Mapoly0043s0095



Description

PROTEIN LCHN [SOURCE:UNIPROTKB/SWISS-PROT,ACC:Q1LX49]

Reference DB

Database ID Description
OrthoMCL OG5_153164
PANTHER PTHR21717 TELOMERIC REPEAT BINDING PROTEIN
PANTHER PTHR21717:SF12

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB12 transcription factor, MYB Mapoly0043s0095.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0043s0095.1 scaffold_43:961682..972921  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0043s0095.1  

Gene structure:

mRNA scaffold_43:961682..972921  ( + strand )
five_prime_UTR scaffold_43:961682..961990  ( + strand )
five_prime_UTR scaffold_43:962989..963208  ( + strand )
five_prime_UTR scaffold_43:963700..964050  ( + strand )
CDS scaffold_43:964051..964134  ( + strand )
CDS scaffold_43:964770..966108  ( + strand )
CDS scaffold_43:966483..966692  ( + strand )
CDS scaffold_43:967937..968014  ( + strand )
CDS scaffold_43:968184..968261  ( + strand )
CDS scaffold_43:968364..968443  ( + strand )
CDS scaffold_43:968671..968912  ( + strand )
CDS scaffold_43:969407..969982  ( + strand )
CDS scaffold_43:970108..970171  ( + strand )
CDS scaffold_43:972008..972160  ( + strand )
three_prime_UTR scaffold_43:972161..972921  ( + strand )

Sequences:

