Mapoly0041s0098



Description

(UnKnown)

Reference DB

Database ID Description
OrthoMCL OG5_131079
PANTHER PTHR21354 UNCHARACTERIZED
PANTHER PTHR21354:SF0 SUBFAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC2H2-7 transcription factor, C2H2-ZnF Mapoly0041s0098.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0041s0098.1 scaffold_41:930964..934311  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0041s0098.1  

Gene structure:

mRNA scaffold_41:930964..934311  ( + strand )
five_prime_UTR scaffold_41:930964..931545  ( + strand )
CDS scaffold_41:931546..931695  ( + strand )
CDS scaffold_41:932530..932594  ( + strand )
CDS scaffold_41:932751..932949  ( + strand )
CDS scaffold_41:933526..933987  ( + strand )
three_prime_UTR scaffold_41:933988..934311  ( + strand )

Sequences:

Gene

>Mapoly0041s0098.1
CGGTCGCCATAGCGTCTAATGAGGACTCAGTGACTCCTTACACTGTATGGCATTGCAAACAAAACCAGACCTCGGCTCGGCTTTGGCACCATGCAGTCGCGACTGCCGAGCGAGAACGCGACCACGAGACCTAAAGATAACGGGACTCGAGGCTCAATGTTGTGGAGAATAAGAGGGACGACTTTCAAATTGTAAACGACTCGCGCGTGTTTTGCCCATGGGCCACCTACAGAAAGCTGGGCCTGGAGGCTGAGGGTTGCTGGCCTCTTGTTTCGCACCGTCGATCGTCGATGGTCACAGTTTTACATCACTAGAGTTTGGAGACCACCTTGGCTTTGGATTCCCTGTGGGAGATTATGGACGGAAGCGAGAGCTTCGGGTTCCTCCTACGATTTACAGCTCGGGATTCCATGTGTTTCTCGTGATCCGCCGACGGCACGAGCGCGAGGATATCGGATCTTCATCGACAAGCCATCTTTTAGTTTTGGTGGTATGTTGTGCTTTGAGTTCCGCTGGTGAGGCTTGAAATTCGCTCCAATTTCTCGATCATCGGTGGCAGAGGAGGAGGACGAGGCTCTCGGGATGGAGGAAGAAGAGAAGAAGGAGGAGAATGAAGGTGCGGATCTACCGTTGAGGAATTTCCCTCATTGGAGTGCAGCAAGACGGAAATTTGCTCCTGACTGTTGTTTCTTCTCTGCCGGTAACCTCGAGCGCGAGCTGCAAGCCAAACAGGTGAAGATCTTGCCTCTGACCTGCACTCTACCTTCCGTCGTATGAACCTGTAAGTCAGCACATTAACTTCTCTCATATAACAGTTTAATTTCGATCAACTACGCTGTAAAGTGGGAACCAAAATAATTAAGATACTCGGCGGAGGAGTCGCAGTTCCTTCCGTAGTTTGAATTTGGGCCGAGATGAAGATATGAAGCCCGGTCATCAAGAGTTGTAATTTTTTCGCTGACAGATTTGACTCGATTGGTGTGTGAGTCAAAAAGGTCTGTAGCTGTCCAGTCAATCTGTTGGAAACTCTCACGAGGGTCAGAGTTTAGCTCAGCGCAGGAAGAGAATTATATCTGTTGCGATACTAAACATTTTCGCAGGACAACCTGCAGACTGTAATTATAGATCTGGAAGTCTTATCTGAGTCTAGGCGCAGCACACTAAAGCTATTACGCCCAGTTTAAGCACCAAGAGTTCGAATTACGGAGTTGTCCGAAGAACAAGCAGCCTTATCTTTTCTGACGAGTACAAGCCTGTGCTTAAGCCTTCCACACAATCATCAATCTCGTGTAGTTGTTTTGAGTACTGCTGCTAACTAAGTTTACTCCTAACACATATGATAGACAATCCTACATTCAAGCACCTTAAAATCGGCTAGTCTTTTATATCATTCGAATATGAGAAGTTTGCTCAGAAGTTTGCTCGAAGTTTGCTCAGTGAAAACTGGGTTTAAATCTGCGTTGTCCTTGAATTTTTCAACAGATTTGTGGGGCGCACACTGGCTTGTTTCAGTCTTGCTTTTGTTTCAAATTCTAATGAAATTCATGTATCGCTTTCGCCAAACAGGTGTCTTTGAGCATAACAGACGAAGAGATAGCGGCCATCAGTCGTCTCGAGGAAGAAGAGACACTGTAAGTCTGGTTGATACTCCTTTGTTAAGCACACGTAGAAGATTGAAGCTCTTGGTTTTTTACCCCAGGCTGATTCCACTTATTGCATCTCACATCTTTGCCACGAGTTGAGTCTAGCGAGAACTCGCGCATTGATATAAGTGGCGTGTTGTGCAGGCAAGTTCGGTGTCCTATTTCTGGCTGTGGGGCAACTTTGAGTTCACTGTCAGACTTCGAATCACATTATAGTTCTGCGCACAGAGCAACTTGCTCTGTTTGTTTCAATGTTTACCCGACCACGAGGCTCCTGAACATCCACATTTCCGAATGCCACGACTCCTTCTTTAAAGCGAAGGTTGCACGCAACTATCCAATGGTAAGTCAGGCGATAACCCTCTTCCTGTATTTTATGTGGCGCATCGTGCTGACCAATCACCAACAGACCAATCTTGTGGAAATTGGACTTTCGATTCAGGATTCAAAATAATCAGAACTTAGAAATTTTTATCATGAATTGTGAAATCAAGACGTCAAAACCAAACAAAGGTGTAGTTCACCTCGATGAGTGCTTGTGAAGCAATCCTGGTTGAGGACGGATGAGTGTAGTAATCTGAAGAACAGCTGAGTATATGCCATTTTTTAGTTATGTTTATGTGCACTAAATTTAAGAACCAAGGCAAACCGTCTGTTCTTCTTATCTCTTTCCTGTTTAAGGTGTAATAGACACAGCACATGAATGATAATTCTAATAGGTTTTTCCTTGTCCACCAAGCTTCTCTTGTTACACCTTCTTCTTCTAGCTGCCACAACGGCATACTGTTTTGCAAGTTTTACGCTCACGGGGAATTTCGTGGAGTACAACGTTGTTGAGTGTCTAAAGTCGTTGACAGTCAGTTGTTGAAAATACTTGTGCTCATGCCGTTATTTACTAATCCTTTGGCTCTTTCAACAGTACGAATGCTTGGTCGAGGGCTGCCCAGGCCGCTTTCAGACGGACGGTCGTAGACTACAGCATCTGGTGGACTCACACCGCTTTCCAAAAACTTTTCGTTTCCACTCAAAAAAACATTTTTCACAAAAGCATCGACGGCGACAGAAACAACACGCATACAAGCAACCACAATCATCTGCAACACCAAAGAAATCAGGAAGCTCGAAGGCAGTACAGAAAAACAGCACACTGTGCATGGCAATTTGTGAAGAGCATGTTCCGGTTAAGTCACTCCACGGTGGTACTGAACACTCCGAACCGAGTGCAGACATGGATGTAGACAGTTTGACCAAAGCTGTTTCGAGGCTAAGTACCTCCAGTTTTGAAAGCAAAACTCCAGCAGTAGTGAGTTTTGGCCGTAGACGAAGCCGCGCTTGTAGCTTACCATCTAAACCCGCTCCGAAGGACTCGGGTCCAAAATAAGGCCAAGCGTATTGAGCAGATTGATTGTTTGCATATGCATCGAAGGCAAGAATTTGGGTGTACAAACAATATTTGCAGATGATGAACTAGACTATGATGATTAACTGTAGACGGATAAACTCTGGTGGTGAGCAGACCAAATCTTCCTCTTTAGAAACTGGTCTGCAACCGAAAGCATAGGTCCTTTTTTCATGGAGATGTTCAGTAGGGCTCTCGTAAACTTTTGCACAGTAAGGGCGAATCTGACTTAGATATCAAAACGTTTATAACGGATAGGAATGATTAGAAGTTCATGGGCATGAATGTACACAGGTCTATGAAAAC

