Mapoly0043s0128



Description

SWI/SNF-RELATED CHROMATIN BINDING PROTEIN

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0005622 Intracellular
KOG KOG0381 HMG box-containing protein
OrthoMCL OG5_163904
PFAM PF00505 HMG (high mobility group) box
PFAM PF01388 ARID/BRIGHT DNA binding domain
PANTHER PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEIN
PANTHER PTHR13711:SF145

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpARID-HMGBOX transcription factor, ARID-HMGbox Mapoly0043s0128.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0043s0128.1 scaffold_43:1235158..1240409  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0043s0128.2 scaffold_43:1233261..1240577  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0043s0128.3 scaffold_43:1233261..1240561  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0043s0128.4 scaffold_43:1235158..1240577  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0043s0128.1  

Gene structure:

mRNA scaffold_43:1235158..1240409  ( - strand )
three_prime_UTR scaffold_43:1235158..1236139  ( - strand )
CDS scaffold_43:1236140..1236469  ( - strand )
CDS scaffold_43:1237404..1237816  ( - strand )
CDS scaffold_43:1237990..1238115  ( - strand )
CDS scaffold_43:1238551..1238713  ( - strand )
CDS scaffold_43:1238906..1238984  ( - strand )
CDS scaffold_43:1239078..1239379  ( - strand )
five_prime_UTR scaffold_43:1239380..1240409  ( - strand )

Sequences:

Gene

>Mapoly0043s0128.1
TTTTCTTCAGGCTTACCTGTAGGCAGGAGAAATTTGGTGTTTTCGGTGTTTGGGCAGAGTTGCGTCTCCGAGATTTTTCATCTCAGGAAAATTATGATTGACGATAGGAAATGTGATACGCGCACGTCTTTATCAGTGGGATCCGAAGCTTTGTGCGTCGAGGTTGGGAGATTTATCTGTACTCCTGTGATGAATGAATCATGTCGTCGTCTAGGAGATTGAAATCCGCTCGGAATTTCGCTTTATACAGAACCTGTCATGGTGCCTCTAGTTTCCTGCGAGCGTGGGAGGTCCGAGCTCGTGCTTGTTGTCTGTGAAGAGATAGCTTTGCTGATCGTACAGGAGTGACCTGTGCTATGTCCTCTTGGTTAGACACACTTCTGTACCAGAAAACACCCTGGAGGGTTTTTTTTTGGGTTGGTTTTTTAGCATCTCAATTGCGCAGTCATGCTCTATCTCTAAGAGCTGGAATGATGCGAAAGTCAGAAGTGACTTTCGACTTACGTATGCTTACATGGCTTTCGACTTACGTGAAGGCATGGGAAAAGCATCTGAATTATCCACGTTATATTTTTATGTATTTTACTTCGCTTCTGCATATGACCTTCTCACACAAGGAATGTGTGATAGGAGGCCCTTCATGAATTTTGCGAAGTCAGTTCAATAACCTCGAGCTTTCTTTCGCGCGGAAAGCCCGTCCTTCTGTATTTTATCAGGCGATGTTGAAGGTTAGGGATGTTGGGTGTCTGCAGGTGTGTTGATACTTTTTGCATTCTGCACATTGTAAGGTCAGGAAAGGCCGCTTGTCGAGTAAGCTGAGGGATTTCAGGCTAAAAGTGCAATACTTCAAACGATATTTGCGATCCAATCAGACTCACAGAGCTTGAAGACTTGTGGTGCCCAAGGGGCGTCACAATTTATGGAGAAGTGATGGAAAATTATTGGCTCATTTCTGAGTCTATGCGGATTATTGGAGTGTGCAGGTTCTCTTATGCTTGATACCAATTGCTGAAGAGGTTGCGATTTCAAAATGGCGACCGAAGCGGCTGTAGCAAATGTGCCACCTTCGGTACAAACACCAGCTAAAAATGCTGACACTGTAATGGTGGACGCGAAGGAGAGCCCTGTGGCTGTTCTCAGTACGCCTGCTCCTGTAACGACCAGTCAAGTCGCACCAACTCCTCAAGTTGCCACCCCTCAGACGCTCGTTCCTGCAATCAACCAGCAAGAATATCCAGCTGCTGTCGCCTCTAACGAGGCAGTTATAAGTGATGAGAGACTTTTTATGGATTCTTTCTACAAATTCCACGAAGCTTTGAAGTCGAAGCCAACGTAAGTTTTGAAACTTGACAGTGGAATCGCATTTCTGTTGACTTAAGCTGCCAAAAGTTTCATGATTGAATAGACGGAGTTGCTTTTGGGCAGGATTCCGAAAATGGGCGGGAAAGACTTGAACGTACACCTTCTGTACAAAGAAGTAACAGCTCGTGGAGGCTTGCAACAGGTCTGTCCAATGTATATAATGTCACGTGTTACATTTTGCACGAGTTATATAGTCATCAAGTGGTGCGAGTTCTTGACAAGTGTAAAGTCTCGAAGTAAAGTCACTTTCAGTGAAGTTCATTTTAATGTTCGCTTGCACTGCTCAGTTCTTGACCTCGTTATCGTATGCTATTGCCACTCTGATATCCGTAAGGTCATCAGAGACAGGAAGTGGAAGGAAATCACAGGTGCTTTTGAGTTTCCTCGCACTACAACTAGTGCGTCATATGTCCTTCGGAAGTACTATGTAAATTTGCTGCATCATTTTGAACAAGTTTACAAGAACGGAGCCAAAGGACCTCTTATTCCTCCACCAGGTATGAGTTTTTCACAGTAGGGCATTCTTCCAGATCAGTGACGTGTTGAAGGGCATTTTGAAGTTGTATCCTTGTTGAACCTCTTTGGTTTTTTGTTCTCCTCTAGCCAAGAAATTTTGTTTCACACGGCTGTGGGTTGGCCGAGAACGTACTTACGATTTTATCTTGCTTCGGAGTGAACTTTTTTCATATACATATTGAACTTTTATTTCTTCTAAAAGACTCGCTTATTTCCGTGTCCTCTCATGAGAACAGAAAATATCACTACCGCATGTCTGAAAGAAGACATTTGCAGTTGGAGATTCTGCTACTTTCTGGAGCTTTGGTACCTTGTTTGATCAGAACTAGATGTGCAAATTCGTAGGTGGGAATGAGGTGTTGGTTGCTCTTATGTTAGCAAAGCTGATGAGGAGTAATCAATTAATTACCATGCAGCAACTTTACCTGGGTCAAGCCCGTCTGTCCAACCTGGTGGTGATCCAGCACTTTCAGAGGGTGGTGATCAAGTCACCAAAAAAAGACCAAGAAAGCGGAAGATACAAATGCCGCTCATTCCTCAAGGTTTGCCTCGGATATTTGACTAGAGACAAACGTTTCAAGTAACATGTTGTCTACCTATAACAGAGGTTTTTTTTAAAAAAATTACATATTTCTCTCTTTCTGTTCTTCTCTACGTCTTCATTAGCTATTTCTCTCTTTTTTAGTACATAATTCGAGATTTCTGTTTATTGCAGTGGACCCCGCGGAGGCTATTGGAACGTCATGCAAGGGCTCAATTGAGGCAAAACTTGACTTTGGATACTTGATTACAATGGTTGTCGGTGGAGAGAAGCTCAAAGGTGTTCTGTATCACGTTCCCACCGGAGTGAAAGTCCCATCTCAGTTCACGAATCTTCCAACCCTGCTGGCCAGTGTTAACGTGGACGCCGCAAAGACCACTGTGGAGAGCACCGCTCGTCGCAAAAGAAGGAGAAAGGAGGAGATGCCAAAGAAGGACCCAAATGCTCCGAGGCCAAACCGGACAGGGTACAATTTCTTTTTCGCTGAACAACGTCAGCGATTGAAGGCTCTGCATCCTGATAAGGATCGAGATATCAGTCGAATGATAGGCGAAGCTTGGAACAGTCTTTCTGAGGAGCAAAAAACGGTGAGTCAAACAGGGCATTTAATGGGCATAGTAAAACCCGGTTATGGCTCAAAAGCTGACAATGTCATGTATGTTGTCAGAGTTGAACTTGAAGCATGACGATGTGCTTTTCCAAATGTCATCCAAAATCGTTTTGTCATGTTCTTAATTTGCTTTTGAACTGGGACAGATACGTCCCATGTGTGTGCAAGATGGAAAGCAAGATGCAACATCCTACTTTGAGAGCTTGTGAGATGAAATTGATCGTCTGCTGTCTCCTGCCATTCTTAAAAGTATGTCCAGGGGATAAATTTAAACTAAAGCTCTTGCTTTAAGATATGTTGCTATTCTACTTTACCTCTGTCTGATGTTCCCTTCAAGTCTATCATTAGACTTGAAGTCTAATACTTTTTCCTTTAGAGCTTGAAAAGGTAAGACGGCAATATCTGGACCCAATGTCAATGTTGCACTCGGAACCTTTGATGTGAATCACACTGATATCTACATGTGATGAGGTATACTTGTGAGAATCATCGTCCGCTTATACAGACTTAAGCGAAGGAGGGTCAAAATGGGACCTAGACTTGCTATTCACTTTCAAAGAGTACCAGTCACACGCAAGGTCGACTCTCTTGGTTGCCTACGTAAACTGCCGAAAGTGAATAGCAAGTTTTAGTGTTTTTTTGGGGGATTATTTAGTTTTACCTTCAACATTGATGTGTTTTCCTAATTATTCGGAGTAAATTTGGGAGATGAGCCCTCCTTGAACAGATCCTACAAGATGAAGCTCTCCATCTCCGATGTGGTCTACTATGCCCGCTAAATGCCCTGTTTGGGAACTTCCACAAAATCAGTTGAGAATGTCTTTGGCTGCTAAAATAGTGTGTTTTTGCCACGATGTCTATAGGTCCCGATTTTGTAGCTCAGGAGTTCTGAACGTTCCATTTGCATGCAGCCCTACCAAGAACGAGGTGTGAAAGACAAGGAGAGATTCAAAAGGGAGATGCGTGATTATCGGGAGAAGATGAAAAGCGGCCACTTTGATAGTGCTGCTGACCTTGGTACAGGGCAGACTGTGACTTCTCCAGAAGATCCCAGTGTTCCTGACCAACCCCTTGAGCAAGATCATGGAAATGCAATGGGGGATGATACTCCTCCCACGGGGGAGCCTACGTCTGAGACGCCCCATCAGCAAACATCCCATGAACCATCAAAGGGTGTTCCTGATCAGTCGTTAAATCAAGAGACACCTGCCTCTGTGGTGTCCACGCAAGGAGAGGGTTGATAGCTCTTCTTGTAGTTTCTGGATTTATGTTGGTTGGTAGTAAAGACTAGTAGAGGCAAACGCTTAGTTCATGGTGAGGAAGCCAGCAGTGGCAAGACAGTCTTCCAGTTTTCGATGTACCATACATTAGTCAGAGGGTTCAGTGGATAGTCAGTCAGGTTTAGGATTGAAAGGTAGATTCCGGTTTCATTCCAAGCAACCCTGTGGAGGATCTTGCTTCACGATTGTCATCATGAAGCGCTTCATCATCCATCTGCCAACACTGTACAGAAATCTGCCATACTTGGCCAGCTTAGCTTTATTCCCCATGGCGACCAGCTCCAACCATTTTCTTCGATATTTAGACGAAAAAAATCTCATATTCTCGATTGGAAATTCTTTTGTTTCTAACATGAGTGCATGTCACTTGTCTCTAATGTGTCAAATGACATCGTAATGTTTCAGCTCCGTTCCAGGCTGGGGTTATGATGAGCTTATTCTGGTCATTCATTTTCGAATTCAGTGCATGTTGCAACAATCACTTTGATTCATTATCCTTTTTTTACACGCGAGAGGGATGCTCAAGTTCACCGTGGTACTGTGGGCGCGGTGCACGCGACTATGTCCTGTTATGCGACAGTTATTTGTCTACATTCCGCGACTGTTGTCCTGTTATGCGACGGTTGTGTGTCTTCATTCCGTTGTGGAAGGCTGGCAGTTTGTATCTTTCTCATTTTGCGGAGGTCCTGGTATCGGATTGAATCGGCCCTTGCAGCTTCGAAGGATATCTGTTCTTGAGTTTTTTCTCACGCAACCATGGTCATCGAGGGGAAATTCACTTCTATAGGGTGGTTCAAGGAGATTCAGGAAGCATCAACAGGTTTTGTTTGTTGCAGTATCCTCTCAAATGTGGGAATGGTATGTACTTTCTTATTGGACATTTCCCATGATTGTTGTTCATGATTTACCTGAGCATATTTCATCTCAGTAATATCTCTGTAAG