Gene

>Mapoly0043s0095.1
AGCGAAGAGAGGTCAGGCGATTGCATGGTGAGTGGGTGGAAAGCGCAATTGAGAGGCGTCTGTCCAATTTGATGGGAAGGGCCGAATTGGCCGTGCAAAGAAGGCGGATCGAGGATCGTCCCGGTGTCATGGGAAGGGTTTAAGCTGGCATGCGCAAGATCAATGGGTGTGTGATGAGACTGGAGAGGGTTTAGTGGCGTCATGACAGGTCGAGGGTTTATCAGACAAAGATCCATGGCCTCACAGTTGATAATTGAGACGTCTAGGACAACAGGTTGCTATGTCGGAGTAGAACATGGGTTTCTGCTGGTAAGTTGCCACCTGATCTTGGGGTTTTAGAAGTAAGAAGTGAGGCCATGGGGTTTTGGACGTTCATTCGAGAGTATCATTGTGGCCTGCTTGTACATCTGCGCATGCTGTTACACATGACGTATTCTGATGCTGGTCTCCTGCACTTTCACGTCGTCCCAAACGAGGCTCTTGAAACTGTACTCAATTGTTCGTGGAACAAGTCTGTTTGATATTGTATGACAGTTCACAACATTTGGGGAGGGAGCCTCTCGGCCATACGCTAGTTAACTCGGTCAGCCTGCATGCGACTTTCGGTGACGCCGAGGCCAGATACGGGGGATTGGGTGTTATGAAGTTCTAGTGACGATGAAGGCGGTCAATTTCTCGTCGTTGACACTCGTTTTTCATCGCCAACTGTTTTTTGACCGTTTCATCTCGCGGCATTCCCAATCTGAAGTGAGGAACAGAGTAGCAATCTGCGTGGCCATCGAATTGTTATACCTCCGTAAAAGTCATCGTCGTCTCAATGCGACTCGGAAAGAACCCGAAGAAGTGTGTACATGGTCGATGTGGTCCGTCGTGCACTGGTTGGGTCACAACCAATTGATCATATGGGTCAATCATGTGCTGTATGGCCAGCTAATGCCAAGAACTACCTGTGAAGCCGCGGTGACTTGATCCGGCGACAGCGAGCTCTTGTCATACTGGGAGGAATGGTCGTCCGTAAACTGAGATGGCCTCTGTCCCGAAAGTACTGTGTCCGGGCCAGTGACTGATCAAGGGGTTTTAGGACAAGGTTTCTCTTGCTTTGTTCTAAGTTGAGGAATGTGCAACTTAATGCCTTTGAACTTGAACCTGTGAATATTGTGGTAATTTCGCCAGCGGTTGTTGCATGTTGTTCAGATCAGCGAAGTTTTCGATCGGGCTTTGCGTACTTCCTGTTTATTTTGTCCCGTTTTGAATCACGTATTTGTAACCTGTCTGACTTGTGATGCGACTGTTGTGCACTTTCAAAGAGTCAAAGTGCATGGGAAGAGCAAGCGAGTTATACTTCGATCAAGGAGAGACTCAATGAAAGAGCCTCGTGCTCTCGAGAGTCTGTTGGACTGAAAAAGCTCCAATCGGACTTCTTGCAACATGGCTCTGTATACGTTCCAGATGGACGTACATGGCAGCGATAAGAACAGAGAAGCTATGGAGTATAACTGCTTGGCGAATTCTGAAGGAAGGCCATAGGTTTGTGGCTAGAAATCACTATCTGGCGGACAAGTTGCTGCGATCGACAGTTTGCTTCTCTGATGATTCCCTTAGGAGTTGTGATGTTCTTTGACTAGTGACGGTGGAGCAAGATAGGCTGAAATTAGGCTGTTGAAAGTTTTCTTCTGGGATGCGATCTGATCGACGACCATGCGTCGACATTTGTTTCTTGAAGAATGCTGCTTTCGGAACTTTGATCGCATATGATATGCGTCAAACACTAATGCGGAGGTCAGGGTACTCAACGTAGTCACCTTAGCCTACGATGCAAACTCGCCAGCAGCAGTTATCGGCCTGACCAAGCTAGGCACGAGCCAAATAACTAGTCTCATCGACGGTTTTCTCGTGAAAAGCCAATGCACGTGATCTAAATTAATCTTGCAGTTCTGTCTGGAACAGTTATAAGGGTCGTGTATCAAGTCAGGTGCTCGCACTTCTAATTCTCAAGGTTTTGTGTTTCATCCTGTCAGGGCTCAGCTGCCGAATCAGGAGTTGACCACCATCCACAGATTAAGTTGATACCCGCTGGAAAAGCACGCGAATTGTAGAGAGGCACCGTAAACAGTCGATTAAAGGATTGATCAAGAGGTATTTTGGTCGCGTAGGCGACATTTGGATGAGACGCCGGTCAGGACAGGCTGTATCCAGTTACAATCTCAAATCGCCTGGAGCCTTCAAGAACGTACATCATGAATCAGGAGAGAACTTGTGAAGGAGCTTCTTAGTAAAGGGACACTGCGGATTTGATTCTTCGCGGAGTTTGAAATTTAGATTACAGAATTCGTGAAATTTTGGAAATCTCCAGAAGGTAATGTAGGAGGATGGAGGCTCGAAGTCGACGAGTTGGGGGTGGATTTCCAGGTTACAATGGCCCTGCCCTGCCTCGTGCTATGCGCTCCTCCAGGGTATGAGCTCGTTCTTCTCGTATGAATATTCTGTCTGTGTCTGCCAATTCTTCATCCTCTTGTGGGCAATTTGCCAAACGCATGTACAGGTTGTGTTGTTGAACCCTGCTGTGTAGATTTTGTATCTGTTGACTGTTGATGATCATCGCTTTAGACAACTCGTGGCTTTGTTCCTTCTATCGTTTCGGAGAAAAACTTACATTGGAAGTGCAACTGCTTCTGTAGTTCATATATACCTCTAGATTTTTTGTTGTCAGTAACATCGCGAACAGTGATAACCCCTGATTACCGAGCACACTGTCTCCCTCTTCTTGTATAATAACCCCTTTGTGGAAAGATTGTGACACTTTGATTTGGCTGTTGGCAATTGAGGAGTGAATTACCTTGATTGGATTGGCTAACAACGTTAAGATGCAAAATAGTGAAGCTTAAGATTGCCCCAGTCAATTGTAGGCTTCATGATGGTTTGAACCCAGCGTAAGAGCCATAAATGTTTCCCGCAGGTGGACGTATTGAACTAGAACAATCTCAAAATTCTAAATCTCAATACGACAAAGTTTCATAGCAATATTCACTGATATTTGTGTTCTTCCTCCTGCAAGTGATTGACGTGTTTCATGTTGGAAATTGAATAGGGACGTGGAGAAGCGGCTAGAAAGGCAACTGTGTGCGGAGGGAGAGCTGGATTTTTTGAGCTACTTGCCACTGTAGCAGGGCAAATTTTACAGGATGATAGCAATGGGGAGGAGCAAGATTTGTCAAATATATCTGGCGTGAAGCTAAAGTGTTCAGAACTGAAGGAAAAGGATTCAGAGTCGTATGCCAGGATCTCTCTTGCGAAGAAAACGCTATGTGAGCCATCCTCAATTGCAGCTTCATGCTTGAACTCATTGCGAGCAGGCATTAGAGATGAGGAAGCGAGGAAGCACTTCGGTTTAGAAAAAGAAGAGGATGAATCCGCCGAATCAGCTCACATGGTAGTCAACAGATCGTACGTTTCTTGCTCATCTCCAGAAACACGAAATCAGACCCTGCTTGGGTCCGACAAGGTAGTCACTGCAAGGAGTGATTGCGTAACAGTAAGTACTCCAGAGCAAAAGGTTCCTGAAGGTAACAAACAGATGGCCGTATCTGTTTCTGATAATGACGAAAACCAGACAATCAAATCTGATCCCGAGTCTAGTCTCTCCTCGGCGATTAAAGATGCTTCAGATTCTGATGAAATGCATCTAGAAACTAGAGAACCTGTTGAACGGCTGCAAATTCCCAAGATTGAAGACCTGGAAGATGGGGACCACTTGGATGACCGGAAGGAGCGTAAGTTTAGCATTCGAGGTAATGAACAGCTTATTGACATGGAAATTGATCTGCCTAAGGCTTCTGTGATGGAAGGAAGCATGCATTACGAAGGTCATGATCCTGTGTCGAGTACTGCATCGGAGGCGACTAAACCGGAACCCTCTTCTGGTGAAGTCACGCATCTACATAGTTGCTTGGCTTCCAGAGAGGAAGACGCATTGCTTAGAGACGTGGTTAGGAGTTCGAAACGTATCATTGACGACACCGCGAGGAGTCCGGGTGACAAGAAACCATGGAAACGCACAGATCCTTGTGGTAAAGAGGATGAGGGCGAATCAGGTGTCGAAGTCGATGATAAGAGCATTTTTGAAACCAGAAAACCATTGAAAGTCACGGATGTGATTCTAGGTAGATTAGTTGCTGAAAAAGTTGGAGTAGAACGTGGATTTGTAAGTGAGCAGATTTTGGAAAGTAGCAGGGAGAGAATTCTCTCCAAAGACAACAATAACTGTTCTTCGAAGCGGAATCTGCCTGAGAATGTCTCACAGAAGCTGAAGGACTCTTACGCCAAGGGTATGAGAGCAAGAAAAGTTGTAAAGATGGTTAAGCGCAGCCGTGTTTCAAATTCCCGGAGCAAGAGAAAGCACGCCGAGATGGAAGCTGCAGCAGATTCAGGTTTGAGCAAATTCTTCCTCAAATTGTCTAGCTGCAATGTCTCGGGTTTCGGAAGAAATTTTTGTCTTAGTCGCCTTTGATTCGTAACGTTGCACAAATTTTTAACAGATGATTTTCACTCGAGTTTGAAGCCTCGGTTGTTCTAGCCTTAATGGGCAAATAGAAATGTATTTCCACCTGAACAAGTACTAGAACATTCATCGTAAGGCAGCACAGTTTGACATATCTGACAGTTGATAGCATTGCGTGTTCGTCACTGGAAACTTGTTTAGGACTATAGAGTTGCTGATATGACCATGTCTGTTGTTGCACGTGAGAGATCCTATGAGATTCTTGCACATTTGCTAGAACTTTTCTGTTGTTTTTATTTTCAGACGAGGCGCAAGGGAAGAAGGCGTACTATAGAGGTCTGTCGTACACTCGACAACGGACATCCAGAGGACTGCCAGCTAAACGAAAGCGGATGGCTGATGGTGCACCGTCAAGCTCTCCAGAGTTGCATGTGAACACCAGTGATCTAATGGAGCTTGGTTTTGATTGCGCGGAAGGGGAGCCACCTGCAGCGGCAGCTAAATTAAGAAGTGGTAAGTACTTCCCACAGTACAAGAAGAAAAGTTTACATTTATGCATCTAATGGAAAAGAGTTTAGCTGGACGATGAGGCATAAGATATTTTGTTATTTTCGTCCTTCTATCTTATTTGTGGTGAGAGAAGCACTTTTTTTAAATTTGAAGTCAACTTGACCAAATTCACATATTTATTAAGTCTTCGAAACTGTAGATGTTTTGTTGTGGACTCTTGAATAAGAGAAGCTTTTAGAGAGGGGCAATGGCACAACTAATCTTTGTGCATGTGATTGTAGCATGCAAGGGAAGCGTCATAGGCATGAATGGTGCTAGGGAGTGGCAGACAATTTAAATATTTCCAGATTTGCGCATAGACTTGGGATGTGGGACTAATAAATTAACTTTGACAGAGGCGAGCAAACTCATCATCCGTTATCTTACCCGAGATGCCTTGTTCCGTTTCTTCTCTTTTGAAGAGATGCACCGTAACCTCAGTCACCAAGTCGTTAGATTCCATTATAGCTTACCAGAATCCGCAATTAAATCAGAACAGCATCTCTAATCCTGTCACTGGTAACCACAATCTGTCACTACCGGGAAGTATTGTATACTTCCACCCTGTTAGGAAATGTCAAAGACGATAAATCAGTTGGCTTCTTCTTCTTTTTGGAAGTGGACCCTCGGTGTAGTTGATAGTTCGGTGGATTACCAGAAAGTGCTATTTGAATTTGCAATCTCGTTGAGTCCATCAATACTCAAGAACATGCACTCCTATGGATATCTATCTTCATAAAGACTCATTACATGCTTGTAGGGGTGGGGGTTGAGAGAGAGGATGAAGCCTTGAAATATCCTGCGCCACTTGTGTCAAGGATTGGAGAAAATTCCTCGTTAAGCAAAGAGAACAACAATGAGTATTTGCTTTTTGTTTGAGGACATCTGATCAAGGGAGATGAGTGTAATGCAGGATAATCAGTAAGTCTTGTCCAAGCGAGAAGGAAGTGAATTGTACTTATTTTGCGTTGTATGTATGCCTAGTCTTTTGATCCTAGTTCAAATCTCCCAGAAAGCAGCCATGTGGATAGAGAGGATATCTAAAACTCGATTATCAACAAAATAAGCTCTTCATCCAGCACCTGAGTCTCGTTTCTCTTATTTCATGTGATACAAGTCCCAAAACTTGTGGTTGATAGAAGCTTCAAGTTACCCGTGCTCGTTACACGGCTTTATCTTTATACAAACACGGTTGCAAACTTGGCCAGATAAACACAATGGAAAAGGCGAGCACGTAGGAGGAATTGATCAGGCGCGGAATGCTTTTGTGGAATCTGCATGTACAGGTGGGCAGTGGGAACTAACGTTTTTGACGACGTGAATCTCATGGTACATGTTGATTCGAACCTGGCTACAAAACATAAACCCATAAGCAGTAACTTATGCCAGATATTTATGATAGTTTTACCAAAGGAAATCTGTGTTTACTGAGAGACAAACTTTTTGGTTTTGCAGCTAAAGCTGCGAGTGTTGCAACTTCTCCAACAGCCAAGGGTTCGGCGAAGTTATCGAAGAAGTCAAATGAACCTCATGGTGCGATACTAACTGATTTCTTATTCGATATATCATGGTTATAATCCTTGCCAATATGCCTACAGCGTGTACTAAAAACATTTCGTTCTCCTTGCCATGCAGTCAAGCTCACCATCAAATCTTTCACAGTTCCAGAATTATCTGTCGATCTACCCGAATCAGCAACAGTATCCAGCCTCAAGGTGAGATGCGTTTTTGTAAACTGTGGTCTCAGCCTAGTAGCTTGTTTCGTACTGTTTACAACATCAATACAGTTGCTTGAAGTCTTTGCGTGCATCTAAAGCAGTTTACTTTTACGGATCGGCAGACCTTTTTTCTAGAGCATAAGCAATTTGTTTCTCTTGTAAATGGTGTTTAATATTTCATATCTATATTATTTCTTATCCATTAGCTTCTCATGTGTGAACAGCGAGCTGTGATGGATGCGGCGATGAATCTTCTAGGTGGGGGTTTGAGGGTTCGAGTGCTTCTCCAAGGCAAAAAGGTTCCCGATGAAGGCGCAACTTTGGCTCAAGTTGGTATTTCTCGTAGTGTCAAGCCAGATTCATTGGGTTTCATGCTGGAGCCGAGTCCTTTGCCTACGTCACCCACATCAACGTCCGAAGATCCTCTCCTCGTTCTGTCTCGCGCTGCTGGTCAGCCATCTCCACGGTAATAAGAGTTACACTCACTTGTCGAGTCCAGTATATTGAAGGCCATATGAATGTCCTGGATCTTAGCGATATCGACATAGGATCACTCAAAAAGGGAATCATAATGAGCTAAAACTGTTTCTACGCTGATCTTTGTTTTTGAAGTTGAGACCTTATTTAACCAAGTCCGAACTTGAATATCACAAATCTTACAAGTAAATGAGAGACTAATCTTACAAGATTAGAGTCATGTGCAGGAGTATCTGCTCCTCAGACTTGCGCCTTTCTTTGGCTTGTCATCGTACCTCTTATTGAGTGATAGGGTTTAGGGTTGATTGTGGATTTGTGGTAGTGGTCAGGTATACAGCTCGTAAGTCAGTGTAGTTCTCCTTTTGAATTGGTGAAATATTTTAACTCTGCCTTGTGTGCGATCCGTATACGAGTACAGATGGGTGGTGCTGTTCTTGAATTGATTCGATGACTTGCTAACGGATGTTGTTTGTTTAAATTCAGATTCAACGGATTTGGATCTCCAGGCATGCCTAGTGCTGCTGAGCTGGGAAGTCGGTGTCCACAAAAGACACGATCAAATAAGGGTACCGGAGGACCAGTTGATGGAGAGGCATACACTGCACCAGTGTCAGGAGATCACAATGAAGCTAAGAGATCAGGGATGACATTCCAAGGTCCACAAGAGGATGCCCTTAAAGGATGCCCTGTCAGCAAGCCCAAGTCAGGCTTAAATGAACGAATGTCATTATCACCCCACTCAACGAGGGTTGCAGCTGCCGGAGCTTTGGCAGCTATAAGAGCACAGGCTGATGCAAGTCGTCGGTCTGCAAAGAACGAATCTGATTCAGCAACTCCTGCTTCTCATACGCTTGCTCATGAAACAATGGTTCCCGGTTCGGGAGCTATTATTCTACACCCTGGCATGAATGTGGGTGAGAATATGCAGGGCTTAGCACTTGTTCCTGTACGACAGAAGTCGCATTCTATGGACGTAGGTAAACGCCGTGTTCGTAGACCTTTTAGTGTGAGTGAGGTGGAGGCTCTGGTACACGCCGTGGAGAAGCTTGGAACTGGCAGGTAAATTGATCTTCTTTAGATGTTCCATCGTGTAAAAGCAATGATGTAGCTTTGGTTCTACAAGAATCAGTAGAGGTTTATCTCTGGTTACTAATTAGAAATTGTCATTGTAACTTTACTTACAGATGGCGCGATGTTAAATTGCGAGCATTTGATCAGGCCAAGCACCGTACATATGTCGATCTGAAGGTAATATTCCACACTTTTCCTCATATCTTCTATTACTTAAGATAATTATAGGGAGCACAAGATGCCACTGCTTCTACTCTCCAGAATGTTTACATTTGTTTGCTTGCTAAAGTAGGCTAGTGAGCAAAGTACTATGGTCAGACCGGTGCATCATGATTTCACCGGGCTATCTAGCGAAATGACTTTCTCTTGGCACTGTGGTTCATCGACATGCCCCCAGCTATAACAAGTACTATGGTCTGACAACAATTTTCGTACACGAACATTAGTCTGTGGGTTCAACAGCTTGCTTGCTGCATCACTCCATTTGACCAAGCTCTGAGAGCGCTGCACAAAATCCACAATTATCTCCGAGACTTAGCCTATATCTTGCCAGATGGAAGACCTCTTTTAGCTCTCCAGTCTTGCGCTCCCATCTTCTTGAGCTGCTGCCATGTTCAGCATACGTAAAGAACAAATGCCCCTGGTTTGTTATGTTTCTTATGCGTGTCTCTCCTCTAGCCTACCTGGGAAGTTAATACTGCCGATAGATGCTCATGATAGAAGAATGGTGAGTTTCCGACGGACAAGATTGATGCGGTGGACAAGAGCAGAGATAGGAAGTTTCAAGATAGTACTGGACGTTCCCGCAATGTCTTTTGTTGATTCATTAGCTTGTAGGTGCAGACAGTCAGCTGGACAGAGCAATATTTGCCTGCCACCCAGGTGTGCGCTTCACCTCATTCTCAACCAAGAACTGTATTTCACTGCAGGGGTTCCAATGGTTGTCCTCAGAACAAATAGCTGTGTAAATCCATCTGTATCAAACAATTCCCTAAATATGCACATACATGAAAGCCTTGTATTTGGAGTAGGAAATACGACTGGAACATGGGAGGTGAAGAATGTTCCTGAAAAACACTTTCTTGCTGTACCTTGACATATTGCGTATGTGATGGACCTGATTTAGCAGTCCTGCGGAATATGCTAGTCTGTTGATGCTATCTTCTGGAAGGTTTACTTCCGATTGAGATTATCCTGTGGTGTCCATTCCATTTGAGATCTGTTCGTGGTGCTCTGTTACTGACACCTACCTCATTTGCAAGCAAGAGATCTAAAGGACTAGGAAGATTTCTCAGCTCCTCTTGTAGATTCTGATTGAAATTTTGAGAATCTAGACCGGATGAAGGGACTAGTATGGAGGGAAAAGAAGTTCCAGTGACAAAATATATATGAAAAATAGATAGAATACCAAGGACTCACACTTGGTGTATACTTCTGATAACGTGATCACTTACGACGTTCTAGTTTAAACGCCATCAGCAACTGCTCATGCAGGCCTATGGCAATCTTGAAAGATGTAAGACATTTTACTTGGGTTCTTCAGGCGAAACTCAGTTCCTGTGATTCCACTAGGTGACTGTTCCGTTAACACCTGCCGTAGGATCTCAAGTTTGACAGACAAATATATGGTCTCGTTGAACTCGTGGAATGTCTTGAAGTGAACGCACAGCCTTCACTTCTAGCCGCCCTGAAGCTCCCTCCCATCAACTTGCCAATGCTAGTGATGTGGAAGTTCAATTTAGTTCGAGAAAGTTTGAACCATTCACGAGGTCTTTGTTAGATTCATTTTGTAAGCCTCAGACAGCCCCGCTTGTTAACCAAACAAAGCTGTTATGCATAGTATTGGATACAGGTCTTGACTTGATATTTAGACTCTAGTATAATCCTCCAAACATATACCTGTGGGAAGTTGTTTGATTGACAAATAAACTCTCCGCAGTTGGGTTTCTGATGCGCTTCTTAAGGTTGCATTTCTTACAGCGTTATGCTTTGCATGTTGATTTTGAAATACAGGACAAATGGAAGACACTCGTCCACACAGCACGTATAGCACCCCACCAGCGACGAGGGGAGCCCGTCCCACAGGAACTTTTGGAACGTGTCACCCACGCCCACACTTACTGGACGGCACAGGCAGCTAAGCAGCAAGCAGAACTTGACTATTGATGAGGTTTTGGGACCAGCTTGCAGGTTGTAGATTGCAGAAGTAAGCAATTCTTGGGTTCCCTGTGGAGTGGGTTGTAAAGTGTAATTTTTCTTTCACTTTCTTTTTTTTTCCTCCTTTCCTTTCTTAGTTCGCCCCTTAAACTTAGAATTCGTGGGCTCATTTGCATGTGACTGTACCATTCATTTATCCTTTTGAGGCTAGTCAGGTAGCTACGTTGTTCATTCTATTCTTCATAGAGAGACAGAGAGGGAGAGGGAGGGTGCTGAACCTGAGGGTTACCACGCTTGCTTACTGTCAGCTACGGCCTATCAGCAAGCAAGGTGAATGTGAGGCAGCACTATCTATAGTGGGTGCTTTATCCATGTAGTCCTAAACATGGGCAAGTGCAGAATGTGCCTCAACAGCGAAACCGTAGATTGACGCACATTTGTGTGTCTTGGAAACGATGTAAATCTGATATACGCCAGCAACATAACTTAGGGCAATTGTAACTTAACTTAGTTTGGGCGGTACTTGTGACACACCAAATTTGTCAATATCCCCGCTGCGAAGGCACGAAAGGAGCTGATGAGTATCTTAAAGAGATAAGAGCTTGTCCATGACTTTGTGCAGTAAAATGCCTTGCACGCCTGTATAGGGGTTCAAACACCCTCGTTTTCATTATTATCCATCCATCAATTCATTTCTTTTGTCTTCATTTTTTCTAGTGTTGTAGGTTGTAGTTTAAAAGTAAGTCGGAGTGGCTCTGGGACTCAATATG

