Mapoly0043s0098



Description

B3 DNA binding domain // Auxin response factor

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0005634 Nucleus
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0009725 Response to hormone stimulus
OrthoMCL OG5_150287
PFAM PF02362 B3 DNA binding domain
PFAM PF06507 Auxin response factor
PANTHER PTHR31384 FAMILY NOT NAMED
PANTHER PTHR31384:SF6

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpB3-4 transcription factor, B3 Mapoly0043s0098.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0043s0098.1 scaffold_43:1001741..1006348  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0043s0098.1  

Gene structure:

mRNA scaffold_43:1001741..1006348  ( - strand )
three_prime_UTR scaffold_43:1001741..1002587  ( - strand )
CDS scaffold_43:1002588..1002619  ( - strand )
CDS scaffold_43:1002973..1003831  ( - strand )
CDS scaffold_43:1004077..1005405  ( - strand )
five_prime_UTR scaffold_43:1005406..1006348  ( - strand )

Sequences:

Gene

>Mapoly0043s0098.1
CTTCCTGTCCTGGCAGGGCCAAAGTTCTCGGCTCGTGGCAGAGGCGCTGCTGTCGAGCGAGCGAGCGCGAGGGCGAGGGAATCCGAACCCGTTCCCGCAGAGCATTTACCTACCGACCGACGCCCGCAGCATAGATAGATAGACTGCTGGATAGATAGGAAGGACGACGAGGCGCAGAAGGACGAGCTGCAGCAGCAGCAGCAGCAGCGGGAGGAGCGATCGAGCGGACGAGCAAACGACGGAACGAGCGCTGGACGAAACAAGGCTCGCACTTGTTCTCTCTCCACTTCTGTCTGCCCTGCGGCTTTGACTTTGGAGACGAAGCAGAGCAGAGGAGCAGGAAAGCGGCAGCAGGGAGTTTGTGGCTGGAAGGACTGCATGGCGTGCATTAGCGCGGCTTTGCGAGCGATGGCTCGAGCGACGACGGTCGAGTGAGTAGGGGGAGCGCGAGCGATGAGGGTGGTGTGTGTCGGCGACGAAGAAGCTCGCGAGGAGTGAGTGAGTAGAGCGGTAGAAGTGCAGCCAGAAGCAGGAGGACGAGCGAGCGAGCGAGAGAAAGAAAGAGAGAGTGAGAGAGCAAATTGCTTCGTGCGAGCCGGACTTAGGTCGTGGCAGAGCATGGATCCGTCGCCGGGGCGACTAATTTGAGAGGGATCTGGTGTTGCGTCTGGAGTTGGAGCCTCGTTTGGTCCTGGGCGTGTGTTTCAGGAGGGGGTGAGGTGAGACTGAGGCTCGAGGACTGACAGGCGGTCGACGACGAGAGTGCAAGGGAAGCAGCAGAACGAGCGAGGAAGAGGAGGAAGAGGAAGCTCGGCTTGGCTTGGCTCGTCGGTCGGGGCAATCAATCGGTCGAGGCTGCGAGGGCGGAGGGTCGCCGGGGTCATATCCATTCGTCAAAATTGCTAAAATTGCGCCACCGCTCTCCGGCTCCTTTCTGTTTGGGATGCCCGGGCCAAGCCCTGGGTGTGGGACAATGAGCGGAACGAATATCAAGATGGAGAAATCGGAGGAGTCGATGGGAGGAGGAGGCAAGGGCTGGGGCGGGGGCAGAGATCGAGATTCATCGTCGGACGGAGGAGGGGGCTCGGGCGAGAACACGGGCCTGGATCCGCAGCTGTGGCACGCCTGCGCAGGAGGCATGGTGCAGCTGCCGCCCGTGGGCGCCAAGGTCATCTACTTCCCGCAGGGCCATGGAGAGCAGGCGGCCACGCCGCCCGAATTCCCAAGAATGATGGGCCCGCAGGGAACAATTGGGTGCCGAGTGGTGTCGGTGAGCTTCTTGGCCGACACGGAGACGGACGAGGTGTATGCGCGCATCCGCCTGCAGCCGCTGGAGCGCGAGGCCGCCATGTCCATCGCCGACTCGACGCTCGACGCGGACGGGGGCCCGTCGTCGCCCCCGCCCGAGAAGCCGGCCTCGTTCGCCAAGACGCTCACGCAGAGCGACGCCAACAACGGAGGCGGATTCTCGGTGCCGCGCTATTGCGCCGAGACCATCTTCCCGCCGCTCGATTACTCCATCGATCCGCCCGTGCAGACGGTGCTGGCCAAGGACGTGCACGGCGAGCGATGGAAGTTCCGCCACATCTACCGCGGCACTCCGCGCCGGCACCTGCTCACCACCGGCTGGAGCACCTTCGTGAATCAGAAGAAGCTCGTGGCCGGCGACGCCATTGTGTTTCTGCGCACCGCCAGCGGCGAGCTCTGCGTCGGCGTGCGCAGGTCGATGCGTGGCACGGGCGGCGCCGATTCCTCGACCTGGTCCGGCGGATCGTCGACCTCGCACCATCGCCCCAATCGCTGGGAGGTCAAGGGCACCGAGAGCTTCTCGGACTTCCTCGGCAACGACAGCGCTGCCGGAGGCGGCTCGGTCTCGAGCGCAGGCTCCGCTGCAGGCCCCGGAGGCCCTCGCGCTGGCCCCGGCGGCAGCAACTCGGGCCCCGGGATTGGCATCCCCGGCCCTTCCACCACCAGCAGCTTCGCGCGCAATCGAGCTCGCGTCACCGCGCAGTCGGTGCTCGAGGCCGCGTCGCTGGCCGTGCAGGGCCAGCCCTTCGAGGTCGTCTACTACCCTCGCGCCAGCACGGCCGAGTTCTGCGTCAAAGCGCAGGCCGTCAAGGCGGCCCTCGATCACACCTGGTTCCCGGGCATGCGCTTCAAGATGGCCTTCGAGACGGAGGATTCGTCGCGGATCAGCTGGTTCATGGGCACCATCTCCGCGGTGCAGCCCGCCGACTCGCTCTGGCCCAAGTCTCCGTGGCGCGTGCTTCAGGTGCCCGTCTGCTTCTTCTTCTTCCCCCACCCTGCAATCGTTTTGACAGGCCTGCCGCACGCCTCGAAAGATTGGAGTCGAGCCCGTCGGCGCTGCGTTGCTTTCGATCGGCCGATGACGAAATGGAATCAGGGGGTTGTGTGGGGGCAAATTGCGCCGATGGTGTGCTGGCTTGACAGTGACCGAGGGCTGGATCTCTGGTGGTCTGATTTCGTGGTGATGTTGGCTGTGGTTGATTGGTGCAGGTGACATGGGACGAGCCGGATTTGTTACAGGGAGTGAGCCGCGTGAGTCCCTGGCAGGTGGAGTTGGTGTCGACTCTGCCGATGCAATTGCCTCCGTTCTCGCTGCCGAAGAAGAAGTTGAGGGCGGCTCAGCCCTCGGACATGAATATGCAAGGCCAAGGGCTGATGGGCATGCCCATCACACTACCTTCGGTTTTTGGGCAAATCAACCCCTGGGCGCACGGACTTACCATGGAGGAAGTTACTGCGGGCATGCAGGGAGCCAGGCATGATCGAGTTTTTGGGCTTGCCTTGTCGGAGAAATTCCGGCCTGGTAAACTCCCAGGTGGGTTTTTTTCAGCAGCAGAGGGTTATTATCCGGATCATGCTGGACGAGGTGGCGGTGGGGAGCCTCACCTTAGTGCATTCCCGCTCCAGGATCGTGCGAGCAACATTTCTTCCCTGATCAGCTCGCTGGGCAGCGTTCCGCCCAGTGGTGACCACGGATCGGCCGGCGCCTTGCTGGTCCCGGCCGGGTCCTGGTCCGGGGGCTCTGCGAACAACAAGAGTGCTTCCACTCAGCTGGTGCTGTTCGGCCAAGCAATCAACACCGACTCCAACAAGAGCCAGCCCCAACACTCAGGCGGGAGCTCGTGCGACGGCCCCTCGCTCCAACACTTGAAAGAGGAATCGTCCGGCAAGCGCAAGGATTCGCCTTCCGAATCCAACCAGAATGAGAATTTCGAGAGGGGCCAGAAGTACATGTCTGGCAGTCTGAGCAACGGCAAACAGTCGGATCTCATAGTGGGCGAGTTTCAGAAGTGGGTGCCCGGGTTGGACAAGGAGAGAGGTGCCGGAGAGAAGCTCGCCGCATCCCCTGGTGAGTCCTTCTCGCACTGCAAAGTTTTTAAAGAAAACGATGAGGTTGGACGGACAGTCGACCTTTCCCAATTTTCGTCATATGAGGAACTGTATGACAGGCTTGGGGCGATGTTCGGTCTTGAACAGAAGGTTCCACTGAACGCGATGTTCTATAGAGATGGAGAAAATTACACACGAAACGTGGGATGTGAGCCTTACAGGTAGTTCCTCTTGTGCCAACCTCGTGGTGTGATCTGAAACGTTTGCTCTTTGCTGGACGTCCTTTTATTGCTCCACGACGATCAACCACTTCCTTGCTTCCGAGCTCGTAGCGCGCGTTCTGATGCTACCATGCTTCTGGTGTGATCGCAGAAATTTTGCAAAGTCCGCAAGGCGCCTGGTGATCCGTGTCGACCCCTCTAGCAACGGCAAAACGCGGTCGCAGTAGCAGGCTAGGCACCATTGACAGTATGCTTGACAGTCGACCGTGCCTTGGAAATTGTCAGATGTATTTTGTAGGTAGACCTCCTTAACATACCTATCTCGAGGAGCACTGGCTTAGGAAGCAGTTGGTGTCACACAGCAGAAACAGAAGCACTCGTGCTGTAGAACCAACCGAAAACCTTCGGACAGGACTCAGGCGGTCTTCTCTCTCGTGGAGCACTTTCTGCTTCGGGAAGAAGATGGTTATCTATTGAAATTCTAAGAAGCTGACCTAGCAGCAGCGATGCCACCTCCCGCTTTAATGTACATAGTTGTGGGAAGAGGCTATTGCGTTGGCGGACGAACTTTGTAGTTGGAGCAGTTATTTCAAGGAGTCTTCATCTGCAACTGGCTGTAGGCTTTGGGTCTTATTTTTTGTTTTAGAAACATGACGCACCTTGTGGCAGGTACTCTTGAGAAACTCTTAGCTGCAAAATGTATGTTATTTCCTCCCCAAGTGTAAGTACAGGGCGATTATCGTTTCCAACTAAGAAGATGAACCTTTCTGCCAAATTGCGTATACGGCTGAGACCCTGTTGTGACTCGAAGACGTGAAAGCCAAATCTGGTCTCTATCACAGCCTTTTGTACCTTACAGAGGACTGGACAAAATTAAATTATTTCGGGATCATACTTCAGGGGGGCCTAGTTCGGGAACCGTAGCATACCCTCTTCACGGCAATTTTTTTCTGCATATATGAGACATTGAAGGACGGCTACCCTGGCTTTTTGAGTTGTAAAGCTGTAAAATTCCCAATCAAGAAAGTCG