mRNA

>Mapoly0043s0128.1
TTTTCTTCAGGCTTACCTGTAGGCAGGAGAAATTTGGTGTTTTCGGTGTTTGGGCAGAGTTGCGTCTCCGAGATTTTTCATCTCAGGAAAATTATGATTGACGATAGGAAATGTGATACGCGCACGTCTTTATCAGTGGGATCCGAAGCTTTGTGCGTCGAGGTTGGGAGATTTATCTGTACTCCTGTGATGAATGAATCATGTCGTCGTCTAGGAGATTGAAATCCGCTCGGAATTTCGCTTTATACAGAACCTGTCATGGTGCCTCTAGTTTCCTGCGAGCGTGGGAGGTCCGAGCTCGTGCTTGTTGTCTGTGAAGAGATAGCTTTGCTGATCGTACAGGAGTGACCTGTGCTATGTCCTCTTGGTTAGACACACTTCTGTACCAGAAAACACCCTGGAGGGTTTTTTTTTGGGTTGGTTTTTTAGCATCTCAATTGCGCAGTCATGCTCTATCTCTAAGAGCTGGAATGATGCGAAAGTCAGAAGTGACTTTCGACTTACGTATGCTTACATGGCTTTCGACTTACGTGAAGGCATGGGAAAAGCATCTGAATTATCCACGTTATATTTTTATGTATTTTACTTCGCTTCTGCATATGACCTTCTCACACAAGGAATGTGTGATAGGAGGCCCTTCATGAATTTTGCGAAGTCAGTTCAATAACCTCGAGCTTTCTTTCGCGCGGAAAGCCCGTCCTTCTGTATTTTATCAGGCGATGTTGAAGGTTAGGGATGTTGGGTGTCTGCAGGTGTGTTGATACTTTTTGCATTCTGCACATTGTAAGGTCAGGAAAGGCCGCTTGTCGAGTAAGCTGAGGGATTTCAGGCTAAAAGTGCAATACTTCAAACGATATTTGCGATCCAATCAGACTCACAGAGCTTGAAGACTTGTGGTGCCCAAGGGGCGTCACAATTTATGGAGAAGTGATGGAAAATTATTGGCTCATTTCTGAGTCTATGCGGATTATTGGAGTGTGCAGGTTCTCTTATGCTTGATACCAATTGCTGAAGAGGTTGCGATTTCAAAATGGCGACCGAAGCGGCTGTAGCAAATGTGCCACCTTCGGTACAAACACCAGCTAAAAATGCTGACACTGTAATGGTGGACGCGAAGGAGAGCCCTGTGGCTGTTCTCAGTACGCCTGCTCCTGTAACGACCAGTCAAGTCGCACCAACTCCTCAAGTTGCCACCCCTCAGACGCTCGTTCCTGCAATCAACCAGCAAGAATATCCAGCTGCTGTCGCCTCTAACGAGGCAGTTATAAGTGATGAGAGACTTTTTATGGATTCTTTCTACAAATTCCACGAAGCTTTGAAGTCGAAGCCAACGATTCCGAAAATGGGCGGGAAAGACTTGAACGTACACCTTCTGTACAAAGAAGTAACAGCTCGTGGAGGCTTGCAACAGGTCATCAGAGACAGGAAGTGGAAGGAAATCACAGGTGCTTTTGAGTTTCCTCGCACTACAACTAGTGCGTCATATGTCCTTCGGAAGTACTATGTAAATTTGCTGCATCATTTTGAACAAGTTTACAAGAACGGAGCCAAAGGACCTCTTATTCCTCCACCAGCAACTTTACCTGGGTCAAGCCCGTCTGTCCAACCTGGTGGTGATCCAGCACTTTCAGAGGGTGGTGATCAAGTCACCAAAAAAAGACCAAGAAAGCGGAAGATACAAATGCCGCTCATTCCTCAAGTGGACCCCGCGGAGGCTATTGGAACGTCATGCAAGGGCTCAATTGAGGCAAAACTTGACTTTGGATACTTGATTACAATGGTTGTCGGTGGAGAGAAGCTCAAAGGTGTTCTGTATCACGTTCCCACCGGAGTGAAAGTCCCATCTCAGTTCACGAATCTTCCAACCCTGCTGGCCAGTGTTAACGTGGACGCCGCAAAGACCACTGTGGAGAGCACCGCTCGTCGCAAAAGAAGGAGAAAGGAGGAGATGCCAAAGAAGGACCCAAATGCTCCGAGGCCAAACCGGACAGGGTACAATTTCTTTTTCGCTGAACAACGTCAGCGATTGAAGGCTCTGCATCCTGATAAGGATCGAGATATCAGTCGAATGATAGGCGAAGCTTGGAACAGTCTTTCTGAGGAGCAAAAAACGCCCTACCAAGAACGAGGTGTGAAAGACAAGGAGAGATTCAAAAGGGAGATGCGTGATTATCGGGAGAAGATGAAAAGCGGCCACTTTGATAGTGCTGCTGACCTTGGTACAGGGCAGACTGTGACTTCTCCAGAAGATCCCAGTGTTCCTGACCAACCCCTTGAGCAAGATCATGGAAATGCAATGGGGGATGATACTCCTCCCACGGGGGAGCCTACGTCTGAGACGCCCCATCAGCAAACATCCCATGAACCATCAAAGGGTGTTCCTGATCAGTCGTTAAATCAAGAGACACCTGCCTCTGTGGTGTCCACGCAAGGAGAGGGTTGATAGCTCTTCTTGTAGTTTCTGGATTTATGTTGGTTGGTAGTAAAGACTAGTAGAGGCAAACGCTTAGTTCATGGTGAGGAAGCCAGCAGTGGCAAGACAGTCTTCCAGTTTTCGATGTACCATACATTAGTCAGAGGGTTCAGTGGATAGTCAGTCAGGTTTAGGATTGAAAGGTAGATTCCGGTTTCATTCCAAGCAACCCTGTGGAGGATCTTGCTTCACGATTGTCATCATGAAGCGCTTCATCATCCATCTGCCAACACTGTACAGAAATCTGCCATACTTGGCCAGCTTAGCTTTATTCCCCATGGCGACCAGCTCCAACCATTTTCTTCGATATTTAGACGAAAAAAATCTCATATTCTCGATTGGAAATTCTTTTGTTTCTAACATGAGTGCATGTCACTTGTCTCTAATGTGTCAAATGACATCGTAATGTTTCAGCTCCGTTCCAGGCTGGGGTTATGATGAGCTTATTCTGGTCATTCATTTTCGAATTCAGTGCATGTTGCAACAATCACTTTGATTCATTATCCTTTTTTTACACGCGAGAGGGATGCTCAAGTTCACCGTGGTACTGTGGGCGCGGTGCACGCGACTATGTCCTGTTATGCGACAGTTATTTGTCTACATTCCGCGACTGTTGTCCTGTTATGCGACGGTTGTGTGTCTTCATTCCGTTGTGGAAGGCTGGCAGTTTGTATCTTTCTCATTTTGCGGAGGTCCTGGTATCGGATTGAATCGGCCCTTGCAGCTTCGAAGGATATCTGTTCTTGAGTTTTTTCTCACGCAACCATGGTCATCGAGGGGAAATTCACTTCTATAGGGTGGTTCAAGGAGATTCAGGAAGCATCAACAGGTTTTGTTTGTTGCAGTATCCTCTCAAATGTGGGAATGGTATGTACTTTCTTATTGGACATTTCCCATGATTGTTGTTCATGATTTACCTGAGCATATTTCATCTCAGTAATATCTCTGTAAG

CDS

>Mapoly0043s0128.1
ATGGCGACCGAAGCGGCTGTAGCAAATGTGCCACCTTCGGTACAAACACCAGCTAAAAATGCTGACACTGTAATGGTGGACGCGAAGGAGAGCCCTGTGGCTGTTCTCAGTACGCCTGCTCCTGTAACGACCAGTCAAGTCGCACCAACTCCTCAAGTTGCCACCCCTCAGACGCTCGTTCCTGCAATCAACCAGCAAGAATATCCAGCTGCTGTCGCCTCTAACGAGGCAGTTATAAGTGATGAGAGACTTTTTATGGATTCTTTCTACAAATTCCACGAAGCTTTGAAGTCGAAGCCAACGATTCCGAAAATGGGCGGGAAAGACTTGAACGTACACCTTCTGTACAAAGAAGTAACAGCTCGTGGAGGCTTGCAACAGGTCATCAGAGACAGGAAGTGGAAGGAAATCACAGGTGCTTTTGAGTTTCCTCGCACTACAACTAGTGCGTCATATGTCCTTCGGAAGTACTATGTAAATTTGCTGCATCATTTTGAACAAGTTTACAAGAACGGAGCCAAAGGACCTCTTATTCCTCCACCAGCAACTTTACCTGGGTCAAGCCCGTCTGTCCAACCTGGTGGTGATCCAGCACTTTCAGAGGGTGGTGATCAAGTCACCAAAAAAAGACCAAGAAAGCGGAAGATACAAATGCCGCTCATTCCTCAAGTGGACCCCGCGGAGGCTATTGGAACGTCATGCAAGGGCTCAATTGAGGCAAAACTTGACTTTGGATACTTGATTACAATGGTTGTCGGTGGAGAGAAGCTCAAAGGTGTTCTGTATCACGTTCCCACCGGAGTGAAAGTCCCATCTCAGTTCACGAATCTTCCAACCCTGCTGGCCAGTGTTAACGTGGACGCCGCAAAGACCACTGTGGAGAGCACCGCTCGTCGCAAAAGAAGGAGAAAGGAGGAGATGCCAAAGAAGGACCCAAATGCTCCGAGGCCAAACCGGACAGGGTACAATTTCTTTTTCGCTGAACAACGTCAGCGATTGAAGGCTCTGCATCCTGATAAGGATCGAGATATCAGTCGAATGATAGGCGAAGCTTGGAACAGTCTTTCTGAGGAGCAAAAAACGCCCTACCAAGAACGAGGTGTGAAAGACAAGGAGAGATTCAAAAGGGAGATGCGTGATTATCGGGAGAAGATGAAAAGCGGCCACTTTGATAGTGCTGCTGACCTTGGTACAGGGCAGACTGTGACTTCTCCAGAAGATCCCAGTGTTCCTGACCAACCCCTTGAGCAAGATCATGGAAATGCAATGGGGGATGATACTCCTCCCACGGGGGAGCCTACGTCTGAGACGCCCCATCAGCAAACATCCCATGAACCATCAAAGGGTGTTCCTGATCAGTCGTTAAATCAAGAGACACCTGCCTCTGTGGTGTCCACGCAAGGAGAGGGTTGA