mRNA

>Mapoly0043s0095.1
AGCGAAGAGAGGTCAGGCGATTGCATGGTGAGTGGGTGGAAAGCGCAATTGAGAGGCGTCTGTCCAATTTGATGGGAAGGGCCGAATTGGCCGTGCAAAGAAGGCGGATCGAGGATCGTCCCGGTGTCATGGGAAGGGTTTAAGCTGGCATGCGCAAGATCAATGGGTGTGTGATGAGACTGGAGAGGGTTTAGTGGCGTCATGACAGGTCGAGGGTTTATCAGACAAAGATCCATGGCCTCACAGTTGATAATTGAGACGTCTAGGACAACAGGTTGCTATGTCGGAGTAGAACATGGGTTTCTGCTGAGTCAAAGTGCATGGGAAGAGCAAGCGAGTTATACTTCGATCAAGGAGAGACTCAATGAAAGAGCCTCGTGCTCTCGAGAGTCTGTTGGACTGAAAAAGCTCCAATCGGACTTCTTGCAACATGGCTCTGTATACGTTCCAGATGGACGTACATGGCAGCGATAAGAACAGAGAAGCTATGGAGTATAACTGCTTGGCGAATTCTGAAGGAAGGCCATAGGGCTCAGCTGCCGAATCAGGAGTTGACCACCATCCACAGATTAAGTTGATACCCGCTGGAAAAGCACGCGAATTGTAGAGAGGCACCGTAAACAGTCGATTAAAGGATTGATCAAGAGGTATTTTGGTCGCGTAGGCGACATTTGGATGAGACGCCGGTCAGGACAGGCTGTATCCAGTTACAATCTCAAATCGCCTGGAGCCTTCAAGAACGTACATCATGAATCAGGAGAGAACTTGTGAAGGAGCTTCTTAGTAAAGGGACACTGCGGATTTGATTCTTCGCGGAGTTTGAAATTTAGATTACAGAATTCGTGAAATTTTGGAAATCTCCAGAAGGTAATGTAGGAGGATGGAGGCTCGAAGTCGACGAGTTGGGGGTGGATTTCCAGGTTACAATGGCCCTGCCCTGCCTCGTGCTATGCGCTCCTCCAGGGGACGTGGAGAAGCGGCTAGAAAGGCAACTGTGTGCGGAGGGAGAGCTGGATTTTTTGAGCTACTTGCCACTGTAGCAGGGCAAATTTTACAGGATGATAGCAATGGGGAGGAGCAAGATTTGTCAAATATATCTGGCGTGAAGCTAAAGTGTTCAGAACTGAAGGAAAAGGATTCAGAGTCGTATGCCAGGATCTCTCTTGCGAAGAAAACGCTATGTGAGCCATCCTCAATTGCAGCTTCATGCTTGAACTCATTGCGAGCAGGCATTAGAGATGAGGAAGCGAGGAAGCACTTCGGTTTAGAAAAAGAAGAGGATGAATCCGCCGAATCAGCTCACATGGTAGTCAACAGATCGTACGTTTCTTGCTCATCTCCAGAAACACGAAATCAGACCCTGCTTGGGTCCGACAAGGTAGTCACTGCAAGGAGTGATTGCGTAACAGTAAGTACTCCAGAGCAAAAGGTTCCTGAAGGTAACAAACAGATGGCCGTATCTGTTTCTGATAATGACGAAAACCAGACAATCAAATCTGATCCCGAGTCTAGTCTCTCCTCGGCGATTAAAGATGCTTCAGATTCTGATGAAATGCATCTAGAAACTAGAGAACCTGTTGAACGGCTGCAAATTCCCAAGATTGAAGACCTGGAAGATGGGGACCACTTGGATGACCGGAAGGAGCGTAAGTTTAGCATTCGAGGTAATGAACAGCTTATTGACATGGAAATTGATCTGCCTAAGGCTTCTGTGATGGAAGGAAGCATGCATTACGAAGGTCATGATCCTGTGTCGAGTACTGCATCGGAGGCGACTAAACCGGAACCCTCTTCTGGTGAAGTCACGCATCTACATAGTTGCTTGGCTTCCAGAGAGGAAGACGCATTGCTTAGAGACGTGGTTAGGAGTTCGAAACGTATCATTGACGACACCGCGAGGAGTCCGGGTGACAAGAAACCATGGAAACGCACAGATCCTTGTGGTAAAGAGGATGAGGGCGAATCAGGTGTCGAAGTCGATGATAAGAGCATTTTTGAAACCAGAAAACCATTGAAAGTCACGGATGTGATTCTAGGTAGATTAGTTGCTGAAAAAGTTGGAGTAGAACGTGGATTTGTAAGTGAGCAGATTTTGGAAAGTAGCAGGGAGAGAATTCTCTCCAAAGACAACAATAACTGTTCTTCGAAGCGGAATCTGCCTGAGAATGTCTCACAGAAGCTGAAGGACTCTTACGCCAAGGGTATGAGAGCAAGAAAAGTTGTAAAGATGGTTAAGCGCAGCCGTGTTTCAAATTCCCGGAGCAAGAGAAAGCACGCCGAGATGGAAGCTGCAGCAGATTCAGACGAGGCGCAAGGGAAGAAGGCGTACTATAGAGGTCTGTCGTACACTCGACAACGGACATCCAGAGGACTGCCAGCTAAACGAAAGCGGATGGCTGATGGTGCACCGTCAAGCTCTCCAGAGTTGCATGTGAACACCAGTGATCTAATGGAGCTTGGTTTTGATTGCGCGGAAGGGGAGCCACCTGCAGCGGCAGCTAAATTAAGAAGTGATAAACACAATGGAAAAGGCGAGCACGTAGGAGGAATTGATCAGGCGCGGAATGCTTTTGTGGAATCTGCATGTACAGCTAAAGCTGCGAGTGTTGCAACTTCTCCAACAGCCAAGGGTTCGGCGAAGTTATCGAAGAAGTCAAATGAACCTCATGTCAAGCTCACCATCAAATCTTTCACAGTTCCAGAATTATCTGTCGATCTACCCGAATCAGCAACAGTATCCAGCCTCAAGCGAGCTGTGATGGATGCGGCGATGAATCTTCTAGGTGGGGGTTTGAGGGTTCGAGTGCTTCTCCAAGGCAAAAAGGTTCCCGATGAAGGCGCAACTTTGGCTCAAGTTGGTATTTCTCGTAGTGTCAAGCCAGATTCATTGGGTTTCATGCTGGAGCCGAGTCCTTTGCCTACGTCACCCACATCAACGTCCGAAGATCCTCTCCTCGTTCTGTCTCGCGCTGCTGGTCAGCCATCTCCACGATTCAACGGATTTGGATCTCCAGGCATGCCTAGTGCTGCTGAGCTGGGAAGTCGGTGTCCACAAAAGACACGATCAAATAAGGGTACCGGAGGACCAGTTGATGGAGAGGCATACACTGCACCAGTGTCAGGAGATCACAATGAAGCTAAGAGATCAGGGATGACATTCCAAGGTCCACAAGAGGATGCCCTTAAAGGATGCCCTGTCAGCAAGCCCAAGTCAGGCTTAAATGAACGAATGTCATTATCACCCCACTCAACGAGGGTTGCAGCTGCCGGAGCTTTGGCAGCTATAAGAGCACAGGCTGATGCAAGTCGTCGGTCTGCAAAGAACGAATCTGATTCAGCAACTCCTGCTTCTCATACGCTTGCTCATGAAACAATGGTTCCCGGTTCGGGAGCTATTATTCTACACCCTGGCATGAATGTGGGTGAGAATATGCAGGGCTTAGCACTTGTTCCTGTACGACAGAAGTCGCATTCTATGGACGTAGGTAAACGCCGTGTTCGTAGACCTTTTAGTGTGAGTGAGGTGGAGGCTCTGGTACACGCCGTGGAGAAGCTTGGAACTGGCAGATGGCGCGATGTTAAATTGCGAGCATTTGATCAGGCCAAGCACCGTACATATGTCGATCTGAAGGACAAATGGAAGACACTCGTCCACACAGCACGTATAGCACCCCACCAGCGACGAGGGGAGCCCGTCCCACAGGAACTTTTGGAACGTGTCACCCACGCCCACACTTACTGGACGGCACAGGCAGCTAAGCAGCAAGCAGAACTTGACTATTGATGAGGTTTTGGGACCAGCTTGCAGGTTGTAGATTGCAGAAGTAAGCAATTCTTGGGTTCCCTGTGGAGTGGGTTGTAAAGTGTAATTTTTCTTTCACTTTCTTTTTTTTTCCTCCTTTCCTTTCTTAGTTCGCCCCTTAAACTTAGAATTCGTGGGCTCATTTGCATGTGACTGTACCATTCATTTATCCTTTTGAGGCTAGTCAGGTAGCTACGTTGTTCATTCTATTCTTCATAGAGAGACAGAGAGGGAGAGGGAGGGTGCTGAACCTGAGGGTTACCACGCTTGCTTACTGTCAGCTACGGCCTATCAGCAAGCAAGGTGAATGTGAGGCAGCACTATCTATAGTGGGTGCTTTATCCATGTAGTCCTAAACATGGGCAAGTGCAGAATGTGCCTCAACAGCGAAACCGTAGATTGACGCACATTTGTGTGTCTTGGAAACGATGTAAATCTGATATACGCCAGCAACATAACTTAGGGCAATTGTAACTTAACTTAGTTTGGGCGGTACTTGTGACACACCAAATTTGTCAATATCCCCGCTGCGAAGGCACGAAAGGAGCTGATGAGTATCTTAAAGAGATAAGAGCTTGTCCATGACTTTGTGCAGTAAAATGCCTTGCACGCCTGTATAGGGGTTCAAACACCCTCGTTTTCATTATTATCCATCCATCAATTCATTTCTTTTGTCTTCATTTTTTCTAGTGTTGTAGGTTGTAGTTTAAAAGTAAGTCGGAGTGGCTCTGGGACTCAATATG