mRNA

>Mapoly0043s0098.1
CTTCCTGTCCTGGCAGGGCCAAAGTTCTCGGCTCGTGGCAGAGGCGCTGCTGTCGAGCGAGCGAGCGCGAGGGCGAGGGAATCCGAACCCGTTCCCGCAGAGCATTTACCTACCGACCGACGCCCGCAGCATAGATAGATAGACTGCTGGATAGATAGGAAGGACGACGAGGCGCAGAAGGACGAGCTGCAGCAGCAGCAGCAGCAGCGGGAGGAGCGATCGAGCGGACGAGCAAACGACGGAACGAGCGCTGGACGAAACAAGGCTCGCACTTGTTCTCTCTCCACTTCTGTCTGCCCTGCGGCTTTGACTTTGGAGACGAAGCAGAGCAGAGGAGCAGGAAAGCGGCAGCAGGGAGTTTGTGGCTGGAAGGACTGCATGGCGTGCATTAGCGCGGCTTTGCGAGCGATGGCTCGAGCGACGACGGTCGAGTGAGTAGGGGGAGCGCGAGCGATGAGGGTGGTGTGTGTCGGCGACGAAGAAGCTCGCGAGGAGTGAGTGAGTAGAGCGGTAGAAGTGCAGCCAGAAGCAGGAGGACGAGCGAGCGAGCGAGAGAAAGAAAGAGAGAGTGAGAGAGCAAATTGCTTCGTGCGAGCCGGACTTAGGTCGTGGCAGAGCATGGATCCGTCGCCGGGGCGACTAATTTGAGAGGGATCTGGTGTTGCGTCTGGAGTTGGAGCCTCGTTTGGTCCTGGGCGTGTGTTTCAGGAGGGGGTGAGGTGAGACTGAGGCTCGAGGACTGACAGGCGGTCGACGACGAGAGTGCAAGGGAAGCAGCAGAACGAGCGAGGAAGAGGAGGAAGAGGAAGCTCGGCTTGGCTTGGCTCGTCGGTCGGGGCAATCAATCGGTCGAGGCTGCGAGGGCGGAGGGTCGCCGGGGTCATATCCATTCGTCAAAATTGCTAAAATTGCGCCACCGCTCTCCGGCTCCTTTCTGTTTGGGATGCCCGGGCCAAGCCCTGGGTGTGGGACAATGAGCGGAACGAATATCAAGATGGAGAAATCGGAGGAGTCGATGGGAGGAGGAGGCAAGGGCTGGGGCGGGGGCAGAGATCGAGATTCATCGTCGGACGGAGGAGGGGGCTCGGGCGAGAACACGGGCCTGGATCCGCAGCTGTGGCACGCCTGCGCAGGAGGCATGGTGCAGCTGCCGCCCGTGGGCGCCAAGGTCATCTACTTCCCGCAGGGCCATGGAGAGCAGGCGGCCACGCCGCCCGAATTCCCAAGAATGATGGGCCCGCAGGGAACAATTGGGTGCCGAGTGGTGTCGGTGAGCTTCTTGGCCGACACGGAGACGGACGAGGTGTATGCGCGCATCCGCCTGCAGCCGCTGGAGCGCGAGGCCGCCATGTCCATCGCCGACTCGACGCTCGACGCGGACGGGGGCCCGTCGTCGCCCCCGCCCGAGAAGCCGGCCTCGTTCGCCAAGACGCTCACGCAGAGCGACGCCAACAACGGAGGCGGATTCTCGGTGCCGCGCTATTGCGCCGAGACCATCTTCCCGCCGCTCGATTACTCCATCGATCCGCCCGTGCAGACGGTGCTGGCCAAGGACGTGCACGGCGAGCGATGGAAGTTCCGCCACATCTACCGCGGCACTCCGCGCCGGCACCTGCTCACCACCGGCTGGAGCACCTTCGTGAATCAGAAGAAGCTCGTGGCCGGCGACGCCATTGTGTTTCTGCGCACCGCCAGCGGCGAGCTCTGCGTCGGCGTGCGCAGGTCGATGCGTGGCACGGGCGGCGCCGATTCCTCGACCTGGTCCGGCGGATCGTCGACCTCGCACCATCGCCCCAATCGCTGGGAGGTCAAGGGCACCGAGAGCTTCTCGGACTTCCTCGGCAACGACAGCGCTGCCGGAGGCGGCTCGGTCTCGAGCGCAGGCTCCGCTGCAGGCCCCGGAGGCCCTCGCGCTGGCCCCGGCGGCAGCAACTCGGGCCCCGGGATTGGCATCCCCGGCCCTTCCACCACCAGCAGCTTCGCGCGCAATCGAGCTCGCGTCACCGCGCAGTCGGTGCTCGAGGCCGCGTCGCTGGCCGTGCAGGGCCAGCCCTTCGAGGTCGTCTACTACCCTCGCGCCAGCACGGCCGAGTTCTGCGTCAAAGCGCAGGCCGTCAAGGCGGCCCTCGATCACACCTGGTTCCCGGGCATGCGCTTCAAGATGGCCTTCGAGACGGAGGATTCGTCGCGGATCAGCTGGTTCATGGGCACCATCTCCGCGGTGCAGCCCGCCGACTCGCTCTGGCCCAAGTCTCCGTGGCGCGTGCTTCAGGTGACATGGGACGAGCCGGATTTGTTACAGGGAGTGAGCCGCGTGAGTCCCTGGCAGGTGGAGTTGGTGTCGACTCTGCCGATGCAATTGCCTCCGTTCTCGCTGCCGAAGAAGAAGTTGAGGGCGGCTCAGCCCTCGGACATGAATATGCAAGGCCAAGGGCTGATGGGCATGCCCATCACACTACCTTCGGTTTTTGGGCAAATCAACCCCTGGGCGCACGGACTTACCATGGAGGAAGTTACTGCGGGCATGCAGGGAGCCAGGCATGATCGAGTTTTTGGGCTTGCCTTGTCGGAGAAATTCCGGCCTGGTAAACTCCCAGGTGGGTTTTTTTCAGCAGCAGAGGGTTATTATCCGGATCATGCTGGACGAGGTGGCGGTGGGGAGCCTCACCTTAGTGCATTCCCGCTCCAGGATCGTGCGAGCAACATTTCTTCCCTGATCAGCTCGCTGGGCAGCGTTCCGCCCAGTGGTGACCACGGATCGGCCGGCGCCTTGCTGGTCCCGGCCGGGTCCTGGTCCGGGGGCTCTGCGAACAACAAGAGTGCTTCCACTCAGCTGGTGCTGTTCGGCCAAGCAATCAACACCGACTCCAACAAGAGCCAGCCCCAACACTCAGGCGGGAGCTCGTGCGACGGCCCCTCGCTCCAACACTTGAAAGAGGAATCGTCCGGCAAGCGCAAGGATTCGCCTTCCGAATCCAACCAGAATGAGAATTTCGAGAGGGGCCAGAAGTACATGTCTGGCAGTCTGAGCAACGGCAAACAGTCGGATCTCATAGTGGGCGAGTTTCAGAAGTGGGTGCCCGGGTTGGACAAGGAGAGAGGTGCCGGAGAGAAGCTCGCCGCATCCCCTGAAATTTTGCAAAGTCCGCAAGGCGCCTGGTGATCCGTGTCGACCCCTCTAGCAACGGCAAAACGCGGTCGCAGTAGCAGGCTAGGCACCATTGACAGTATGCTTGACAGTCGACCGTGCCTTGGAAATTGTCAGATGTATTTTGTAGGTAGACCTCCTTAACATACCTATCTCGAGGAGCACTGGCTTAGGAAGCAGTTGGTGTCACACAGCAGAAACAGAAGCACTCGTGCTGTAGAACCAACCGAAAACCTTCGGACAGGACTCAGGCGGTCTTCTCTCTCGTGGAGCACTTTCTGCTTCGGGAAGAAGATGGTTATCTATTGAAATTCTAAGAAGCTGACCTAGCAGCAGCGATGCCACCTCCCGCTTTAATGTACATAGTTGTGGGAAGAGGCTATTGCGTTGGCGGACGAACTTTGTAGTTGGAGCAGTTATTTCAAGGAGTCTTCATCTGCAACTGGCTGTAGGCTTTGGGTCTTATTTTTTGTTTTAGAAACATGACGCACCTTGTGGCAGGTACTCTTGAGAAACTCTTAGCTGCAAAATGTATGTTATTTCCTCCCCAAGTGTAAGTACAGGGCGATTATCGTTTCCAACTAAGAAGATGAACCTTTCTGCCAAATTGCGTATACGGCTGAGACCCTGTTGTGACTCGAAGACGTGAAAGCCAAATCTGGTCTCTATCACAGCCTTTTGTACCTTACAGAGGACTGGACAAAATTAAATTATTTCGGGATCATACTTCAGGGGGGCCTAGTTCGGGAACCGTAGCATACCCTCTTCACGGCAATTTTTTTCTGCATATATGAGACATTGAAGGACGGCTACCCTGGCTTTTTGAGTTGTAAAGCTGTAAAATTCCCAATCAAGAAAGTCG