Protein

>Mapoly0043s0128.1
MATEAAVANVPPSVQTPAKNADTVMVDAKESPVAVLSTPAPVTTSQVAPTPQVATPQTLVPAINQQEYPAAVASNEAVISDERLFMDSFYKFHEALKSKPTIPKMGGKDLNVHLLYKEVTARGGLQQVIRDRKWKEITGAFEFPRTTTSASYVLRKYYVNLLHHFEQVYKNGAKGPLIPPPATLPGSSPSVQPGGDPALSEGGDQVTKKRPRKRKIQMPLIPQVDPAEAIGTSCKGSIEAKLDFGYLITMVVGGEKLKGVLYHVPTGVKVPSQFTNLPTLLASVNVDAAKTTVESTARRKRRRKEEMPKKDPNAPRPNRTGYNFFFAEQRQRLKALHPDKDRDISRMIGEAWNSLSEEQKTPYQERGVKDKERFKREMRDYREKMKSGHFDSAADLGTGQTVTSPEDPSVPDQPLEQDHGNAMGDDTPPTGEPTSETPHQQTSHEPSKGVPDQSLNQETPASVVSTQGEG

Mapoly0043s0128.2  

Gene structure:

mRNA scaffold_43:1233261..1240577  ( - strand )
three_prime_UTR scaffold_43:1233261..1233863  ( - strand )
three_prime_UTR scaffold_43:1235243..1236139  ( - strand )
CDS scaffold_43:1236140..1236469  ( - strand )
CDS scaffold_43:1237404..1237816  ( - strand )
CDS scaffold_43:1237990..1238115  ( - strand )
CDS scaffold_43:1238551..1238713  ( - strand )
CDS scaffold_43:1238906..1238984  ( - strand )
CDS scaffold_43:1239078..1239379  ( - strand )
five_prime_UTR scaffold_43:1239380..1239426  ( - strand )
five_prime_UTR scaffold_43:1240423..1240577  ( - strand )

Sequences:

Gene

>Mapoly0043s0128.2
GCTTTTCGGAGGATTATTTCTCATGCCTTTTCGAACTTGCGTTTCTCAAAGGGAGGGAAGCCCGAAAGAAGCTCAATACTACAAACATTTCTTCAATTTTGGTTCAGACGGTGGTTTCATGTGGCGCTCCCCGCAAGCGTTGCGACGTCTTTCGGGTATTGTTTAATATTTTCTTCAGGCTTACCTGTAGGCAGGAGAAATTTGGTGTTTTCGGTGTTTGGGCAGAGTTGCGTCTCCGAGATTTTTCATCTCAGGAAAATTATGATTGACGATAGGAAATGTGATACGCGCACGTCTTTATCAGTGGGATCCGAAGCTTTGTGCGTCGAGGTTGGGAGATTTATCTGTACTCCTGTGATGAATGAATCATGTCGTCGTCTAGGAGATTGAAATCCGCTCGGAATTTCGCTTTATACAGAACCTGTCATGGTGCCTCTAGTTTCCTGCGAGCGTGGGAGGTCCGAGCTCGTGCTTGTTGTCTGTGAAGAGATAGCTTTGCTGATCGTACAGGAGTGACCTGTGCTATGTCCTCTTGGTTAGACACACTTCTGTACCAGAAAACACCCTGGAGGGTTTTTTTTTGGGTTGGTTTTTTAGCATCTCAATTGCGCAGTCATGCTCTATCTCTAAGAGCTGGAATGATGCGAAAGTCAGAAGTGACTTTCGACTTACGTATGCTTACATGGCTTTCGACTTACGTGAAGGCATGGGAAAAGCATCTGAATTATCCACGTTATATTTTTATGTATTTTACTTCGCTTCTGCATATGACCTTCTCACACAAGGAATGTGTGATAGGAGGCCCTTCATGAATTTTGCGAAGTCAGTTCAATAACCTCGAGCTTTCTTTCGCGCGGAAAGCCCGTCCTTCTGTATTTTATCAGGCGATGTTGAAGGTTAGGGATGTTGGGTGTCTGCAGGTGTGTTGATACTTTTTGCATTCTGCACATTGTAAGGTCAGGAAAGGCCGCTTGTCGAGTAAGCTGAGGGATTTCAGGCTAAAAGTGCAATACTTCAAACGATATTTGCGATCCAATCAGACTCACAGAGCTTGAAGACTTGTGGTGCCCAAGGGGCGTCACAATTTATGGAGAAGTGATGGAAAATTATTGGCTCATTTCTGAGTCTATGCGGATTATTGGAGTGTGCAGGTTCTCTTATGCTTGATACCAATTGCTGAAGAGGTTGCGATTTCAAAATGGCGACCGAAGCGGCTGTAGCAAATGTGCCACCTTCGGTACAAACACCAGCTAAAAATGCTGACACTGTAATGGTGGACGCGAAGGAGAGCCCTGTGGCTGTTCTCAGTACGCCTGCTCCTGTAACGACCAGTCAAGTCGCACCAACTCCTCAAGTTGCCACCCCTCAGACGCTCGTTCCTGCAATCAACCAGCAAGAATATCCAGCTGCTGTCGCCTCTAACGAGGCAGTTATAAGTGATGAGAGACTTTTTATGGATTCTTTCTACAAATTCCACGAAGCTTTGAAGTCGAAGCCAACGTAAGTTTTGAAACTTGACAGTGGAATCGCATTTCTGTTGACTTAAGCTGCCAAAAGTTTCATGATTGAATAGACGGAGTTGCTTTTGGGCAGGATTCCGAAAATGGGCGGGAAAGACTTGAACGTACACCTTCTGTACAAAGAAGTAACAGCTCGTGGAGGCTTGCAACAGGTCTGTCCAATGTATATAATGTCACGTGTTACATTTTGCACGAGTTATATAGTCATCAAGTGGTGCGAGTTCTTGACAAGTGTAAAGTCTCGAAGTAAAGTCACTTTCAGTGAAGTTCATTTTAATGTTCGCTTGCACTGCTCAGTTCTTGACCTCGTTATCGTATGCTATTGCCACTCTGATATCCGTAAGGTCATCAGAGACAGGAAGTGGAAGGAAATCACAGGTGCTTTTGAGTTTCCTCGCACTACAACTAGTGCGTCATATGTCCTTCGGAAGTACTATGTAAATTTGCTGCATCATTTTGAACAAGTTTACAAGAACGGAGCCAAAGGACCTCTTATTCCTCCACCAGGTATGAGTTTTTCACAGTAGGGCATTCTTCCAGATCAGTGACGTGTTGAAGGGCATTTTGAAGTTGTATCCTTGTTGAACCTCTTTGGTTTTTTGTTCTCCTCTAGCCAAGAAATTTTGTTTCACACGGCTGTGGGTTGGCCGAGAACGTACTTACGATTTTATCTTGCTTCGGAGTGAACTTTTTTCATATACATATTGAACTTTTATTTCTTCTAAAAGACTCGCTTATTTCCGTGTCCTCTCATGAGAACAGAAAATATCACTACCGCATGTCTGAAAGAAGACATTTGCAGTTGGAGATTCTGCTACTTTCTGGAGCTTTGGTACCTTGTTTGATCAGAACTAGATGTGCAAATTCGTAGGTGGGAATGAGGTGTTGGTTGCTCTTATGTTAGCAAAGCTGATGAGGAGTAATCAATTAATTACCATGCAGCAACTTTACCTGGGTCAAGCCCGTCTGTCCAACCTGGTGGTGATCCAGCACTTTCAGAGGGTGGTGATCAAGTCACCAAAAAAAGACCAAGAAAGCGGAAGATACAAATGCCGCTCATTCCTCAAGGTTTGCCTCGGATATTTGACTAGAGACAAACGTTTCAAGTAACATGTTGTCTACCTATAACAGAGGTTTTTTTTAAAAAAATTACATATTTCTCTCTTTCTGTTCTTCTCTACGTCTTCATTAGCTATTTCTCTCTTTTTTAGTACATAATTCGAGATTTCTGTTTATTGCAGTGGACCCCGCGGAGGCTATTGGAACGTCATGCAAGGGCTCAATTGAGGCAAAACTTGACTTTGGATACTTGATTACAATGGTTGTCGGTGGAGAGAAGCTCAAAGGTGTTCTGTATCACGTTCCCACCGGAGTGAAAGTCCCATCTCAGTTCACGAATCTTCCAACCCTGCTGGCCAGTGTTAACGTGGACGCCGCAAAGACCACTGTGGAGAGCACCGCTCGTCGCAAAAGAAGGAGAAAGGAGGAGATGCCAAAGAAGGACCCAAATGCTCCGAGGCCAAACCGGACAGGGTACAATTTCTTTTTCGCTGAACAACGTCAGCGATTGAAGGCTCTGCATCCTGATAAGGATCGAGATATCAGTCGAATGATAGGCGAAGCTTGGAACAGTCTTTCTGAGGAGCAAAAAACGGTGAGTCAAACAGGGCATTTAATGGGCATAGTAAAACCCGGTTATGGCTCAAAAGCTGACAATGTCATGTATGTTGTCAGAGTTGAACTTGAAGCATGACGATGTGCTTTTCCAAATGTCATCCAAAATCGTTTTGTCATGTTCTTAATTTGCTTTTGAACTGGGACAGATACGTCCCATGTGTGTGCAAGATGGAAAGCAAGATGCAACATCCTACTTTGAGAGCTTGTGAGATGAAATTGATCGTCTGCTGTCTCCTGCCATTCTTAAAAGTATGTCCAGGGGATAAATTTAAACTAAAGCTCTTGCTTTAAGATATGTTGCTATTCTACTTTACCTCTGTCTGATGTTCCCTTCAAGTCTATCATTAGACTTGAAGTCTAATACTTTTTCCTTTAGAGCTTGAAAAGGTAAGACGGCAATATCTGGACCCAATGTCAATGTTGCACTCGGAACCTTTGATGTGAATCACACTGATATCTACATGTGATGAGGTATACTTGTGAGAATCATCGTCCGCTTATACAGACTTAAGCGAAGGAGGGTCAAAATGGGACCTAGACTTGCTATTCACTTTCAAAGAGTACCAGTCACACGCAAGGTCGACTCTCTTGGTTGCCTACGTAAACTGCCGAAAGTGAATAGCAAGTTTTAGTGTTTTTTTGGGGGATTATTTAGTTTTACCTTCAACATTGATGTGTTTTCCTAATTATTCGGAGTAAATTTGGGAGATGAGCCCTCCTTGAACAGATCCTACAAGATGAAGCTCTCCATCTCCGATGTGGTCTACTATGCCCGCTAAATGCCCTGTTTGGGAACTTCCACAAAATCAGTTGAGAATGTCTTTGGCTGCTAAAATAGTGTGTTTTTGCCACGATGTCTATAGGTCCCGATTTTGTAGCTCAGGAGTTCTGAACGTTCCATTTGCATGCAGCCCTACCAAGAACGAGGTGTGAAAGACAAGGAGAGATTCAAAAGGGAGATGCGTGATTATCGGGAGAAGATGAAAAGCGGCCACTTTGATAGTGCTGCTGACCTTGGTACAGGGCAGACTGTGACTTCTCCAGAAGATCCCAGTGTTCCTGACCAACCCCTTGAGCAAGATCATGGAAATGCAATGGGGGATGATACTCCTCCCACGGGGGAGCCTACGTCTGAGACGCCCCATCAGCAAACATCCCATGAACCATCAAAGGGTGTTCCTGATCAGTCGTTAAATCAAGAGACACCTGCCTCTGTGGTGTCCACGCAAGGAGAGGGTTGATAGCTCTTCTTGTAGTTTCTGGATTTATGTTGGTTGGTAGTAAAGACTAGTAGAGGCAAACGCTTAGTTCATGGTGAGGAAGCCAGCAGTGGCAAGACAGTCTTCCAGTTTTCGATGTACCATACATTAGTCAGAGGGTTCAGTGGATAGTCAGTCAGGTTTAGGATTGAAAGGTAGATTCCGGTTTCATTCCAAGCAACCCTGTGGAGGATCTTGCTTCACGATTGTCATCATGAAGCGCTTCATCATCCATCTGCCAACACTGTACAGAAATCTGCCATACTTGGCCAGCTTAGCTTTATTCCCCATGGCGACCAGCTCCAACCATTTTCTTCGATATTTAGACGAAAAAAATCTCATATTCTCGATTGGAAATTCTTTTGTTTCTAACATGAGTGCATGTCACTTGTCTCTAATGTGTCAAATGACATCGTAATGTTTCAGCTCCGTTCCAGGCTGGGGTTATGATGAGCTTATTCTGGTCATTCATTTTCGAATTCAGTGCATGTTGCAACAATCACTTTGATTCATTATCCTTTTTTTACACGCGAGAGGGATGCTCAAGTTCACCGTGGTACTGTGGGCGCGGTGCACGCGACTATGTCCTGTTATGCGACAGTTATTTGTCTACATTCCGCGACTGTTGTCCTGTTATGCGACGGTTGTGTGTCTTCATTCCGTTGTGGAAGGCTGGCAGTTTGTATCTTTCTCATTTTGCGGAGGTCCTGGTATCGGATTGAATCGGCCCTTGCAGCTTCGAAGGATATCTGTTCTTGAGTTTTTTCTCACGCAACCATGGTCATCGAGGGGAAATTCACTTCTATAGGGTGGTTCAAGGAGATTCAGGAAGCATCAACAGGTTTTGTTTGTTGCAGTATCCTCTCAAATGTGGGAATGGTATGTACTTTCTTATTGGACATTTCCCATGATTGTTGTTCATGATTTACCTGAGCATATTTCATCTCAGTAATATCTCTGTAAGATATGTTAGTATGTGTATTGCTTCGTTATTACGTTGTACGCTAGTTCATTTTTGGCGATTCACTTTCACAAATCTACTTCTGTGCAAGACCTCTTCTACGACATTGCAAATCGAATAGATTTTGGATATCAAAAGGTGAAGCAATCTGTACTCAGAGTTTGGGAAATAATGTAACCTTTCGGGGATATTGGGAGCAGTTGCATTTCAGCTAAGGTTGAAGCAAAATCCTCTAGAGGTTATTTTATTTCGAAGGACGCGAAGTATATGTGTGGATATAATTAAGCGATGTATAGCTGTAATTTTACACTGCTAGTGACGGATTCAGGGCCACGTCTGGTATACCAACGGTTCATCCATTAGTGTCGAGTATCTTTCCTTTGTGGTCGAACAGTTTTCCATTGTTCAATGCCGAATATGTAGCGTATGAAGTTGGTCTCTCAGTTACATTCTTATCATTGTGTTCTGAGTTGATACGTCCTTAGTTTAAGTTGCGTGTCCGTGGTTCGTATAGTACGTATAGGCCGAGGTTCTGAACATCGCGACGAAGCGATGGCGCATCAACGTTACTGCGAGATGATTACTAACTGCTACCCAATTCAATTATGCCCAAGTGGGTGCGAGGAATGCCTTGCTTTCTCAAGTCATAGTTCCACTGATCTTGTGATCGATAGAAGAGGCGCGAGCACTGTCATCAATGAAAGGTTTTTTGGGTTGTCAAGCCTTCAGTGAATTTTCTCGCACCTGGGCTGAGTTCTGAGGTTCACTGACTCGCTGCTCATTGCTTCATACCGCTGTTTGCTTATCATGATGCGCTGTATTCTCGTGATCATACAATGATCAAAACATCGATAGTTCTATCGTACAAAAAGTTAATGTTCTTGTATATCTATAATATCAGTGTACAGTAAACAATTTAGTAACAGCTAAATTAACGGGTATTCTTGTGCACACAAGCAGCTTTTCAACATTGTTGAAAATTTACTTTCTGATGATATATTTGGTTACAACAACTTATAGAAAATTCTTACTTCTGCAATTTCAGGGTGTAATGCTATGGATCTTGAATTTGGACTATTAATACTGGCGGGTAACCTTTTTTATTTCACTATGGATGTTTTGACTGCAGAGTATACTACTATGTACCCATATTCCTGTCGCTCATTATTGTTGACGGAGACAAGCATTTGTTGCTCTTCCAAATCTCGGCTTCGCAAGAATTCATATATATAACTCTGTACGTTGATTAGAGATACAGTTGAATGCTTGTGTTTTGATGACAGCAAATGAACTCCAGGTATTGCAGTTCACTCTTCTGCATGTCGTACAAGCAACATTGTGATTGGAGGTCATCCCAAACCTGGTTCCTGACGTCGTCTTGAGCTATGTTCTTGGCGGTGCTACGGTTGTTCTACTTACGAATCTTTCTCTGCAAACGTAACTTTCATCCATATTTTTTTTTACAGGTTTAATAGTACTCTGATGTTCTACCTTAAAGTTGTTCTGTTCAACCCTCTTACTTTCCATAGACATGATGTAAGTTCTGAGACATCATGTTGTATGTTTTATGCTAAAATGTTGTGCGTTTAATTGTGCTAACGTCTTGCGCGCTCGCCGCGTTGCAGACCGGATTGGTATGGCTGTAATAAATGAACATCGTTGTGAAGCTACTAGGTACAGACGTATTTACAGTTTGGATACAATTGAAAGAACTGTGCAAGAAAATTGCACAAAGCTTATAATTAGTTCAAAAAGTGGTAGATCTGTTATCTCGGAACATCACTTTCCAGGAATAAGACTTGTCTGTTAAATACTCATGATTGTCATCCAAATGCCCCACATTATGATAAATAAAGTTAATGAACGATGAACGAAAAAAAACGTTCAATATTGATCGCGA

