGAGGAAGTGGCCGAACAATGCCAGTGGGAATGGGGTGAAAGATGTCACTGCTAACCCAACCATAGGTAATTTGGGAAGGTTTTCGTCCTACAATAGTAACGGAGATAAGGAAGATGCTTTGTACGACACTTGGCCACCATCGAGCGTCGGACAAAACCATGCCTTGGATCCGGTACCCGAGACCGATTCTAGGAAGCGATTTCTCCAGATGAGTCTGGGGCAACCCAACGATACGAATCACAAGCGCCTGCATTTGGACACGTCTCCAAACGTGCAGACAACGGTTGCGCCTACCACTCTAAAGCGCTCATCCTCATGGGCCTCTTCTCTCACATCCACCTGTTCTAAGACTGTAGACGCCATTAACCCTGGGCCTCTACCTTACACCAAGTCGAATTCACGACATGCCGTCGGGCCGGCTTTGAACACCAATCTGAAGCCGCGAGCCCGGCAGGGCAGTGCGAACGATCCTCAGAGCATAGCAGCTCGCCATCGGAGGGAACGCATCAGCGAGCGACTGAAGACTCTACAAGATCTTGTTCCTAATGGTTCCAAGGTAGACTTGGTCACCATGCTTGAAAAGGCCATCAACTACGTCAAGTTTCTGCAACTTCAAGTGAAAGTGCTGACTACTGACGACTATTGGCCTTCCAACGAGAAGGGCGCTGCCCCATGTACTGCTCTTCCCAACTTTGAAGATATGGAGGGCGCTCTGAAAGTTCTGGTCGCGCAGGCTGAGAAAGAGGCAAATTCCAATTTGAGTAACACCACTAGCAACAACGGTGGCAATTCCAGCAGTAGCAGTCAAGAGAACAAATCACCGAATCAAGCAGACAACAACTCGTCCTGA

Protein

>Mapoly0039s0003.1
MMSSRTLTLSRRNNMEGVLQVAKSPNHENQSSLQTWQCDQESTEFDTGSAGNLLSAQVAAASLASSSPESGPESDLLPSELQNLESGNLLSNDVPSSNPTANFLLPKSSIWGTGDSEYSWAQESLSRSSGSMDDSSLLTSDTLGNDTSRLVETPKTDPLLPQWASQLPNTTQSSASIQPPTQMFQRRSWQTSDDHTSLGLIPTINMQAYNTSFPALSSSSGGGMSLDATKFNMDYLGGERSCNMGNFEGTSVYDSVARKLHCQMSGLETSSGSDFSSGSGISTLGFASLQMGQSQGITDSSENNVSSGLFLQQGLMQQKNYNGVSTMNHDKSSYLSSNSRVYFNQSSSSTLDTTNTIMNTSTSNQRFGENMHSPKLLLESLSGNSVLRNLETNISGSHNPSESVLGSHGYLYSTQKKVDTLESLRKWPNNASGNGVKDVTANPTIGNLGRFSSYNSNGDKEDALYDTWPPSSVGQNHALDPVPETDSRKRFLQMSLGQPNDTNHKRLHLDTSPNVQTTVAPTTLKRSSSWASSLTSTCSKTVDAINPGPLPYTKSNSRHAVGPALNTNLKPRARQGSANDPQSIAARHRRERISERLKTLQDLVPNGSKVDLVTMLEKAINYVKFLQLQVKVLTTDDYWPSNEKGAAPCTALPNFEDMEGALKVLVAQAEKEANSNLSNTTSNNGGNSSSSSQENKSPNQADNNSS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>