CDS

>Mapoly0043s0098.1
ATGCCCGGGCCAAGCCCTGGGTGTGGGACAATGAGCGGAACGAATATCAAGATGGAGAAATCGGAGGAGTCGATGGGAGGAGGAGGCAAGGGCTGGGGCGGGGGCAGAGATCGAGATTCATCGTCGGACGGAGGAGGGGGCTCGGGCGAGAACACGGGCCTGGATCCGCAGCTGTGGCACGCCTGCGCAGGAGGCATGGTGCAGCTGCCGCCCGTGGGCGCCAAGGTCATCTACTTCCCGCAGGGCCATGGAGAGCAGGCGGCCACGCCGCCCGAATTCCCAAGAATGATGGGCCCGCAGGGAACAATTGGGTGCCGAGTGGTGTCGGTGAGCTTCTTGGCCGACACGGAGACGGACGAGGTGTATGCGCGCATCCGCCTGCAGCCGCTGGAGCGCGAGGCCGCCATGTCCATCGCCGACTCGACGCTCGACGCGGACGGGGGCCCGTCGTCGCCCCCGCCCGAGAAGCCGGCCTCGTTCGCCAAGACGCTCACGCAGAGCGACGCCAACAACGGAGGCGGATTCTCGGTGCCGCGCTATTGCGCCGAGACCATCTTCCCGCCGCTCGATTACTCCATCGATCCGCCCGTGCAGACGGTGCTGGCCAAGGACGTGCACGGCGAGCGATGGAAGTTCCGCCACATCTACCGCGGCACTCCGCGCCGGCACCTGCTCACCACCGGCTGGAGCACCTTCGTGAATCAGAAGAAGCTCGTGGCCGGCGACGCCATTGTGTTTCTGCGCACCGCCAGCGGCGAGCTCTGCGTCGGCGTGCGCAGGTCGATGCGTGGCACGGGCGGCGCCGATTCCTCGACCTGGTCCGGCGGATCGTCGACCTCGCACCATCGCCCCAATCGCTGGGAGGTCAAGGGCACCGAGAGCTTCTCGGACTTCCTCGGCAACGACAGCGCTGCCGGAGGCGGCTCGGTCTCGAGCGCAGGCTCCGCTGCAGGCCCCGGAGGCCCTCGCGCTGGCCCCGGCGGCAGCAACTCGGGCCCCGGGATTGGCATCCCCGGCCCTTCCACCACCAGCAGCTTCGCGCGCAATCGAGCTCGCGTCACCGCGCAGTCGGTGCTCGAGGCCGCGTCGCTGGCCGTGCAGGGCCAGCCCTTCGAGGTCGTCTACTACCCTCGCGCCAGCACGGCCGAGTTCTGCGTCAAAGCGCAGGCCGTCAAGGCGGCCCTCGATCACACCTGGTTCCCGGGCATGCGCTTCAAGATGGCCTTCGAGACGGAGGATTCGTCGCGGATCAGCTGGTTCATGGGCACCATCTCCGCGGTGCAGCCCGCCGACTCGCTCTGGCCCAAGTCTCCGTGGCGCGTGCTTCAGGTGACATGGGACGAGCCGGATTTGTTACAGGGAGTGAGCCGCGTGAGTCCCTGGCAGGTGGAGTTGGTGTCGACTCTGCCGATGCAATTGCCTCCGTTCTCGCTGCCGAAGAAGAAGTTGAGGGCGGCTCAGCCCTCGGACATGAATATGCAAGGCCAAGGGCTGATGGGCATGCCCATCACACTACCTTCGGTTTTTGGGCAAATCAACCCCTGGGCGCACGGACTTACCATGGAGGAAGTTACTGCGGGCATGCAGGGAGCCAGGCATGATCGAGTTTTTGGGCTTGCCTTGTCGGAGAAATTCCGGCCTGGTAAACTCCCAGGTGGGTTTTTTTCAGCAGCAGAGGGTTATTATCCGGATCATGCTGGACGAGGTGGCGGTGGGGAGCCTCACCTTAGTGCATTCCCGCTCCAGGATCGTGCGAGCAACATTTCTTCCCTGATCAGCTCGCTGGGCAGCGTTCCGCCCAGTGGTGACCACGGATCGGCCGGCGCCTTGCTGGTCCCGGCCGGGTCCTGGTCCGGGGGCTCTGCGAACAACAAGAGTGCTTCCACTCAGCTGGTGCTGTTCGGCCAAGCAATCAACACCGACTCCAACAAGAGCCAGCCCCAACACTCAGGCGGGAGCTCGTGCGACGGCCCCTCGCTCCAACACTTGAAAGAGGAATCGTCCGGCAAGCGCAAGGATTCGCCTTCCGAATCCAACCAGAATGAGAATTTCGAGAGGGGCCAGAAGTACATGTCTGGCAGTCTGAGCAACGGCAAACAGTCGGATCTCATAGTGGGCGAGTTTCAGAAGTGGGTGCCCGGGTTGGACAAGGAGAGAGGTGCCGGAGAGAAGCTCGCCGCATCCCCTGAAATTTTGCAAAGTCCGCAAGGCGCCTGGTGA