mRNA

>Mapoly0043s0128.2
GCTTTTCGGAGGATTATTTCTCATGCCTTTTCGAACTTGCGTTTCTCAAAGGGAGGGAAGCCCGAAAGAAGCTCAATACTACAAACATTTCTTCAATTTTGGTTCAGACGGTGGTTTCATGTGGCGCTCCCCGCAAGCGTTGCGACGTCTTTCGGGTTCTCTTATGCTTGATACCAATTGCTGAAGAGGTTGCGATTTCAAAATGGCGACCGAAGCGGCTGTAGCAAATGTGCCACCTTCGGTACAAACACCAGCTAAAAATGCTGACACTGTAATGGTGGACGCGAAGGAGAGCCCTGTGGCTGTTCTCAGTACGCCTGCTCCTGTAACGACCAGTCAAGTCGCACCAACTCCTCAAGTTGCCACCCCTCAGACGCTCGTTCCTGCAATCAACCAGCAAGAATATCCAGCTGCTGTCGCCTCTAACGAGGCAGTTATAAGTGATGAGAGACTTTTTATGGATTCTTTCTACAAATTCCACGAAGCTTTGAAGTCGAAGCCAACGATTCCGAAAATGGGCGGGAAAGACTTGAACGTACACCTTCTGTACAAAGAAGTAACAGCTCGTGGAGGCTTGCAACAGGTCATCAGAGACAGGAAGTGGAAGGAAATCACAGGTGCTTTTGAGTTTCCTCGCACTACAACTAGTGCGTCATATGTCCTTCGGAAGTACTATGTAAATTTGCTGCATCATTTTGAACAAGTTTACAAGAACGGAGCCAAAGGACCTCTTATTCCTCCACCAGCAACTTTACCTGGGTCAAGCCCGTCTGTCCAACCTGGTGGTGATCCAGCACTTTCAGAGGGTGGTGATCAAGTCACCAAAAAAAGACCAAGAAAGCGGAAGATACAAATGCCGCTCATTCCTCAAGTGGACCCCGCGGAGGCTATTGGAACGTCATGCAAGGGCTCAATTGAGGCAAAACTTGACTTTGGATACTTGATTACAATGGTTGTCGGTGGAGAGAAGCTCAAAGGTGTTCTGTATCACGTTCCCACCGGAGTGAAAGTCCCATCTCAGTTCACGAATCTTCCAACCCTGCTGGCCAGTGTTAACGTGGACGCCGCAAAGACCACTGTGGAGAGCACCGCTCGTCGCAAAAGAAGGAGAAAGGAGGAGATGCCAAAGAAGGACCCAAATGCTCCGAGGCCAAACCGGACAGGGTACAATTTCTTTTTCGCTGAACAACGTCAGCGATTGAAGGCTCTGCATCCTGATAAGGATCGAGATATCAGTCGAATGATAGGCGAAGCTTGGAACAGTCTTTCTGAGGAGCAAAAAACGCCCTACCAAGAACGAGGTGTGAAAGACAAGGAGAGATTCAAAAGGGAGATGCGTGATTATCGGGAGAAGATGAAAAGCGGCCACTTTGATAGTGCTGCTGACCTTGGTACAGGGCAGACTGTGACTTCTCCAGAAGATCCCAGTGTTCCTGACCAACCCCTTGAGCAAGATCATGGAAATGCAATGGGGGATGATACTCCTCCCACGGGGGAGCCTACGTCTGAGACGCCCCATCAGCAAACATCCCATGAACCATCAAAGGGTGTTCCTGATCAGTCGTTAAATCAAGAGACACCTGCCTCTGTGGTGTCCACGCAAGGAGAGGGTTGATAGCTCTTCTTGTAGTTTCTGGATTTATGTTGGTTGGTAGTAAAGACTAGTAGAGGCAAACGCTTAGTTCATGGTGAGGAAGCCAGCAGTGGCAAGACAGTCTTCCAGTTTTCGATGTACCATACATTAGTCAGAGGGTTCAGTGGATAGTCAGTCAGGTTTAGGATTGAAAGGTAGATTCCGGTTTCATTCCAAGCAACCCTGTGGAGGATCTTGCTTCACGATTGTCATCATGAAGCGCTTCATCATCCATCTGCCAACACTGTACAGAAATCTGCCATACTTGGCCAGCTTAGCTTTATTCCCCATGGCGACCAGCTCCAACCATTTTCTTCGATATTTAGACGAAAAAAATCTCATATTCTCGATTGGAAATTCTTTTGTTTCTAACATGAGTGCATGTCACTTGTCTCTAATGTGTCAAATGACATCGTAATGTTTCAGCTCCGTTCCAGGCTGGGGTTATGATGAGCTTATTCTGGTCATTCATTTTCGAATTCAGTGCATGTTGCAACAATCACTTTGATTCATTATCCTTTTTTTACACGCGAGAGGGATGCTCAAGTTCACCGTGGTACTGTGGGCGCGGTGCACGCGACTATGTCCTGTTATGCGACAGTTATTTGTCTACATTCCGCGACTGTTGTCCTGTTATGCGACGGTTGTGTGTCTTCATTCCGTTGTGGAAGGCTGGCAGTTTGTATCTTTCTCATTTTGCGGAGGTCCTGGTATCGGATTGAATCGGCCCTTGCAGCTTCGAAGGATATCTGTTCTTGAGTTTTTTCTCACGCAACCATGGTCATCGAGGGGAAATTCACTTCTATAGGGTGGTTCAAGGAGATTCAGGAAGCATCAACAGGTTTTGTTTGTTGCAGTATCCTCTCAAATGTGGGAATGGTATTGCAGTTCACTCTTCTGCATGTCGTACAAGCAACATTGTGATTGGAGGTCATCCCAAACCTGGTTCCTGACGTCGTCTTGAGCTATGTTCTTGGCGGTGCTACGGTTGTTCTACTTACGAATCTTTCTCTGCAAACGTAACTTTCATCCATATTTTTTTTTACAGGTTTAATAGTACTCTGATGTTCTACCTTAAAGTTGTTCTGTTCAACCCTCTTACTTTCCATAGACATGATGTAAGTTCTGAGACATCATGTTGTATGTTTTATGCTAAAATGTTGTGCGTTTAATTGTGCTAACGTCTTGCGCGCTCGCCGCGTTGCAGACCGGATTGGTATGGCTGTAATAAATGAACATCGTTGTGAAGCTACTAGGTACAGACGTATTTACAGTTTGGATACAATTGAAAGAACTGTGCAAGAAAATTGCACAAAGCTTATAATTAGTTCAAAAAGTGGTAGATCTGTTATCTCGGAACATCACTTTCCAGGAATAAGACTTGTCTGTTAAATACTCATGATTGTCATCCAAATGCCCCACATTATGATAAATAAAGTTAATGAACGATGAACGAAAAAAAACGTTCAATATTGATCGCGA