CDS

>Mapoly0043s0095.1
ATGGAGGCTCGAAGTCGACGAGTTGGGGGTGGATTTCCAGGTTACAATGGCCCTGCCCTGCCTCGTGCTATGCGCTCCTCCAGGGGACGTGGAGAAGCGGCTAGAAAGGCAACTGTGTGCGGAGGGAGAGCTGGATTTTTTGAGCTACTTGCCACTGTAGCAGGGCAAATTTTACAGGATGATAGCAATGGGGAGGAGCAAGATTTGTCAAATATATCTGGCGTGAAGCTAAAGTGTTCAGAACTGAAGGAAAAGGATTCAGAGTCGTATGCCAGGATCTCTCTTGCGAAGAAAACGCTATGTGAGCCATCCTCAATTGCAGCTTCATGCTTGAACTCATTGCGAGCAGGCATTAGAGATGAGGAAGCGAGGAAGCACTTCGGTTTAGAAAAAGAAGAGGATGAATCCGCCGAATCAGCTCACATGGTAGTCAACAGATCGTACGTTTCTTGCTCATCTCCAGAAACACGAAATCAGACCCTGCTTGGGTCCGACAAGGTAGTCACTGCAAGGAGTGATTGCGTAACAGTAAGTACTCCAGAGCAAAAGGTTCCTGAAGGTAACAAACAGATGGCCGTATCTGTTTCTGATAATGACGAAAACCAGACAATCAAATCTGATCCCGAGTCTAGTCTCTCCTCGGCGATTAAAGATGCTTCAGATTCTGATGAAATGCATCTAGAAACTAGAGAACCTGTTGAACGGCTGCAAATTCCCAAGATTGAAGACCTGGAAGATGGGGACCACTTGGATGACCGGAAGGAGCGTAAGTTTAGCATTCGAGGTAATGAACAGCTTATTGACATGGAAATTGATCTGCCTAAGGCTTCTGTGATGGAAGGAAGCATGCATTACGAAGGTCATGATCCTGTGTCGAGTACTGCATCGGAGGCGACTAAACCGGAACCCTCTTCTGGTGAAGTCACGCATCTACATAGTTGCTTGGCTTCCAGAGAGGAAGACGCATTGCTTAGAGACGTGGTTAGGAGTTCGAAACGTATCATTGACGACACCGCGAGGAGTCCGGGTGACAAGAAACCATGGAAACGCACAGATCCTTGTGGTAAAGAGGATGAGGGCGAATCAGGTGTCGAAGTCGATGATAAGAGCATTTTTGAAACCAGAAAACCATTGAAAGTCACGGATGTGATTCTAGGTAGATTAGTTGCTGAAAAAGTTGGAGTAGAACGTGGATTTGTAAGTGAGCAGATTTTGGAAAGTAGCAGGGAGAGAATTCTCTCCAAAGACAACAATAACTGTTCTTCGAAGCGGAATCTGCCTGAGAATGTCTCACAGAAGCTGAAGGACTCTTACGCCAAGGGTATGAGAGCAAGAAAAGTTGTAAAGATGGTTAAGCGCAGCCGTGTTTCAAATTCCCGGAGCAAGAGAAAGCACGCCGAGATGGAAGCTGCAGCAGATTCAGACGAGGCGCAAGGGAAGAAGGCGTACTATAGAGGTCTGTCGTACACTCGACAACGGACATCCAGAGGACTGCCAGCTAAACGAAAGCGGATGGCTGATGGTGCACCGTCAAGCTCTCCAGAGTTGCATGTGAACACCAGTGATCTAATGGAGCTTGGTTTTGATTGCGCGGAAGGGGAGCCACCTGCAGCGGCAGCTAAATTAAGAAGTGATAAACACAATGGAAAAGGCGAGCACGTAGGAGGAATTGATCAGGCGCGGAATGCTTTTGTGGAATCTGCATGTACAGCTAAAGCTGCGAGTGTTGCAACTTCTCCAACAGCCAAGGGTTCGGCGAAGTTATCGAAGAAGTCAAATGAACCTCATGTCAAGCTCACCATCAAATCTTTCACAGTTCCAGAATTATCTGTCGATCTACCCGAATCAGCAACAGTATCCAGCCTCAAGCGAGCTGTGATGGATGCGGCGATGAATCTTCTAGGTGGGGGTTTGAGGGTTCGAGTGCTTCTCCAAGGCAAAAAGGTTCCCGATGAAGGCGCAACTTTGGCTCAAGTTGGTATTTCTCGTAGTGTCAAGCCAGATTCATTGGGTTTCATGCTGGAGCCGAGTCCTTTGCCTACGTCACCCACATCAACGTCCGAAGATCCTCTCCTCGTTCTGTCTCGCGCTGCTGGTCAGCCATCTCCACGATTCAACGGATTTGGATCTCCAGGCATGCCTAGTGCTGCTGAGCTGGGAAGTCGGTGTCCACAAAAGACACGATCAAATAAGGGTACCGGAGGACCAGTTGATGGAGAGGCATACACTGCACCAGTGTCAGGAGATCACAATGAAGCTAAGAGATCAGGGATGACATTCCAAGGTCCACAAGAGGATGCCCTTAAAGGATGCCCTGTCAGCAAGCCCAAGTCAGGCTTAAATGAACGAATGTCATTATCACCCCACTCAACGAGGGTTGCAGCTGCCGGAGCTTTGGCAGCTATAAGAGCACAGGCTGATGCAAGTCGTCGGTCTGCAAAGAACGAATCTGATTCAGCAACTCCTGCTTCTCATACGCTTGCTCATGAAACAATGGTTCCCGGTTCGGGAGCTATTATTCTACACCCTGGCATGAATGTGGGTGAGAATATGCAGGGCTTAGCACTTGTTCCTGTACGACAGAAGTCGCATTCTATGGACGTAGGTAAACGCCGTGTTCGTAGACCTTTTAGTGTGAGTGAGGTGGAGGCTCTGGTACACGCCGTGGAGAAGCTTGGAACTGGCAGATGGCGCGATGTTAAATTGCGAGCATTTGATCAGGCCAAGCACCGTACATATGTCGATCTGAAGGACAAATGGAAGACACTCGTCCACACAGCACGTATAGCACCCCACCAGCGACGAGGGGAGCCCGTCCCACAGGAACTTTTGGAACGTGTCACCCACGCCCACACTTACTGGACGGCACAGGCAGCTAAGCAGCAAGCAGAACTTGACTATTGA

Protein

>Mapoly0043s0095.1
MEARSRRVGGGFPGYNGPALPRAMRSSRGRGEAARKATVCGGRAGFFELLATVAGQILQDDSNGEEQDLSNISGVKLKCSELKEKDSESYARISLAKKTLCEPSSIAASCLNSLRAGIRDEEARKHFGLEKEEDESAESAHMVVNRSYVSCSSPETRNQTLLGSDKVVTARSDCVTVSTPEQKVPEGNKQMAVSVSDNDENQTIKSDPESSLSSAIKDASDSDEMHLETREPVERLQIPKIEDLEDGDHLDDRKERKFSIRGNEQLIDMEIDLPKASVMEGSMHYEGHDPVSSTASEATKPEPSSGEVTHLHSCLASREEDALLRDVVRSSKRIIDDTARSPGDKKPWKRTDPCGKEDEGESGVEVDDKSIFETRKPLKVTDVILGRLVAEKVGVERGFVSEQILESSRERILSKDNNNCSSKRNLPENVSQKLKDSYAKGMRARKVVKMVKRSRVSNSRSKRKHAEMEAAADSDEAQGKKAYYRGLSYTRQRTSRGLPAKRKRMADGAPSSSPELHVNTSDLMELGFDCAEGEPPAAAAKLRSDKHNGKGEHVGGIDQARNAFVESACTAKAASVATSPTAKGSAKLSKKSNEPHVKLTIKSFTVPELSVDLPESATVSSLKRAVMDAAMNLLGGGLRVRVLLQGKKVPDEGATLAQVGISRSVKPDSLGFMLEPSPLPTSPTSTSEDPLLVLSRAAGQPSPRFNGFGSPGMPSAAELGSRCPQKTRSNKGTGGPVDGEAYTAPVSGDHNEAKRSGMTFQGPQEDALKGCPVSKPKSGLNERMSLSPHSTRVAAAGALAAIRAQADASRRSAKNESDSATPASHTLAHETMVPGSGAIILHPGMNVGENMQGLALVPVRQKSHSMDVGKRRVRRPFSVSEVEALVHAVEKLGTGRWRDVKLRAFDQAKHRTYVDLKDKWKTLVHTARIAPHQRRGEPVPQELLERVTHAHTYWTAQAAKQQAELDY

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>