Mapoly0042s0058



Description

SWI/SNF COMPLEX-RELATED

Reference DB

Database ID Description
GO GO:0003682 Chromatin binding
OrthoMCL OG5_136211
PFAM PF00249 Myb-like DNA-binding domain
PANTHER PTHR12802 SWI/SNF COMPLEX-RELATED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB11 transcription factor, MYB Mapoly0042s0058.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0042s0058.1 scaffold_42:672003..676373  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0042s0058.1  

Gene structure:

mRNA scaffold_42:672003..676373  ( + strand )
five_prime_UTR scaffold_42:672003..673136  ( + strand )
CDS scaffold_42:673137..673297  ( + strand )
CDS scaffold_42:674182..674363  ( + strand )
CDS scaffold_42:674570..674746  ( + strand )
CDS scaffold_42:674887..675161  ( + strand )
CDS scaffold_42:675555..675956  ( + strand )
three_prime_UTR scaffold_42:675957..676373  ( + strand )

Sequences:

Gene

>Mapoly0042s0058.1
ACGGATCAGCATCAGGCACAGAGACTCGAAGAGAGGAGAACGAAGGAGTACGCAGGGAAAAACTCAGAGTTCACACCCACCCGTCCTTGGGCTCCCGTCGCCCCAAGCACAGCACAGCACAACACCGGAGGCCAGACCGCACCATACCACACCACACCAGACCACACCAACAACAACAGCACATCTGATGCAGCGTCTACCGCTTCCTTGCCTGCCTCTGTGTCCTCTCAGAGCTCTTCTCCCTGCGCTCCTGACCTTCCTCCGAGCTTGATCCTGCGGGTATCATTCTCCCATCCATCTTCCGCTGGCCTTTTCTCTCAGCCCGCCATCTGAGGACCAATCTGCCCACTCAATCCTCCTCGACTTCGCTTGCCTTGCCTTGCCTAGCCTAGCCTTGCCTTGCCGACTGACCACTGCCTCACTGACTTTCCCACACTCCTTATTTACCAACTTCCAAGCGAACCCGCTGCTCCAGAGTTCAGTGCAAGCTCTTGTCATGTGCGCTCGGCCTTCTTAGGTAGATAAGAGCGCTCGGATTCCGCTGCGGTGTGCCTACACTGATAACCTGCTGGAAATCAATTGCTAGCTGTTAACCATGATCTTGTGCTTTCTCCGATCTCCTTCGGACTTGTGTCGATAGACAGTGAGTGAGTCACTGCGGCAGTGCTCGATTTGGTCGAAGGACGTTTGGGCCATCAGGGGGAAGGTGGAGGTGTGTATCGTATGGATGAACGTAGTGGAATTAGTGCGGTGAAGTAGATCGGGTCGCCGTGTATTCAGTCTATCTTCGCTTCTAGCATTCTTCAGGGGTTCGTGATGTCGGAATAGAGTGCCACTCCCGACTCTGTGAGTAGAGCTGGAAAGGTACAACAGCTCGTGGCTGGCTGCTCGGTTGGATTCCTTCTTGAGGCCTTGTGCGGATTCGGTCTCGGACTGCTTAGCCCCGTTTGTGTCCGAGTAGAGTGCGGATTGGAGAGCAGCGCGGATCGGAATTTGCAGAGCAAGCGATAGAGACGACAGGTGGGAAACAGAGGCCGTGGAGGCTTGTAGAATTGAGTGGATTCACAGCGAGGGTGTTGACACAAGGTCGAGGCTCATGGTTCGCTAGTGGTCGTCAGGTACTTTAATGTCGAGATGTTAGGAGTCATGGCTGCTGGTTCACCAGCACTTTCTGGCATGGGGCCACAAGGCTCCGAGGAGGGTTCCAAAAAAGTCCGCAAACCGTACACTATCACCAAGTCTCGCGAGAGCTGGACAGAGCAGGAGCACGACAAGTTTCTCGAAGCACTCCAACTGTAAGTTTGATTCTGAACCCCCATGATCCCGGCTTCTCTTCCATCCTCTGCTCTCATCTAAGAGCTGCCGTAGGTTTCCTCTGCAACCCTTAAAGTGGGGCAACTGAAGATTCCTGCTGTCTTGCCTCCACGAGAGCCCCCCGTTTCCACTTTTCGATGTAGAGTCTTCAGGGCATAAGGGATTCTCACTGAGCTCTTCGCTCAGGACAGGCTTGAATTCCCCCACTCTAGCTGTGATCGTCGTTCAGAGCCAGGTCTTACCGGCCAAGGCTGCAGAAGGCACGAGGAACACAGCTGACAACATCAAGGGATGATGGCCATATCCCGACTGCTGCGGAAGAGCTGCAAGTGAGCTAGCTCGGAGCGGCCCTCGAGCTGCGCCTGCTGTTCATTCCGAGGTTACCATGCTTAGTGTCTGAACATGGCCCAGCAGCATGTCTTGTCTTGCGTGCTCTCTCGGACCGTGGGCCGGGAGGACGCCGAGCTCTCGCATGGCAAGCAGCTCCATCGAGCGCTGTCGGATGCCGGCTAATTGCCACGGGACAGGGCGAGGATGAGCTCACCCCTCGACATGCCGAAGCATCTCCTCCCGTGAGTCTTGTTCCCCAAGCAAAGATCCGAGCTTCGGACGAAGCTGGCACGTTCTCGTGGCGCAATCCGCCTGACAGTACCCTTTGACCTTCGGGGTCGTGGGCTAGTTCTGTCAGCAGCGGATAGAATGCTTGCGCCTGCAGTGCTAGGGACGACAACGTACATGTAGGTCACGGTCGCATGTCGTCCACTTTGCGACGACGACGGCGACGATGAGGATGAGGATGACGATGCTGGGGCTGCTGAGAAATGGGGGTTTGATCGATGACCGATATATGTTTGGCTCTGTGCAGGTTCGATCGAGACTGGAAGAAGATCGAGGCGTTCGTCGGGTCCAAGTCCGTAATTCAAATCAGAAGCCACGCGCAGAAGTATTTTCTCAAGGTGCAGAAGAACGGCACGGGCGAGCATGTGCCGCCTCCGCGACCTAAGCGGAAATCAGCGCAGCCGTATCCCCAGAAGGCGCCCAAGGCTGGTGAGTCCCGGTGCCTGCCTCCGCGAGCGGAACGGGGCCTCGTGCCCCCGGGCCGCTCGCCCGACGCTAGACTAAGACTAATCGTCGGGGCGTTTGCGCAACGACTAGCGGCGTACGGACTCTAGAACTCGTTTCGTGCCTCGTTCGTTGCTCGTTCCACGTGCCTGACATGTGAATGAACGTCTCGCGCCGCCTTGCCTGCGCAGTGTCAGCAGTTCAGCAGCCCGGTGTTCTGGCGCGCACATTGAACCCCCAGCCGACGCAATCCGAGCCTTGCTTGCCGAGGCGAGGCAATTTTCAAAGCTGCAGCATCGGGAGCAACTCTGGGAGCTGGCAGTACCATTCCATGCCGCCGGTGGTGCCCATCACCACAGATCTCCGAGGTGCCCATTTCGTCCCCCTCGCTGTCTGTTGTCGGGTCTTGTCGATCGTGTTGGTTTGGAGGGAGGGAGGGAGGGAGGGAGGGAGATTGGATTTGACGGGTTGGCAGGGTCTGACTCGTTGCTCATTCTTCTTTTTGCAGCCACTCCTGATTTTGCCGAGGTTTACAAGTTCATCGGGAACGTGTTCGATCCCGGCATGAACAGCAACCACAATCTGAAGAAGTTGAAAGAGATGGCCCCGATCGATCGCGAGACCGTGCTTCTGCTGATGAGGAACCTCTCCATCAACTTGTCCAGCCCCGAGTTCGAAGAGAGGAAATTGTTCATGCCCGCATTCGAGGCCAATCCGGATGCCGCCAGACCAGATTCCTCAGATCAGCACCTGGCGATGCTTTCCGCCACGCAACCGCCCTCGGTAACTATCTGCGGCACTGGCTGACGCCGACTCGAGTCAGTCGGCTTTGTAATTCGTGTAACTACGCTAGCTTAGTCTCATCGCACAGTCATCATCTCCCTGCCTGCAGCGGATTTGCATTTTCTCATGGCTCTGTTCCGCCTCCCGGATCAAGCCAACATTCTTTGGGTCTACGCAGAGCACCTCCTCTCCTTCTCAGCAGCAGCAATTCGTGGAACTAGTGACCTGGTGGCCGGAATTGGTCCGGCCCGCGATGTAGCCGAGGTCCAGATTAGCAGAGTCTAGAAACAGGGTCTAGACACGAGTCAGCCGAGCTTGATGGGTCGTCTTGATGGGATTTGGCATGGAGGCCTTGGATTCTACTGAAGTGAGAGTTTCATTTCGTTCTTCCAGGACGGAGGAGACGATGATGCTGCGTTTTCTGGACAACCTTCTTCAAACCATCAGAGTGATAGTGGAGACTCGGATTCACAAGTGGACCCCAGCCATGGCCAAACTCGAGTTTTGCCATCCTACTCTGACGGTCCCATGGATGTCGCTGAGCACCGGCGGCTGACACATGAAGGAGGGAGTAGAAGCGTAGACTCAGTGTTACCCATAGCTCCTTACCCCGGATTGACATCTTCAAGGCCGATGACGGACAATTCCTCAGCTGGAGCTCATCGGTCCATGGGTCTGCACTCGCATCCTCACATGGCATTTTCTGGTAGAGCAGACGTGGGGTTTGGGATGCCGCTGCCCACTTTGACGCCAGGTGTAGTGGGGGAAGGCAACATCGATAACTGGTGGAGCTAGCAGCCAGCGGCCTTCATCAGACGCCTGTGCTGTTTTTCCTTAGCTTAAATGTGTACTTTTATTCTTACATTTAGCCACTTTTGCCAGGATGATGTCCTCGTCCTGCTTGTGAAATAAGGCCTATGCAGATAGTTAGTTGTATAGGGGACGATTATGGAAAAGCTTGTGAAAAGGTGGAGTACTGTCTGTAGTAGTGTCGGTACTGGATTCTTTCAGCCTACAGTAGCAAGGCCAACTGAAGAGTGTGTTATAGTCCTGCGGTGGTGTGAAACAAATTGGTCTCCATTCGAGCAATAGCCTCGGAAATTTTAGAAATCAAATGTACATTACCAGTTGCCGAAAATATGTTCATATGTTGTACACTTCCTACGAAGAAATTGAAGTCGATTGCTCATCTTTCTGGCCTCGGCTCTTATC

