Mapoly0040s0112



Description

CIRCADIAN PROTEIN CLOCK/ARNT/BMAL/PAS // SUBFAMILY NOT NAMED

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_147273
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR23042 CIRCADIAN PROTEIN CLOCK/ARNT/BMAL/PAS
PANTHER PTHR23042:SF19 SUBFAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH13 transcription factor, bHLH Mapoly0040s0112.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0040s0112.1 scaffold_40:1155407..1160300  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0040s0112.1  

Gene structure:

mRNA scaffold_40:1155407..1160300  ( + strand )
five_prime_UTR scaffold_40:1155407..1156030  ( + strand )
CDS scaffold_40:1156031..1156164  ( + strand )
CDS scaffold_40:1157422..1157484  ( + strand )
CDS scaffold_40:1157830..1157907  ( + strand )
CDS scaffold_40:1158262..1158424  ( + strand )
CDS scaffold_40:1159247..1159513  ( + strand )
three_prime_UTR scaffold_40:1159514..1160300  ( + strand )

Sequences:

Gene

>Mapoly0040s0112.1
GGGGGTGGCGTTGTTGATCAGTGCGAGCGAAATGTGAGGGAAAGAGACAAAGCACGCAGACGGGCAAGAGAAAGGTCGAGGTCGAAGGGGCCAGTCGCAGACCAGATAGGCAGGCACGCAGGCTGCGAGGGACGCAGACTCGAGTCCGAGAAAAGCATTGGGAGCGGAGCGGAGAGGAGAGGAGAGGAGAGCGGAGCGGTGGTGGGAGTGGCGACGACGAAGTTAGGCAGAGAGGGAGAGAAAGAGAGAGGGAGAGAGGAACGGGGAGAGGGGTGCGGGGCGGGAGAGGGGACAGCGCAATGTGGCGAGAATCATGTAAGCAGCCTTCATAATCCTGCCACACACCCTGGTGATAGTCTTTCGGTGCGTGGGGTGGGGAGGTCTTCCACTATGATGCAGCTCCTTCTAGGGTGACAGCAGGCGCAGCGCTGGTAGGTGTTGGGCCGAAGGCCGGGCCGCCTAGGCACGAGCGAGGGAGGAGGAGCAGGAGGTCGGAGAGCGAGGATTGCAGGCGCTCGAAGTCGTCGTCTTCGTCTGCTTCGTCAGCGTAGTCGAGGTTTTCGATTTGTAGTGGGGGTGAATTGTGTAGAGGTAGAAGAACAGGTGGAACAGGGACACACCACAATGTCTTCTCCTTCGAATAACAGCAAGTGGATCTCCTTCCTAGCGCAAGATCTCTTGGAAGTGGAGGAGCCACAGCCGTTTAATGCATTCCAGTGGTGCACGAGCCAGTCCCTCCCGGAACAGGGAGACTGCAGGTGAGGTTCTGGTCTTCGGTTTTCCCCCCTTTTTATGGGGGGTATTGGCTACTTTCGGGTATGCCGTGGCATATTTTGGATTTGAGGGAAGGTGAACGAGTGGAGATCGTGGTTGGGATACAGCAGTGTGCTCGTTCCGTGCCCGGCTCTCTTTCTCTATTGTGACCCGTTTCTTAGGCTCCCTGAAAATTTTCAGTTGTCAATTGAGGTCATTTTCTGTATGCCCGAGGGATGGGGGTTCAGTGCATAGTTTATTTTCCGTCCGTCTTTCATGTCCCTGTTCTACTTTCTTTGTGATTTTTCTCTTCTCTCGAGCTACGGTTTGGGCAAGTGCAACTGGATCCTCTTCCCCACACTCTTTCATTCTTCCGTCTCCATGGTACTCAGTCCAAGACATGTCCTTCTGGTTTACCCTCTTTGGGTATACTTTTCTCTATTTCTTGTTGTCATTAAGTCGCAGGTTTTCAACTTTTAATTTCAAGACATAAGTGGCATCTACGCGTTCATTTTTTCTGTGGCTTTGAAATCGCTTAGCGCCAACTCGTGGTCATTCTTGAAGAGCTATGCCACAGAGATAAAACAGGTTTGTCTAGGTCCAGATGACCTCTCGTTATCTTAGGCGCTCGGAAAGAGCATACAGTGCTGAACTTTGGTATTAGTTTTGGACATGTAGACTCTTCATTGTCCCTTCAGATCAATGTCTCGTTTGACATCCATCGACCTGAAGTCGGGTATTCGACAGGTCGGGTAGCAGTTTCTGCACACCCTCAATTCCTGCCTCTTAGGTATCTTTCATTTGACCATTGTCAGTGTGTATCTTGTGCTGTGCTTTACAGACAAGGAGCACTTCAATGCGTTCTCAGTTTAAGTTCGAATAGAAATTTGGGCGTTGCCTGCGTTGTTGGTCGAGGGCTAGGTCAGAGACAATTTATACATTTCGGAGTGTAGCCTTTCGTTCTTGGTGACGAGGTCGATCATGAACAGTTATGCTGAGTGAGGCAATCATATTACTGATCTCTCTAGACTTCGTCTAGTTTATTGGGCGAACTGATCTTTGACAGTCGAACACTGTCTGTGCCGAGGATGATCTCCTCTTCATGTTCTCCGTTTATCAAACGACTTTTTGAAACATACTGTTTGGAGTGGAGGCTCTTGTTCTACCAAGAAGCTACACGTCAGGGCAACTTTTGTTTTCCTTAGCTGGCTGCTATGCACTCATCTATAAATCCGGACCTTGACAATTGTTTCCCTTTACAGTGCGGAGAATGATGGCTCAAAGGCCGATTCTGATGAACACGAGAAGATTTGTCCAAGGAAAAGGTAAGATTATTGTTGTTTGTTGCACATCTCTCACAACCCTGTTCAAGTGTGTTGGCTCCTATCCTTAGGATTCCGGTGTGAAACCGTTGTGAAGTAACTTCAAGTGGTTGTCCGCACGCATTTCCTCTCCATCTGATAGTCTTTGTTTGCTAAGGGTTAACTTTGGCTGGAACTTTGTATCATGTGAACGGTTTATTTCTGGGTGTTTACACCGGTGGGCTGTTTGTCAGCCATGTATGTTTCTGGTACTTATAATTCAGATCACCACCATTTGAATACTCTCTTCTTGTAGTCGTCTTTGAAGAGGCTTGGAAATGAGACTTTTATCATGGGTGTTATATGTAGGTCTCGAGACGAATCATGCAGTGGAGCTGGCAGCAAGGCCTGTCGTGAAAAGATGCGCCGTGACCGTCTTAATGACAGGTAGCTTGATGTCTTCGTACTTGCGTTCCAAAAAGTCGCTACTGTGATGCAAACAGTGATCTTGATCATTACAAGGAACAAGGCTTGTCGACGTTTATGTGTTAACATGGCTTCTCTTTGTCTTTTCAAAACTTCGTTTTGTTTCGTTTCAAAATAATGTTTAGTCAGCCCTCACAGCTATTGGGCGGTAGACGGGTTGAAAACTTCCCGTAATTCATGCATCGATTGGTTACATCAGGCAGATACGGATTGAGTACCCTTTGAATTGAGAGTGTGCTGTCTACCTTCGTTCCGTCTGAAGCTAGTTGTCTTAAGAGGACTAACGATGTGTACACTCGGATGCTATGTTTCCAGGTTTGTGGAACTGAGCTCAGCCTTGGAGCCCGGCAGGCCCCCCAAGTCTGACAAGGCTACCATCCTTTGCGATGCCGTACGTATTCTGAATCAGCTGCGGTCAGAGGCCCAGGAGCTGAAGGATTCAAACCATCTGCTGCGCGAAGCAATCAAAGACTTGAAGGTAATACACCTCACCCTATGATGTACTCCGGTGTGGCTGCCAGATGAATATCATCAGGACAGATTAATGGTTATCTCCTGAAGGAAATAACCAATTATGTGTCCCTTCCCAGACACCTGAATACTTCAATATTGGTTGGTAATGCGCATTTGCTGCTCTGCTTCGTGGTCTAATCACGAACGCTGTTGATCGTTCCCGACGACTGCGTTCACCCTCTTTTACCGCAAGGTGTTCATCTACTGTCTGATCCTTGGGGCCACGTAGTTTGCTAGAGACCTTGGACACGAAGTCACTCGTCATCCATTGTTTTTCTCAAAGAAGACCATGGAATTATGCGTCGTTGATTTGTTTTCAATTCAACTCTTCCTTTGGTGTCTTTTCTTCATCACCGACGTCAAAACTGGTGTTTGTCGGACTTCACAATACTCCCAAACTAGATTAAAGTTTTTGTAACTTTTCTGAACCCTATCCTGAACCTTTACAAAATCGGATTGCATATTGCTAATCTGTCTGCCCTTGAAATTTAGAGGGAAGGATGATAACTGCAAAAACCATGTCTGCCGTTTCTCCTACCTTTTTTGGAATTTTTACTAGTTTTGTCCACGGCCTTGAAGGTTTCATCAGAGAGGGCATGACTAACACGTGTATATAGACGGTGTTTTTCCCTTCCTGTCGTTTAATATAGCTGCTTATTTGTGCCGTGCTCGTGCTTTTCTAGCGGTGAGCTGGATTATGCATCTACGTTCTGTTGTATCAATGAAGCTTGTAGTGTAAGAGCCAGTAAACTGATTGTGAAAGTGATTCATTTGGTGATCTTCCTAGGCCGAGAAGAACGAGCTACGTGACGAGAAGTTGAGGTTGAAGGCAGACAAGGAGAGACTGGAGCAGCAATTGAAGACCATGACTATACCATATACCCATCCTGCTACTCTTCATGCGGCTGCTGCATTTGCCCAAGCACAGGCACACGCCACAACCAATAAGGCTTCTCACATGCCAGGATATCCAGGAATGGCCATGTGGCAATGGATGCCACAGGCGACTGTCGACACGTCGCAAGACCACGTCCTCAGACCTCCTGTCGCTTAAGCATCCCGTTTCGACTTGGGTCTTCACATGTTTATCCAAAGCCGCCTTCTGCCCCAAAGCGCGAAAAGAACCTCAATAGGTTGCTACATTTGGCGAGACTTTTCTTCTTTGAACTCCAGATTTTGGATTCACATGCCTTGTACCTAGATGTACTTCGTAAAGCAATCATTCAACCGCCATTCTTGTTCATTAGCGATGTTTGGTTTTCTTTGCCCACCTTCATTGGGTAGGGCATTCATCTGTTCTTTTAGGATAGTGTGAAGGGGTCGACTTTCTCTGCAATAAACTGTGTAGAACTCGTTTTATGTGCTGTGAGGGCTCCTTCGGAGTCTGTGCAGTGTTGAGACCCTTGGTATATTTTAGGTTCTGTTGGATAGTAGAACTGCGTACTGACTCGGTACAGTAGCTTTAGTCTCTCGTCAATTGGTAGGTTCGTCACAAACAAGAGTTCTTTTTACGAGAGTTGCATAGAATCTCAGCATCTGACATTGTCGGAAACTTGGAGTCTATGCGTAAGTTTTTTGTTAGCATGTTTTAGGACGTAGCATGGACCGTCAGAAGTGTAGAGAGTTCAGTCGATTGTGTGCCATTGTGAAATAGGTAAAGCGTGAACAAGCTGGTCTCTTACCAGGTTGATGTGTGAAATAGAGTTGCACACAATTGGCAATGGTTTGATAGGAAGTATGGATGACGATGTTAAGATGGTGGCGGTAGGTTCTTGATATTTTGGCTCCTTGAACATAATGCCTGAAGTTAAACTCTGTACTTCCGATTTATAATCGAGCGG

