Mapoly0039s0068



Description

STEROL REGULATORY ELEMENT-BINDING PROTEIN

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_190857
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR12565 STEROL REGULATORY ELEMENT-BINDING PROTEIN
PANTHER PTHR12565:SF77

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH7 transcription factor, bHLH Mapoly0039s0068.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0039s0068.1 scaffold_39:893492..899151  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0039s0068.1  

Gene structure:

mRNA scaffold_39:893492..899151  ( + strand )
five_prime_UTR scaffold_39:893492..895034  ( + strand )
five_prime_UTR scaffold_39:895256..896079  ( + strand )
CDS scaffold_39:896080..896811  ( + strand )
CDS scaffold_39:897773..898246  ( + strand )
three_prime_UTR scaffold_39:898247..899151  ( + strand )

Sequences:

Gene

>Mapoly0039s0068.1
GTGGAATCATGGGTCGTTTAGGGTCATCCAGCAGGTGTCTGGATTTAGGGGGCTCATGGTCGTCCGGAGTGATCCAATTGAGGCTTTTTTCCATCTTTGGACAGCTTGGCCGCTGAAAGGGGAATTTGTGCGGATTGCGCAACTAACTTGTCTGAGATAGAAGGTCGAAACTGGCACTGATCTGGTTGGATCTAGTCGGGTCGGGTTGGAAAGGGATTAGCTATTCGGACGACATGAAGAGACGGGATGGGGGAAACAGTGGTAAAATATTGCATTGCCACATACGTCGAGTATCGAAGGTCACAGATCTCCTCGGCCGAGAGAGAGAGAGGTGGGGCCGGTCCTTGTGCTGGCTGTGCTAAGTTGAGGTGCTGCTGCGAGTGAGACAGTGATGTGGGGGCTCGGTCAGGCTGAGGAGCGAGCTGAGGCACTAACTAGGGGACAGAAGATCTTCATCTTCTAGGAAGAAAGGAACGCCATAAGATCTGACAAGAGAGCCGCAGCGAGATCGCGGGGAGCTTCTGGACTCGCTTCGCTTTGGGAGCAGCAAATATCTGCATTCCTCTCTCGACCCGCTCGACTCTCTCTCTCTCTCAGTCCGCCTCCCGCTTCTGTTCTTGTTCTCCTGGTCCTCTCTCCTCTCTCCTCTCCCCCCTCTCTCTCCTTCTCTCTTTCTCTTTCTACTTGAATGACAGGATCGCTGCCCTCCTTACCGATCTACGTGCTCTCTCGTCACCCCAGATTGCTGTCTTTTCCTTCCTTTTAGAGCTCTCGCGCTCGCATCTTGGGGCGCTCACTGGGAAGACACTTTTGCGCTCTCTCCCGCTGCTCTCACTCACTCTCTCTCTCTCTCTGCCGCGAGCCACATTTTGATTTGATCTGAACTTGAGGAACATCGCCGCATTTCGGGTTTGGATCATCTTCGGTCGTCACGTACGGCCCGTGGTCGCGGTTGTAGCTCGCCCCGCAGTCAGCCGCCGGGCCGCCGGTCCCTCTCACTCTCATGAGGCATCGTCACTGCAGGTCCACTTCTGCTCCCGGCTGGAATTGGCAACATTATCATGCCAAGGCCTGTTCGTGTCGTCCAAGCTGAGGGGACGGTCAGCTGACAGGCGTCCGGTAATTCGGAAAGGGTTCGTTATGGACATCTGAGTGAGTCCGGTGGCCGGGACCTTGACCTCGAGGATTAGGGACGATTTCGTCGGTGCGGAACTGAAGTCAAGCTGGATTGCACCCAGCTAGTTATGAAACCGGAACTCTTGGATCTTCTTTGCAGGAGAGCTGAGGGTGGATGTATGAGAGGTGAAAACTCCGAGCGCATTGTTGCAGAGAACACAGCATTCTTCTACTACCACAGAAAAAGGGCTTGGGTCTCAGTGCATTCCCTCTAACATAAGGCCGACACCGAAAGTCGTCAATTGAACCGTGCTCCCGAGTATTTGATGAGCCCGGAGCTTTAATTCAAACACCAATAATTGGAAAGACCAAAGTGACAGTGGGTATGCAAAATGTCCTTGAGAAACTTATGACATCATAAAATAAGGTGATCACTTGTGCGAACCCACTTCAAGAGCTGGTTACTTTGCAGAAGTTTAATCGGCGCTAGCAATTTTCCGTCCAGCAGATGTTAGAATTTGCTGACGGATTGTCTGATCAATTCTCTGAGCTCTGAGCTTGGTGGTTTCAGATGTTTGAATTTTTTCGTTTCAGCTCGAACCTGCTTGTTATGCTGACTGCGCGTACGGTGCCCAATGTTCTGCACAGCTTAAGCTTCCGAGCTCGAGAGTGCCGATTTCGGCGGCTCTACGCGTTCGAGGGTTCGAAGTTCCAACATCAGATGTCACCTTATAGCCCGTACCTAACAGCTTAAAGAGAGAGATTCAGAAGAACAGGAACCTGCAAAATCTTGCGGACTATCGAAATATATATCCATGGCCGGGAATAGTACGCGGATTCCATAATATTTTCAGCTCCAATTGTTTGCAGAGGGTGGTGCTTCGGGTGTAGTGCCCATGTTGAGATGGTCAGTCGGCTGCACACCATCCAGGAATCACGAGTTTCTGTTGTGGTGGATTGTTCTTGCGAAGATTGCTTCTTTACTGCTGCGGATCATCTGAAGTATCTTCCTCACTTCTTCGCCTGCAACGCCGGACGACGATCTTGAGGGCTTCTTGCAAATTTCATAGCCGAATATCATTCAGCGGCGATGGCGAGAGTAGTCGGCCATAGCCCAAGAAATCACCGGCAGACTAAAGGTGAGGATGGAGTATGCGGTATCTTGATCTACGACAAATGTTAAAGCTCCCAGCTATCCTAGGCTCGTGAGTTTGTTCAAAGACTTCACGGCTTTGAAGCTTTTTCGAGCGGCCCCGGAACGATGGATGGCAGCTAATGTTATCGTGATCAATCGGGCAAGAAATAAATCTGAGCCATAGTTGAGTCAAGAGCTCCTCCAGCTGCCATGGACTTCTGATAATCACCATCAGCTGAAGCGTTGGTCTCGGGAGTCGATGGATTGACGTGACACTGTCAGCTACCGAGAGATTTCTTGGAGTGGAGATTGATTACGCTCTCCTTTTGTGTGGTCAATGGGTGGAGAAGCAACGGGGCGCTTAGATTTGTGCTCACAGTGGCAAATCACGCCGGATTCCGGCTTCATCAGACCTTTCAACAAACCTGTTCTGGAGGAACCCAACTTCGCCATGCCAGCGTTGCCAAATTCTGGAGTTTGGCCGGGCGCGCAATCGTTGGCAACATGTACCAGCTCCGGCCCTTCGGCTTTGTTCAGCGTCTCGACGGCAGCAGCATCGCGAGGGTTGTTGGATCACCACACTGCTTCGCGATCAATGCAGTTCAACCACTTGCTTCCGAAGCAGGAGGCTTTCATCTCATCCAACTTTCCCTCGATGCTCGGGCAGTCGACATCATCCCTGGGTTATGACCGTCTTCCCCAGACGCAGCTTTTCGGAAGCCCGCTTTTGCCGAATGCCGAGCACCAGCTGGTGGGAAGAAGCTCTTTGAATTCGTTCAGTTACGATGACGGGCTCGTTCACGGCTCTAGCTCTAGTGGTGCTTCCCGGGAACGAGGGAAGCAGCAGCTGCCTCCACCTTCAGGTCCTGCGCAAGCTAACGGAGGATCCCTGGTCCTGGACGTGTCGAAAGGCGAGCTGATCAACCTGTCGAAGTTGACTCCTCAGGAGATCCTCGATGCCAAGGCACTGGCTGCCTCGAAGAGTCACAGTGAAGCGGAGAGGAGGAGGCGTGAGCGGATCAACACTCATCTCGCGACATTACGGAACAACCTTCCCAGTTCCACTAAGGTAAGTAAGAGTCATCATAATGCATATGAGGTGTAGCGTTGTAAATGTCTGATTTGGCAGCTGGCTCGAGTGTGATGGCGGTTTGAAGCTGTTATGCTCGTTGAGATCCTCTCCAAACGTGAACGGGAGGTCCAATCGTACACTGGACAAGCAGTTCCTGTCGATGAATCAATATAGCATCGGGTCACTCTCCCATCCTGAATATCTGTGGCGCAGCTAAATGAACTGGCATCTGGATCCCAGGTCGTACAAAGCTTGACAATTATTGGCACTCAGCCTTCTCAGGTCCTGAGGAGGCTGAGTGCCAATAACCGGTGGACTTGCACCTGACATTCACTGGGTGGGTAATCACTTGTTTTGACAAGAATGTGTCGCCGTCATCGGACCCCAAGATCATCACCGCCTCTTGTCGTACGATGACAGTCAGGGGGTTGCTCAGGCCCCAGTTCTTTTACGAGGTCTACACCACACGCGCAAAGTATGTTTCTTTGTGGTCACACGCTAATCAATGGCGATCGTTAGAGTCGAGAACCTTCTGACTGCTCTGTACATCCGATGTCATTGATAATGGAAAATAACTTTGTGACGGAGACAATCGTGTGCCCGAAGCGACTTGTGGACGTACTAGGTGAATCGTGTCACTTGGCGACCAAACACGAGACTTGAGAAGCCAGTATGGAAGCATCGATAATACTCATCCTCCTCCATTCGCACAAAGTCCTGATCAGTGGGCAATTGCATTGATCGCATTGCTGTTTTGTGGGTACAGTTGTGCGATCGGGTCTGATTCATGCTCACGGTCGACTGTCTTACGAGTTAAACTAGTGGAGTGGAAGCCAGTGTTCAGGATAAGTTGATAACATTATAAACGTACACATGAGTTTTAAACAGTGGGTTACACTCCTTAAGTGACGAGAAAGGATAAACTTTGTGTTGACGCTTTGCATGTGTGGTTGTGCAGACGGACAAGGCATCACTGCTCGGAGAGGTTATAGACCATTTAAAGTTTCTCAAGCGGCAAGCAGCCGACATCGCCGAAGGGGGTCCAGTACCTTCAGATGTGGACGAGCTGACTGTGGACGTGGACCCTTCGTCGAGCGAGATTGGAGATGGACGGACTTACTATCGAGCGTCTCTTTGCTGTGATGATCGACCAGATCTTTATCCGGATCTTATGAGGACGCTGCACACTCTGAGGCTTCAGACCGTTAAGGCTGAGATAGCAACACTGGGCGGGCGCATAAAAAATGTCCTACTGATGACCAGAAGCGATGAGGGTAGCGACGAGGATGACAAAGAAGCTCTATCTGTGTCGTCTGTAATGGAAGCTTTGCGGGCTGTGATGGAGAGGTCAGGGCTTGGAGATCAGTCGCCAGGCTCCAGCAACAAAAGACAGAGACTTGCATCCTTAGATTCGTCGAGCCCTTCGATGTAAGACCCGATTCCGTCCTCGCCATGTTATCTGATGAATGGACAGCTAGCACGCCCCTAATCATACTGTAGCTTCCTACATAGCTCACTCCCCTCCCTTCCTTACTCAGCATCATTCTTCCTGAAACCTGCTGTAGAACATTTCCTTTTAGTGTAGCTTCCTAAAAGCATGTGTCGATCCCGAAGATATTCAACGACCTTAAAAATCAGCTATCGTTTACTGTCGGCCCAGCCTCCTACACCTGGAGTTTTTTTCTTATTTTTTTTCTTTACGTAAGCTCCTTCCTTACTGGCTACTTCGTTACGATATGCCCACCCTTATAGTCAGTTCATTGCCGGAGTAATTTTGCCATGAGCCTTGCTACATGTCAGGCTGTACGTACATTTTGGAGTTATCGGGAGTTCAGAGAACTGAGGTAGAAATTCGTGCAAGTTCTCTGGGATGCTGAGAACATATTCACGAGAAGGGAATTGTCGGGTCGTCGTGTTAGTGGTCTTGAGATGTCCTACAAGGGCGGTGGTTACCTTGCTCAGGAAGAGGTAGAGGTGGTCGGTGACTGGTAGATTTAGTCGATAATTGGACACTTGTAGTTAGACGAGAGGATTGAAAGTGAAGGGTTGGACTTACATGGAATCAGAAGAATTCCCCGACCCCTTTCATTTTCGAGCAGTCCATGGGTGGATATGGGGGTTTGTTTCAGCGCAGAACCCAACTCCCATCTCCACCCGTCTGATTGCCTTTGTAAACTGGTATGGAAGTCCAACCATTTGTAATTGTGGTTTCTTTCCGTTACCACGGCACCGCCACCAGGAAACGACTTCTTCACCTAATTTTTGACTGCGAATAGAGTTGATGTTGTCACCTTGTGCAAGTAAAGCTATTAATAAAGCTGACGTGCATCATGTTGA