mRNA

>Mapoly0042s0058.1
ACGGATCAGCATCAGGCACAGAGACTCGAAGAGAGGAGAACGAAGGAGTACGCAGGGAAAAACTCAGAGTTCACACCCACCCGTCCTTGGGCTCCCGTCGCCCCAAGCACAGCACAGCACAACACCGGAGGCCAGACCGCACCATACCACACCACACCAGACCACACCAACAACAACAGCACATCTGATGCAGCGTCTACCGCTTCCTTGCCTGCCTCTGTGTCCTCTCAGAGCTCTTCTCCCTGCGCTCCTGACCTTCCTCCGAGCTTGATCCTGCGGGTATCATTCTCCCATCCATCTTCCGCTGGCCTTTTCTCTCAGCCCGCCATCTGAGGACCAATCTGCCCACTCAATCCTCCTCGACTTCGCTTGCCTTGCCTTGCCTAGCCTAGCCTTGCCTTGCCGACTGACCACTGCCTCACTGACTTTCCCACACTCCTTATTTACCAACTTCCAAGCGAACCCGCTGCTCCAGAGTTCAGTGCAAGCTCTTGTCATGTGCGCTCGGCCTTCTTAGGTAGATAAGAGCGCTCGGATTCCGCTGCGGTGTGCCTACACTGATAACCTGCTGGAAATCAATTGCTAGCTGTTAACCATGATCTTGTGCTTTCTCCGATCTCCTTCGGACTTGTGTCGATAGACAGTGAGTGAGTCACTGCGGCAGTGCTCGATTTGGTCGAAGGACGTTTGGGCCATCAGGGGGAAGGTGGAGGTGTGTATCGTATGGATGAACGTAGTGGAATTAGTGCGGTGAAGTAGATCGGGTCGCCGTGTATTCAGTCTATCTTCGCTTCTAGCATTCTTCAGGGGTTCGTGATGTCGGAATAGAGTGCCACTCCCGACTCTGTGAGTAGAGCTGGAAAGGTACAACAGCTCGTGGCTGGCTGCTCGGTTGGATTCCTTCTTGAGGCCTTGTGCGGATTCGGTCTCGGACTGCTTAGCCCCGTTTGTGTCCGAGTAGAGTGCGGATTGGAGAGCAGCGCGGATCGGAATTTGCAGAGCAAGCGATAGAGACGACAGGTGGGAAACAGAGGCCGTGGAGGCTTGTAGAATTGAGTGGATTCACAGCGAGGGTGTTGACACAAGGTCGAGGCTCATGGTTCGCTAGTGGTCGTCAGGTACTTTAATGTCGAGATGTTAGGAGTCATGGCTGCTGGTTCACCAGCACTTTCTGGCATGGGGCCACAAGGCTCCGAGGAGGGTTCCAAAAAAGTCCGCAAACCGTACACTATCACCAAGTCTCGCGAGAGCTGGACAGAGCAGGAGCACGACAAGTTTCTCGAAGCACTCCAACTGTTCGATCGAGACTGGAAGAAGATCGAGGCGTTCGTCGGGTCCAAGTCCGTAATTCAAATCAGAAGCCACGCGCAGAAGTATTTTCTCAAGGTGCAGAAGAACGGCACGGGCGAGCATGTGCCGCCTCCGCGACCTAAGCGGAAATCAGCGCAGCCGTATCCCCAGAAGGCGCCCAAGGCTGTGTCAGCAGTTCAGCAGCCCGGTGTTCTGGCGCGCACATTGAACCCCCAGCCGACGCAATCCGAGCCTTGCTTGCCGAGGCGAGGCAATTTTCAAAGCTGCAGCATCGGGAGCAACTCTGGGAGCTGGCAGTACCATTCCATGCCGCCGGTGGTGCCCATCACCACAGATCTCCGAGCCACTCCTGATTTTGCCGAGGTTTACAAGTTCATCGGGAACGTGTTCGATCCCGGCATGAACAGCAACCACAATCTGAAGAAGTTGAAAGAGATGGCCCCGATCGATCGCGAGACCGTGCTTCTGCTGATGAGGAACCTCTCCATCAACTTGTCCAGCCCCGAGTTCGAAGAGAGGAAATTGTTCATGCCCGCATTCGAGGCCAATCCGGATGCCGCCAGACCAGATTCCTCAGATCAGCACCTGGCGATGCTTTCCGCCACGCAACCGCCCTCGGACGGAGGAGACGATGATGCTGCGTTTTCTGGACAACCTTCTTCAAACCATCAGAGTGATAGTGGAGACTCGGATTCACAAGTGGACCCCAGCCATGGCCAAACTCGAGTTTTGCCATCCTACTCTGACGGTCCCATGGATGTCGCTGAGCACCGGCGGCTGACACATGAAGGAGGGAGTAGAAGCGTAGACTCAGTGTTACCCATAGCTCCTTACCCCGGATTGACATCTTCAAGGCCGATGACGGACAATTCCTCAGCTGGAGCTCATCGGTCCATGGGTCTGCACTCGCATCCTCACATGGCATTTTCTGGTAGAGCAGACGTGGGGTTTGGGATGCCGCTGCCCACTTTGACGCCAGGTGTAGTGGGGGAAGGCAACATCGATAACTGGTGGAGCTAGCAGCCAGCGGCCTTCATCAGACGCCTGTGCTGTTTTTCCTTAGCTTAAATGTGTACTTTTATTCTTACATTTAGCCACTTTTGCCAGGATGATGTCCTCGTCCTGCTTGTGAAATAAGGCCTATGCAGATAGTTAGTTGTATAGGGGACGATTATGGAAAAGCTTGTGAAAAGGTGGAGTACTGTCTGTAGTAGTGTCGGTACTGGATTCTTTCAGCCTACAGTAGCAAGGCCAACTGAAGAGTGTGTTATAGTCCTGCGGTGGTGTGAAACAAATTGGTCTCCATTCGAGCAATAGCCTCGGAAATTTTAGAAATCAAATGTACATTACCAGTTGCCGAAAATATGTTCATATGTTGTACACTTCCTACGAAGAAATTGAAGTCGATTGCTCATCTTTCTGGCCTCGGCTCTTATC