mRNA

>Mapoly0040s0112.1
GGGGGTGGCGTTGTTGATCAGTGCGAGCGAAATGTGAGGGAAAGAGACAAAGCACGCAGACGGGCAAGAGAAAGGTCGAGGTCGAAGGGGCCAGTCGCAGACCAGATAGGCAGGCACGCAGGCTGCGAGGGACGCAGACTCGAGTCCGAGAAAAGCATTGGGAGCGGAGCGGAGAGGAGAGGAGAGGAGAGCGGAGCGGTGGTGGGAGTGGCGACGACGAAGTTAGGCAGAGAGGGAGAGAAAGAGAGAGGGAGAGAGGAACGGGGAGAGGGGTGCGGGGCGGGAGAGGGGACAGCGCAATGTGGCGAGAATCATGTAAGCAGCCTTCATAATCCTGCCACACACCCTGGTGATAGTCTTTCGGTGCGTGGGGTGGGGAGGTCTTCCACTATGATGCAGCTCCTTCTAGGGTGACAGCAGGCGCAGCGCTGGTAGGTGTTGGGCCGAAGGCCGGGCCGCCTAGGCACGAGCGAGGGAGGAGGAGCAGGAGGTCGGAGAGCGAGGATTGCAGGCGCTCGAAGTCGTCGTCTTCGTCTGCTTCGTCAGCGTAGTCGAGGTTTTCGATTTGTAGTGGGGGTGAATTGTGTAGAGGTAGAAGAACAGGTGGAACAGGGACACACCACAATGTCTTCTCCTTCGAATAACAGCAAGTGGATCTCCTTCCTAGCGCAAGATCTCTTGGAAGTGGAGGAGCCACAGCCGTTTAATGCATTCCAGTGGTGCACGAGCCAGTCCCTCCCGGAACAGGGAGACTGCAGTGCGGAGAATGATGGCTCAAAGGCCGATTCTGATGAACACGAGAAGATTTGTCCAAGGAAAAGGTCTCGAGACGAATCATGCAGTGGAGCTGGCAGCAAGGCCTGTCGTGAAAAGATGCGCCGTGACCGTCTTAATGACAGGTTTGTGGAACTGAGCTCAGCCTTGGAGCCCGGCAGGCCCCCCAAGTCTGACAAGGCTACCATCCTTTGCGATGCCGTACGTATTCTGAATCAGCTGCGGTCAGAGGCCCAGGAGCTGAAGGATTCAAACCATCTGCTGCGCGAAGCAATCAAAGACTTGAAGGCCGAGAAGAACGAGCTACGTGACGAGAAGTTGAGGTTGAAGGCAGACAAGGAGAGACTGGAGCAGCAATTGAAGACCATGACTATACCATATACCCATCCTGCTACTCTTCATGCGGCTGCTGCATTTGCCCAAGCACAGGCACACGCCACAACCAATAAGGCTTCTCACATGCCAGGATATCCAGGAATGGCCATGTGGCAATGGATGCCACAGGCGACTGTCGACACGTCGCAAGACCACGTCCTCAGACCTCCTGTCGCTTAAGCATCCCGTTTCGACTTGGGTCTTCACATGTTTATCCAAAGCCGCCTTCTGCCCCAAAGCGCGAAAAGAACCTCAATAGGTTGCTACATTTGGCGAGACTTTTCTTCTTTGAACTCCAGATTTTGGATTCACATGCCTTGTACCTAGATGTACTTCGTAAAGCAATCATTCAACCGCCATTCTTGTTCATTAGCGATGTTTGGTTTTCTTTGCCCACCTTCATTGGGTAGGGCATTCATCTGTTCTTTTAGGATAGTGTGAAGGGGTCGACTTTCTCTGCAATAAACTGTGTAGAACTCGTTTTATGTGCTGTGAGGGCTCCTTCGGAGTCTGTGCAGTGTTGAGACCCTTGGTATATTTTAGGTTCTGTTGGATAGTAGAACTGCGTACTGACTCGGTACAGTAGCTTTAGTCTCTCGTCAATTGGTAGGTTCGTCACAAACAAGAGTTCTTTTTACGAGAGTTGCATAGAATCTCAGCATCTGACATTGTCGGAAACTTGGAGTCTATGCGTAAGTTTTTTGTTAGCATGTTTTAGGACGTAGCATGGACCGTCAGAAGTGTAGAGAGTTCAGTCGATTGTGTGCCATTGTGAAATAGGTAAAGCGTGAACAAGCTGGTCTCTTACCAGGTTGATGTGTGAAATAGAGTTGCACACAATTGGCAATGGTTTGATAGGAAGTATGGATGACGATGTTAAGATGGTGGCGGTAGGTTCTTGATATTTTGGCTCCTTGAACATAATGCCTGAAGTTAAACTCTGTACTTCCGATTTATAATCGAGCGG

CDS

>Mapoly0040s0112.1
ATGTCTTCTCCTTCGAATAACAGCAAGTGGATCTCCTTCCTAGCGCAAGATCTCTTGGAAGTGGAGGAGCCACAGCCGTTTAATGCATTCCAGTGGTGCACGAGCCAGTCCCTCCCGGAACAGGGAGACTGCAGTGCGGAGAATGATGGCTCAAAGGCCGATTCTGATGAACACGAGAAGATTTGTCCAAGGAAAAGGTCTCGAGACGAATCATGCAGTGGAGCTGGCAGCAAGGCCTGTCGTGAAAAGATGCGCCGTGACCGTCTTAATGACAGGTTTGTGGAACTGAGCTCAGCCTTGGAGCCCGGCAGGCCCCCCAAGTCTGACAAGGCTACCATCCTTTGCGATGCCGTACGTATTCTGAATCAGCTGCGGTCAGAGGCCCAGGAGCTGAAGGATTCAAACCATCTGCTGCGCGAAGCAATCAAAGACTTGAAGGCCGAGAAGAACGAGCTACGTGACGAGAAGTTGAGGTTGAAGGCAGACAAGGAGAGACTGGAGCAGCAATTGAAGACCATGACTATACCATATACCCATCCTGCTACTCTTCATGCGGCTGCTGCATTTGCCCAAGCACAGGCACACGCCACAACCAATAAGGCTTCTCACATGCCAGGATATCCAGGAATGGCCATGTGGCAATGGATGCCACAGGCGACTGTCGACACGTCGCAAGACCACGTCCTCAGACCTCCTGTCGCTTAA

Protein

>Mapoly0040s0112.1
MSSPSNNSKWISFLAQDLLEVEEPQPFNAFQWCTSQSLPEQGDCSAENDGSKADSDEHEKICPRKRSRDESCSGAGSKACREKMRRDRLNDRFVELSSALEPGRPPKSDKATILCDAVRILNQLRSEAQELKDSNHLLREAIKDLKAEKNELRDEKLRLKADKERLEQQLKTMTIPYTHPATLHAAAAFAQAQAHATTNKASHMPGYPGMAMWQWMPQATVDTSQDHVLRPPVA

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>