mRNA

>Mapoly0041s0098.1
CGGTCGCCATAGCGTCTAATGAGGACTCAGTGACTCCTTACACTGTATGGCATTGCAAACAAAACCAGACCTCGGCTCGGCTTTGGCACCATGCAGTCGCGACTGCCGAGCGAGAACGCGACCACGAGACCTAAAGATAACGGGACTCGAGGCTCAATGTTGTGGAGAATAAGAGGGACGACTTTCAAATTGTAAACGACTCGCGCGTGTTTTGCCCATGGGCCACCTACAGAAAGCTGGGCCTGGAGGCTGAGGGTTGCTGGCCTCTTGTTTCGCACCGTCGATCGTCGATGGTCACAGTTTTACATCACTAGAGTTTGGAGACCACCTTGGCTTTGGATTCCCTGTGGGAGATTATGGACGGAAGCGAGAGCTTCGGGTTCCTCCTACGATTTACAGCTCGGGATTCCATGTGTTTCTCGTGATCCGCCGACGGCACGAGCGCGAGGATATCGGATCTTCATCGACAAGCCATCTTTTAGTTTTGGTGGTATGTTGTGCTTTGAGTTCCGCTGGTGAGGCTTGAAATTCGCTCCAATTTCTCGATCATCGGTGGCAGAGGAGGAGGACGAGGCTCTCGGGATGGAGGAAGAAGAGAAGAAGGAGGAGAATGAAGGTGCGGATCTACCGTTGAGGAATTTCCCTCATTGGAGTGCAGCAAGACGGAAATTTGCTCCTGACTGTTGTTTCTTCTCTGCCGGTAACCTCGAGCGCGAGCTGCAAGCCAAACAGGTGTCTTTGAGCATAACAGACGAAGAGATAGCGGCCATCAGTCGTCTCGAGGAAGAAGAGACACTGCAAGTTCGGTGTCCTATTTCTGGCTGTGGGGCAACTTTGAGTTCACTGTCAGACTTCGAATCACATTATAGTTCTGCGCACAGAGCAACTTGCTCTGTTTGTTTCAATGTTTACCCGACCACGAGGCTCCTGAACATCCACATTTCCGAATGCCACGACTCCTTCTTTAAAGCGAAGGTTGCACGCAACTATCCAATGTACGAATGCTTGGTCGAGGGCTGCCCAGGCCGCTTTCAGACGGACGGTCGTAGACTACAGCATCTGGTGGACTCACACCGCTTTCCAAAAACTTTTCGTTTCCACTCAAAAAAACATTTTTCACAAAAGCATCGACGGCGACAGAAACAACACGCATACAAGCAACCACAATCATCTGCAACACCAAAGAAATCAGGAAGCTCGAAGGCAGTACAGAAAAACAGCACACTGTGCATGGCAATTTGTGAAGAGCATGTTCCGGTTAAGTCACTCCACGGTGGTACTGAACACTCCGAACCGAGTGCAGACATGGATGTAGACAGTTTGACCAAAGCTGTTTCGAGGCTAAGTACCTCCAGTTTTGAAAGCAAAACTCCAGCAGTAGTGAGTTTTGGCCGTAGACGAAGCCGCGCTTGTAGCTTACCATCTAAACCCGCTCCGAAGGACTCGGGTCCAAAATAAGGCCAAGCGTATTGAGCAGATTGATTGTTTGCATATGCATCGAAGGCAAGAATTTGGGTGTACAAACAATATTTGCAGATGATGAACTAGACTATGATGATTAACTGTAGACGGATAAACTCTGGTGGTGAGCAGACCAAATCTTCCTCTTTAGAAACTGGTCTGCAACCGAAAGCATAGGTCCTTTTTTCATGGAGATGTTCAGTAGGGCTCTCGTAAACTTTTGCACAGTAAGGGCGAATCTGACTTAGATATCAAAACGTTTATAACGGATAGGAATGATTAGAAGTTCATGGGCATGAATGTACACAGGTCTATGAAAAC

CDS

>Mapoly0041s0098.1
ATGGAGGAAGAAGAGAAGAAGGAGGAGAATGAAGGTGCGGATCTACCGTTGAGGAATTTCCCTCATTGGAGTGCAGCAAGACGGAAATTTGCTCCTGACTGTTGTTTCTTCTCTGCCGGTAACCTCGAGCGCGAGCTGCAAGCCAAACAGGTGTCTTTGAGCATAACAGACGAAGAGATAGCGGCCATCAGTCGTCTCGAGGAAGAAGAGACACTGCAAGTTCGGTGTCCTATTTCTGGCTGTGGGGCAACTTTGAGTTCACTGTCAGACTTCGAATCACATTATAGTTCTGCGCACAGAGCAACTTGCTCTGTTTGTTTCAATGTTTACCCGACCACGAGGCTCCTGAACATCCACATTTCCGAATGCCACGACTCCTTCTTTAAAGCGAAGGTTGCACGCAACTATCCAATGTACGAATGCTTGGTCGAGGGCTGCCCAGGCCGCTTTCAGACGGACGGTCGTAGACTACAGCATCTGGTGGACTCACACCGCTTTCCAAAAACTTTTCGTTTCCACTCAAAAAAACATTTTTCACAAAAGCATCGACGGCGACAGAAACAACACGCATACAAGCAACCACAATCATCTGCAACACCAAAGAAATCAGGAAGCTCGAAGGCAGTACAGAAAAACAGCACACTGTGCATGGCAATTTGTGAAGAGCATGTTCCGGTTAAGTCACTCCACGGTGGTACTGAACACTCCGAACCGAGTGCAGACATGGATGTAGACAGTTTGACCAAAGCTGTTTCGAGGCTAAGTACCTCCAGTTTTGAAAGCAAAACTCCAGCAGTAGTGAGTTTTGGCCGTAGACGAAGCCGCGCTTGTAGCTTACCATCTAAACCCGCTCCGAAGGACTCGGGTCCAAAATAA

Protein

>Mapoly0041s0098.1
MEEEEKKEENEGADLPLRNFPHWSAARRKFAPDCCFFSAGNLERELQAKQVSLSITDEEIAAISRLEEEETLQVRCPISGCGATLSSLSDFESHYSSAHRATCSVCFNVYPTTRLLNIHISECHDSFFKAKVARNYPMYECLVEGCPGRFQTDGRRLQHLVDSHRFPKTFRFHSKKHFSQKHRRRQKQHAYKQPQSSATPKKSGSSKAVQKNSTLCMAICEEHVPVKSLHGGTEHSEPSADMDVDSLTKAVSRLSTSSFESKTPAVVSFGRRRSRACSLPSKPAPKDSGPK

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>