mRNA

>Mapoly0039s0068.1
GTGGAATCATGGGTCGTTTAGGGTCATCCAGCAGGTGTCTGGATTTAGGGGGCTCATGGTCGTCCGGAGTGATCCAATTGAGGCTTTTTTCCATCTTTGGACAGCTTGGCCGCTGAAAGGGGAATTTGTGCGGATTGCGCAACTAACTTGTCTGAGATAGAAGGTCGAAACTGGCACTGATCTGGTTGGATCTAGTCGGGTCGGGTTGGAAAGGGATTAGCTATTCGGACGACATGAAGAGACGGGATGGGGGAAACAGTGGTAAAATATTGCATTGCCACATACGTCGAGTATCGAAGGTCACAGATCTCCTCGGCCGAGAGAGAGAGAGGTGGGGCCGGTCCTTGTGCTGGCTGTGCTAAGTTGAGGTGCTGCTGCGAGTGAGACAGTGATGTGGGGGCTCGGTCAGGCTGAGGAGCGAGCTGAGGCACTAACTAGGGGACAGAAGATCTTCATCTTCTAGGAAGAAAGGAACGCCATAAGATCTGACAAGAGAGCCGCAGCGAGATCGCGGGGAGCTTCTGGACTCGCTTCGCTTTGGGAGCAGCAAATATCTGCATTCCTCTCTCGACCCGCTCGACTCTCTCTCTCTCTCAGTCCGCCTCCCGCTTCTGTTCTTGTTCTCCTGGTCCTCTCTCCTCTCTCCTCTCCCCCCTCTCTCTCCTTCTCTCTTTCTCTTTCTACTTGAATGACAGGATCGCTGCCCTCCTTACCGATCTACGTGCTCTCTCGTCACCCCAGATTGCTGTCTTTTCCTTCCTTTTAGAGCTCTCGCGCTCGCATCTTGGGGCGCTCACTGGGAAGACACTTTTGCGCTCTCTCCCGCTGCTCTCACTCACTCTCTCTCTCTCTCTGCCGCGAGCCACATTTTGATTTGATCTGAACTTGAGGAACATCGCCGCATTTCGGGTTTGGATCATCTTCGGTCGTCACGTACGGCCCGTGGTCGCGGTTGTAGCTCGCCCCGCAGTCAGCCGCCGGGCCGCCGGTCCCTCTCACTCTCATGAGGCATCGTCACTGCAGGTCCACTTCTGCTCCCGGCTGGAATTGGCAACATTATCATGCCAAGGCCTGTTCGTGTCGTCCAAGCTGAGGGGACGGTCAGCTGACAGGCGTCCGGTAATTCGGAAAGGGTTCGTTATGGACATCTGAGTGAGTCCGGTGGCCGGGACCTTGACCTCGAGGATTAGGGACGATTTCGTCGGTGCGGAACTGAAGTCAAGCTGGATTGCACCCAGCTAGTTATGAAACCGGAACTCTTGGATCTTCTTTGCAGGAGAGCTGAGGGTGGATGTATGAGAGGTGAAAACTCCGAGCGCATTGTTGCAGAGAACACAGCATTCTTCTACTACCACAGAAAAAGGGCTTGGGTCTCAGTGCATTCCCTCTAACATAAGGCCGACACCGAAAGTCGTCAATTGAACCGTGCTCCCGAGTATTTGATGAGCCCGGAGCTTTAATTCAAACACCAATAATTGGAAAGACCAAAGTGACAGTGGGTATGCAAAATGTCCTTGAGAAACTTATGACATCATAAAATAAGCTTAAGCTTCCGAGCTCGAGAGTGCCGATTTCGGCGGCTCTACGCGTTCGAGGGTTCGAAGTTCCAACATCAGATGTCACCTTATAGCCCGTACCTAACAGCTTAAAGAGAGAGATTCAGAAGAACAGGAACCTGCAAAATCTTGCGGACTATCGAAATATATATCCATGGCCGGGAATAGTACGCGGATTCCATAATATTTTCAGCTCCAATTGTTTGCAGAGGGTGGTGCTTCGGGTGTAGTGCCCATGTTGAGATGGTCAGTCGGCTGCACACCATCCAGGAATCACGAGTTTCTGTTGTGGTGGATTGTTCTTGCGAAGATTGCTTCTTTACTGCTGCGGATCATCTGAAGTATCTTCCTCACTTCTTCGCCTGCAACGCCGGACGACGATCTTGAGGGCTTCTTGCAAATTTCATAGCCGAATATCATTCAGCGGCGATGGCGAGAGTAGTCGGCCATAGCCCAAGAAATCACCGGCAGACTAAAGGTGAGGATGGAGTATGCGGTATCTTGATCTACGACAAATGTTAAAGCTCCCAGCTATCCTAGGCTCGTGAGTTTGTTCAAAGACTTCACGGCTTTGAAGCTTTTTCGAGCGGCCCCGGAACGATGGATGGCAGCTAATGTTATCGTGATCAATCGGGCAAGAAATAAATCTGAGCCATAGTTGAGTCAAGAGCTCCTCCAGCTGCCATGGACTTCTGATAATCACCATCAGCTGAAGCGTTGGTCTCGGGAGTCGATGGATTGACGTGACACTGTCAGCTACCGAGAGATTTCTTGGAGTGGAGATTGATTACGCTCTCCTTTTGTGTGGTCAATGGGTGGAGAAGCAACGGGGCGCTTAGATTTGTGCTCACAGTGGCAAATCACGCCGGATTCCGGCTTCATCAGACCTTTCAACAAACCTGTTCTGGAGGAACCCAACTTCGCCATGCCAGCGTTGCCAAATTCTGGAGTTTGGCCGGGCGCGCAATCGTTGGCAACATGTACCAGCTCCGGCCCTTCGGCTTTGTTCAGCGTCTCGACGGCAGCAGCATCGCGAGGGTTGTTGGATCACCACACTGCTTCGCGATCAATGCAGTTCAACCACTTGCTTCCGAAGCAGGAGGCTTTCATCTCATCCAACTTTCCCTCGATGCTCGGGCAGTCGACATCATCCCTGGGTTATGACCGTCTTCCCCAGACGCAGCTTTTCGGAAGCCCGCTTTTGCCGAATGCCGAGCACCAGCTGGTGGGAAGAAGCTCTTTGAATTCGTTCAGTTACGATGACGGGCTCGTTCACGGCTCTAGCTCTAGTGGTGCTTCCCGGGAACGAGGGAAGCAGCAGCTGCCTCCACCTTCAGGTCCTGCGCAAGCTAACGGAGGATCCCTGGTCCTGGACGTGTCGAAAGGCGAGCTGATCAACCTGTCGAAGTTGACTCCTCAGGAGATCCTCGATGCCAAGGCACTGGCTGCCTCGAAGAGTCACAGTGAAGCGGAGAGGAGGAGGCGTGAGCGGATCAACACTCATCTCGCGACATTACGGAACAACCTTCCCAGTTCCACTAAGACGGACAAGGCATCACTGCTCGGAGAGGTTATAGACCATTTAAAGTTTCTCAAGCGGCAAGCAGCCGACATCGCCGAAGGGGGTCCAGTACCTTCAGATGTGGACGAGCTGACTGTGGACGTGGACCCTTCGTCGAGCGAGATTGGAGATGGACGGACTTACTATCGAGCGTCTCTTTGCTGTGATGATCGACCAGATCTTTATCCGGATCTTATGAGGACGCTGCACACTCTGAGGCTTCAGACCGTTAAGGCTGAGATAGCAACACTGGGCGGGCGCATAAAAAATGTCCTACTGATGACCAGAAGCGATGAGGGTAGCGACGAGGATGACAAAGAAGCTCTATCTGTGTCGTCTGTAATGGAAGCTTTGCGGGCTGTGATGGAGAGGTCAGGGCTTGGAGATCAGTCGCCAGGCTCCAGCAACAAAAGACAGAGACTTGCATCCTTAGATTCGTCGAGCCCTTCGATGTAAGACCCGATTCCGTCCTCGCCATGTTATCTGATGAATGGACAGCTAGCACGCCCCTAATCATACTGTAGCTTCCTACATAGCTCACTCCCCTCCCTTCCTTACTCAGCATCATTCTTCCTGAAACCTGCTGTAGAACATTTCCTTTTAGTGTAGCTTCCTAAAAGCATGTGTCGATCCCGAAGATATTCAACGACCTTAAAAATCAGCTATCGTTTACTGTCGGCCCAGCCTCCTACACCTGGAGTTTTTTTCTTATTTTTTTTCTTTACGTAAGCTCCTTCCTTACTGGCTACTTCGTTACGATATGCCCACCCTTATAGTCAGTTCATTGCCGGAGTAATTTTGCCATGAGCCTTGCTACATGTCAGGCTGTACGTACATTTTGGAGTTATCGGGAGTTCAGAGAACTGAGGTAGAAATTCGTGCAAGTTCTCTGGGATGCTGAGAACATATTCACGAGAAGGGAATTGTCGGGTCGTCGTGTTAGTGGTCTTGAGATGTCCTACAAGGGCGGTGGTTACCTTGCTCAGGAAGAGGTAGAGGTGGTCGGTGACTGGTAGATTTAGTCGATAATTGGACACTTGTAGTTAGACGAGAGGATTGAAAGTGAAGGGTTGGACTTACATGGAATCAGAAGAATTCCCCGACCCCTTTCATTTTCGAGCAGTCCATGGGTGGATATGGGGGTTTGTTTCAGCGCAGAACCCAACTCCCATCTCCACCCGTCTGATTGCCTTTGTAAACTGGTATGGAAGTCCAACCATTTGTAATTGTGGTTTCTTTCCGTTACCACGGCACCGCCACCAGGAAACGACTTCTTCACCTAATTTTTGACTGCGAATAGAGTTGATGTTGTCACCTTGTGCAAGTAAAGCTATTAATAAAGCTGACGTGCATCATGTTGA