CDS

>Mapoly0042s0058.1
ATGTTAGGAGTCATGGCTGCTGGTTCACCAGCACTTTCTGGCATGGGGCCACAAGGCTCCGAGGAGGGTTCCAAAAAAGTCCGCAAACCGTACACTATCACCAAGTCTCGCGAGAGCTGGACAGAGCAGGAGCACGACAAGTTTCTCGAAGCACTCCAACTGTTCGATCGAGACTGGAAGAAGATCGAGGCGTTCGTCGGGTCCAAGTCCGTAATTCAAATCAGAAGCCACGCGCAGAAGTATTTTCTCAAGGTGCAGAAGAACGGCACGGGCGAGCATGTGCCGCCTCCGCGACCTAAGCGGAAATCAGCGCAGCCGTATCCCCAGAAGGCGCCCAAGGCTGTGTCAGCAGTTCAGCAGCCCGGTGTTCTGGCGCGCACATTGAACCCCCAGCCGACGCAATCCGAGCCTTGCTTGCCGAGGCGAGGCAATTTTCAAAGCTGCAGCATCGGGAGCAACTCTGGGAGCTGGCAGTACCATTCCATGCCGCCGGTGGTGCCCATCACCACAGATCTCCGAGCCACTCCTGATTTTGCCGAGGTTTACAAGTTCATCGGGAACGTGTTCGATCCCGGCATGAACAGCAACCACAATCTGAAGAAGTTGAAAGAGATGGCCCCGATCGATCGCGAGACCGTGCTTCTGCTGATGAGGAACCTCTCCATCAACTTGTCCAGCCCCGAGTTCGAAGAGAGGAAATTGTTCATGCCCGCATTCGAGGCCAATCCGGATGCCGCCAGACCAGATTCCTCAGATCAGCACCTGGCGATGCTTTCCGCCACGCAACCGCCCTCGGACGGAGGAGACGATGATGCTGCGTTTTCTGGACAACCTTCTTCAAACCATCAGAGTGATAGTGGAGACTCGGATTCACAAGTGGACCCCAGCCATGGCCAAACTCGAGTTTTGCCATCCTACTCTGACGGTCCCATGGATGTCGCTGAGCACCGGCGGCTGACACATGAAGGAGGGAGTAGAAGCGTAGACTCAGTGTTACCCATAGCTCCTTACCCCGGATTGACATCTTCAAGGCCGATGACGGACAATTCCTCAGCTGGAGCTCATCGGTCCATGGGTCTGCACTCGCATCCTCACATGGCATTTTCTGGTAGAGCAGACGTGGGGTTTGGGATGCCGCTGCCCACTTTGACGCCAGGTGTAGTGGGGGAAGGCAACATCGATAACTGGTGGAGCTAG

Protein

>Mapoly0042s0058.1
MLGVMAAGSPALSGMGPQGSEEGSKKVRKPYTITKSRESWTEQEHDKFLEALQLFDRDWKKIEAFVGSKSVIQIRSHAQKYFLKVQKNGTGEHVPPPRPKRKSAQPYPQKAPKAVSAVQQPGVLARTLNPQPTQSEPCLPRRGNFQSCSIGSNSGSWQYHSMPPVVPITTDLRATPDFAEVYKFIGNVFDPGMNSNHNLKKLKEMAPIDRETVLLLMRNLSINLSSPEFEERKLFMPAFEANPDAARPDSSDQHLAMLSATQPPSDGGDDDAAFSGQPSSNHQSDSGDSDSQVDPSHGQTRVLPSYSDGPMDVAEHRRLTHEGGSRSVDSVLPIAPYPGLTSSRPMTDNSSAGAHRSMGLHSHPHMAFSGRADVGFGMPLPTLTPGVVGEGNIDNWWS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>