Protein

>Mapoly0043s0098.1
MPGPSPGCGTMSGTNIKMEKSEESMGGGGKGWGGGRDRDSSSDGGGGSGENTGLDPQLWHACAGGMVQLPPVGAKVIYFPQGHGEQAATPPEFPRMMGPQGTIGCRVVSVSFLADTETDEVYARIRLQPLEREAAMSIADSTLDADGGPSSPPPEKPASFAKTLTQSDANNGGGFSVPRYCAETIFPPLDYSIDPPVQTVLAKDVHGERWKFRHIYRGTPRRHLLTTGWSTFVNQKKLVAGDAIVFLRTASGELCVGVRRSMRGTGGADSSTWSGGSSTSHHRPNRWEVKGTESFSDFLGNDSAAGGGSVSSAGSAAGPGGPRAGPGGSNSGPGIGIPGPSTTSSFARNRARVTAQSVLEAASLAVQGQPFEVVYYPRASTAEFCVKAQAVKAALDHTWFPGMRFKMAFETEDSSRISWFMGTISAVQPADSLWPKSPWRVLQVTWDEPDLLQGVSRVSPWQVELVSTLPMQLPPFSLPKKKLRAAQPSDMNMQGQGLMGMPITLPSVFGQINPWAHGLTMEEVTAGMQGARHDRVFGLALSEKFRPGKLPGGFFSAAEGYYPDHAGRGGGGEPHLSAFPLQDRASNISSLISSLGSVPPSGDHGSAGALLVPAGSWSGGSANNKSASTQLVLFGQAINTDSNKSQPQHSGGSSCDGPSLQHLKEESSGKRKDSPSESNQNENFERGQKYMSGSLSNGKQSDLIVGEFQKWVPGLDKERGAGEKLAASPEILQSPQGAW

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>