CDS

>Mapoly0039s0068.1
ATGGGTGGAGAAGCAACGGGGCGCTTAGATTTGTGCTCACAGTGGCAAATCACGCCGGATTCCGGCTTCATCAGACCTTTCAACAAACCTGTTCTGGAGGAACCCAACTTCGCCATGCCAGCGTTGCCAAATTCTGGAGTTTGGCCGGGCGCGCAATCGTTGGCAACATGTACCAGCTCCGGCCCTTCGGCTTTGTTCAGCGTCTCGACGGCAGCAGCATCGCGAGGGTTGTTGGATCACCACACTGCTTCGCGATCAATGCAGTTCAACCACTTGCTTCCGAAGCAGGAGGCTTTCATCTCATCCAACTTTCCCTCGATGCTCGGGCAGTCGACATCATCCCTGGGTTATGACCGTCTTCCCCAGACGCAGCTTTTCGGAAGCCCGCTTTTGCCGAATGCCGAGCACCAGCTGGTGGGAAGAAGCTCTTTGAATTCGTTCAGTTACGATGACGGGCTCGTTCACGGCTCTAGCTCTAGTGGTGCTTCCCGGGAACGAGGGAAGCAGCAGCTGCCTCCACCTTCAGGTCCTGCGCAAGCTAACGGAGGATCCCTGGTCCTGGACGTGTCGAAAGGCGAGCTGATCAACCTGTCGAAGTTGACTCCTCAGGAGATCCTCGATGCCAAGGCACTGGCTGCCTCGAAGAGTCACAGTGAAGCGGAGAGGAGGAGGCGTGAGCGGATCAACACTCATCTCGCGACATTACGGAACAACCTTCCCAGTTCCACTAAGACGGACAAGGCATCACTGCTCGGAGAGGTTATAGACCATTTAAAGTTTCTCAAGCGGCAAGCAGCCGACATCGCCGAAGGGGGTCCAGTACCTTCAGATGTGGACGAGCTGACTGTGGACGTGGACCCTTCGTCGAGCGAGATTGGAGATGGACGGACTTACTATCGAGCGTCTCTTTGCTGTGATGATCGACCAGATCTTTATCCGGATCTTATGAGGACGCTGCACACTCTGAGGCTTCAGACCGTTAAGGCTGAGATAGCAACACTGGGCGGGCGCATAAAAAATGTCCTACTGATGACCAGAAGCGATGAGGGTAGCGACGAGGATGACAAAGAAGCTCTATCTGTGTCGTCTGTAATGGAAGCTTTGCGGGCTGTGATGGAGAGGTCAGGGCTTGGAGATCAGTCGCCAGGCTCCAGCAACAAAAGACAGAGACTTGCATCCTTAGATTCGTCGAGCCCTTCGATGTAA

Protein

>Mapoly0039s0068.1
MGGEATGRLDLCSQWQITPDSGFIRPFNKPVLEEPNFAMPALPNSGVWPGAQSLATCTSSGPSALFSVSTAAASRGLLDHHTASRSMQFNHLLPKQEAFISSNFPSMLGQSTSSLGYDRLPQTQLFGSPLLPNAEHQLVGRSSLNSFSYDDGLVHGSSSSGASRERGKQQLPPPSGPAQANGGSLVLDVSKGELINLSKLTPQEILDAKALAASKSHSEAERRRRERINTHLATLRNNLPSSTKTDKASLLGEVIDHLKFLKRQAADIAEGGPVPSDVDELTVDVDPSSSEIGDGRTYYRASLCCDDRPDLYPDLMRTLHTLRLQTVKAEIATLGGRIKNVLLMTRSDEGSDEDDKEALSVSSVMEALRAVMERSGLGDQSPGSSNKRQRLASLDSSSPSM

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>