CDS

>Mapoly0043s0128.2
ATGGCGACCGAAGCGGCTGTAGCAAATGTGCCACCTTCGGTACAAACACCAGCTAAAAATGCTGACACTGTAATGGTGGACGCGAAGGAGAGCCCTGTGGCTGTTCTCAGTACGCCTGCTCCTGTAACGACCAGTCAAGTCGCACCAACTCCTCAAGTTGCCACCCCTCAGACGCTCGTTCCTGCAATCAACCAGCAAGAATATCCAGCTGCTGTCGCCTCTAACGAGGCAGTTATAAGTGATGAGAGACTTTTTATGGATTCTTTCTACAAATTCCACGAAGCTTTGAAGTCGAAGCCAACGATTCCGAAAATGGGCGGGAAAGACTTGAACGTACACCTTCTGTACAAAGAAGTAACAGCTCGTGGAGGCTTGCAACAGGTCATCAGAGACAGGAAGTGGAAGGAAATCACAGGTGCTTTTGAGTTTCCTCGCACTACAACTAGTGCGTCATATGTCCTTCGGAAGTACTATGTAAATTTGCTGCATCATTTTGAACAAGTTTACAAGAACGGAGCCAAAGGACCTCTTATTCCTCCACCAGCAACTTTACCTGGGTCAAGCCCGTCTGTCCAACCTGGTGGTGATCCAGCACTTTCAGAGGGTGGTGATCAAGTCACCAAAAAAAGACCAAGAAAGCGGAAGATACAAATGCCGCTCATTCCTCAAGTGGACCCCGCGGAGGCTATTGGAACGTCATGCAAGGGCTCAATTGAGGCAAAACTTGACTTTGGATACTTGATTACAATGGTTGTCGGTGGAGAGAAGCTCAAAGGTGTTCTGTATCACGTTCCCACCGGAGTGAAAGTCCCATCTCAGTTCACGAATCTTCCAACCCTGCTGGCCAGTGTTAACGTGGACGCCGCAAAGACCACTGTGGAGAGCACCGCTCGTCGCAAAAGAAGGAGAAAGGAGGAGATGCCAAAGAAGGACCCAAATGCTCCGAGGCCAAACCGGACAGGGTACAATTTCTTTTTCGCTGAACAACGTCAGCGATTGAAGGCTCTGCATCCTGATAAGGATCGAGATATCAGTCGAATGATAGGCGAAGCTTGGAACAGTCTTTCTGAGGAGCAAAAAACGCCCTACCAAGAACGAGGTGTGAAAGACAAGGAGAGATTCAAAAGGGAGATGCGTGATTATCGGGAGAAGATGAAAAGCGGCCACTTTGATAGTGCTGCTGACCTTGGTACAGGGCAGACTGTGACTTCTCCAGAAGATCCCAGTGTTCCTGACCAACCCCTTGAGCAAGATCATGGAAATGCAATGGGGGATGATACTCCTCCCACGGGGGAGCCTACGTCTGAGACGCCCCATCAGCAAACATCCCATGAACCATCAAAGGGTGTTCCTGATCAGTCGTTAAATCAAGAGACACCTGCCTCTGTGGTGTCCACGCAAGGAGAGGGTTGA

Protein

>Mapoly0043s0128.2
MATEAAVANVPPSVQTPAKNADTVMVDAKESPVAVLSTPAPVTTSQVAPTPQVATPQTLVPAINQQEYPAAVASNEAVISDERLFMDSFYKFHEALKSKPTIPKMGGKDLNVHLLYKEVTARGGLQQVIRDRKWKEITGAFEFPRTTTSASYVLRKYYVNLLHHFEQVYKNGAKGPLIPPPATLPGSSPSVQPGGDPALSEGGDQVTKKRPRKRKIQMPLIPQVDPAEAIGTSCKGSIEAKLDFGYLITMVVGGEKLKGVLYHVPTGVKVPSQFTNLPTLLASVNVDAAKTTVESTARRKRRRKEEMPKKDPNAPRPNRTGYNFFFAEQRQRLKALHPDKDRDISRMIGEAWNSLSEEQKTPYQERGVKDKERFKREMRDYREKMKSGHFDSAADLGTGQTVTSPEDPSVPDQPLEQDHGNAMGDDTPPTGEPTSETPHQQTSHEPSKGVPDQSLNQETPASVVSTQGEG

Mapoly0043s0128.3  

Gene structure:

mRNA scaffold_43:1233261..1240561  ( - strand )
three_prime_UTR scaffold_43:1233261..1233863  ( - strand )
three_prime_UTR scaffold_43:1235243..1236139  ( - strand )
CDS scaffold_43:1236140..1236469  ( - strand )
CDS scaffold_43:1237404..1237816  ( - strand )
CDS scaffold_43:1237990..1238115  ( - strand )
CDS scaffold_43:1238551..1238713  ( - strand )
CDS scaffold_43:1238906..1238984  ( - strand )
CDS scaffold_43:1239078..1239379  ( - strand )
five_prime_UTR scaffold_43:1239380..1239657  ( - strand )
five_prime_UTR scaffold_43:1240423..1240561  ( - strand )

Sequences:

Gene

>Mapoly0043s0128.3
TTTCTCATGCCTTTTCGAACTTGCGTTTCTCAAAGGGAGGGAAGCCCGAAAGAAGCTCAATACTACAAACATTTCTTCAATTTTGGTTCAGACGGTGGTTTCATGTGGCGCTCCCCGCAAGCGTTGCGACGTCTTTCGGGTATTGTTTAATATTTTCTTCAGGCTTACCTGTAGGCAGGAGAAATTTGGTGTTTTCGGTGTTTGGGCAGAGTTGCGTCTCCGAGATTTTTCATCTCAGGAAAATTATGATTGACGATAGGAAATGTGATACGCGCACGTCTTTATCAGTGGGATCCGAAGCTTTGTGCGTCGAGGTTGGGAGATTTATCTGTACTCCTGTGATGAATGAATCATGTCGTCGTCTAGGAGATTGAAATCCGCTCGGAATTTCGCTTTATACAGAACCTGTCATGGTGCCTCTAGTTTCCTGCGAGCGTGGGAGGTCCGAGCTCGTGCTTGTTGTCTGTGAAGAGATAGCTTTGCTGATCGTACAGGAGTGACCTGTGCTATGTCCTCTTGGTTAGACACACTTCTGTACCAGAAAACACCCTGGAGGGTTTTTTTTTGGGTTGGTTTTTTAGCATCTCAATTGCGCAGTCATGCTCTATCTCTAAGAGCTGGAATGATGCGAAAGTCAGAAGTGACTTTCGACTTACGTATGCTTACATGGCTTTCGACTTACGTGAAGGCATGGGAAAAGCATCTGAATTATCCACGTTATATTTTTATGTATTTTACTTCGCTTCTGCATATGACCTTCTCACACAAGGAATGTGTGATAGGAGGCCCTTCATGAATTTTGCGAAGTCAGTTCAATAACCTCGAGCTTTCTTTCGCGCGGAAAGCCCGTCCTTCTGTATTTTATCAGGCGATGTTGAAGGTTAGGGATGTTGGGTGTCTGCAGGTGTGTTGATACTTTTTGCATTCTGCACATTGTAAGGTCAGGAAAGGCCGCTTGTCGAGTAAGCTGAGGGATTTCAGGCTAAAAGTGCAATACTTCAAACGATATTTGCGATCCAATCAGACTCACAGAGCTTGAAGACTTGTGGTGCCCAAGGGGCGTCACAATTTATGGAGAAGTGATGGAAAATTATTGGCTCATTTCTGAGTCTATGCGGATTATTGGAGTGTGCAGGTTCTCTTATGCTTGATACCAATTGCTGAAGAGGTTGCGATTTCAAAATGGCGACCGAAGCGGCTGTAGCAAATGTGCCACCTTCGGTACAAACACCAGCTAAAAATGCTGACACTGTAATGGTGGACGCGAAGGAGAGCCCTGTGGCTGTTCTCAGTACGCCTGCTCCTGTAACGACCAGTCAAGTCGCACCAACTCCTCAAGTTGCCACCCCTCAGACGCTCGTTCCTGCAATCAACCAGCAAGAATATCCAGCTGCTGTCGCCTCTAACGAGGCAGTTATAAGTGATGAGAGACTTTTTATGGATTCTTTCTACAAATTCCACGAAGCTTTGAAGTCGAAGCCAACGTAAGTTTTGAAACTTGACAGTGGAATCGCATTTCTGTTGACTTAAGCTGCCAAAAGTTTCATGATTGAATAGACGGAGTTGCTTTTGGGCAGGATTCCGAAAATGGGCGGGAAAGACTTGAACGTACACCTTCTGTACAAAGAAGTAACAGCTCGTGGAGGCTTGCAACAGGTCTGTCCAATGTATATAATGTCACGTGTTACATTTTGCACGAGTTATATAGTCATCAAGTGGTGCGAGTTCTTGACAAGTGTAAAGTCTCGAAGTAAAGTCACTTTCAGTGAAGTTCATTTTAATGTTCGCTTGCACTGCTCAGTTCTTGACCTCGTTATCGTATGCTATTGCCACTCTGATATCCGTAAGGTCATCAGAGACAGGAAGTGGAAGGAAATCACAGGTGCTTTTGAGTTTCCTCGCACTACAACTAGTGCGTCATATGTCCTTCGGAAGTACTATGTAAATTTGCTGCATCATTTTGAACAAGTTTACAAGAACGGAGCCAAAGGACCTCTTATTCCTCCACCAGGTATGAGTTTTTCACAGTAGGGCATTCTTCCAGATCAGTGACGTGTTGAAGGGCATTTTGAAGTTGTATCCTTGTTGAACCTCTTTGGTTTTTTGTTCTCCTCTAGCCAAGAAATTTTGTTTCACACGGCTGTGGGTTGGCCGAGAACGTACTTACGATTTTATCTTGCTTCGGAGTGAACTTTTTTCATATACATATTGAACTTTTATTTCTTCTAAAAGACTCGCTTATTTCCGTGTCCTCTCATGAGAACAGAAAATATCACTACCGCATGTCTGAAAGAAGACATTTGCAGTTGGAGATTCTGCTACTTTCTGGAGCTTTGGTACCTTGTTTGATCAGAACTAGATGTGCAAATTCGTAGGTGGGAATGAGGTGTTGGTTGCTCTTATGTTAGCAAAGCTGATGAGGAGTAATCAATTAATTACCATGCAGCAACTTTACCTGGGTCAAGCCCGTCTGTCCAACCTGGTGGTGATCCAGCACTTTCAGAGGGTGGTGATCAAGTCACCAAAAAAAGACCAAGAAAGCGGAAGATACAAATGCCGCTCATTCCTCAAGGTTTGCCTCGGATATTTGACTAGAGACAAACGTTTCAAGTAACATGTTGTCTACCTATAACAGAGGTTTTTTTTAAAAAAATTACATATTTCTCTCTTTCTGTTCTTCTCTACGTCTTCATTAGCTATTTCTCTCTTTTTTAGTACATAATTCGAGATTTCTGTTTATTGCAGTGGACCCCGCGGAGGCTATTGGAACGTCATGCAAGGGCTCAATTGAGGCAAAACTTGACTTTGGATACTTGATTACAATGGTTGTCGGTGGAGAGAAGCTCAAAGGTGTTCTGTATCACGTTCCCACCGGAGTGAAAGTCCCATCTCAGTTCACGAATCTTCCAACCCTGCTGGCCAGTGTTAACGTGGACGCCGCAAAGACCACTGTGGAGAGCACCGCTCGTCGCAAAAGAAGGAGAAAGGAGGAGATGCCAAAGAAGGACCCAAATGCTCCGAGGCCAAACCGGACAGGGTACAATTTCTTTTTCGCTGAACAACGTCAGCGATTGAAGGCTCTGCATCCTGATAAGGATCGAGATATCAGTCGAATGATAGGCGAAGCTTGGAACAGTCTTTCTGAGGAGCAAAAAACGGTGAGTCAAACAGGGCATTTAATGGGCATAGTAAAACCCGGTTATGGCTCAAAAGCTGACAATGTCATGTATGTTGTCAGAGTTGAACTTGAAGCATGACGATGTGCTTTTCCAAATGTCATCCAAAATCGTTTTGTCATGTTCTTAATTTGCTTTTGAACTGGGACAGATACGTCCCATGTGTGTGCAAGATGGAAAGCAAGATGCAACATCCTACTTTGAGAGCTTGTGAGATGAAATTGATCGTCTGCTGTCTCCTGCCATTCTTAAAAGTATGTCCAGGGGATAAATTTAAACTAAAGCTCTTGCTTTAAGATATGTTGCTATTCTACTTTACCTCTGTCTGATGTTCCCTTCAAGTCTATCATTAGACTTGAAGTCTAATACTTTTTCCTTTAGAGCTTGAAAAGGTAAGACGGCAATATCTGGACCCAATGTCAATGTTGCACTCGGAACCTTTGATGTGAATCACACTGATATCTACATGTGATGAGGTATACTTGTGAGAATCATCGTCCGCTTATACAGACTTAAGCGAAGGAGGGTCAAAATGGGACCTAGACTTGCTATTCACTTTCAAAGAGTACCAGTCACACGCAAGGTCGACTCTCTTGGTTGCCTACGTAAACTGCCGAAAGTGAATAGCAAGTTTTAGTGTTTTTTTGGGGGATTATTTAGTTTTACCTTCAACATTGATGTGTTTTCCTAATTATTCGGAGTAAATTTGGGAGATGAGCCCTCCTTGAACAGATCCTACAAGATGAAGCTCTCCATCTCCGATGTGGTCTACTATGCCCGCTAAATGCCCTGTTTGGGAACTTCCACAAAATCAGTTGAGAATGTCTTTGGCTGCTAAAATAGTGTGTTTTTGCCACGATGTCTATAGGTCCCGATTTTGTAGCTCAGGAGTTCTGAACGTTCCATTTGCATGCAGCCCTACCAAGAACGAGGTGTGAAAGACAAGGAGAGATTCAAAAGGGAGATGCGTGATTATCGGGAGAAGATGAAAAGCGGCCACTTTGATAGTGCTGCTGACCTTGGTACAGGGCAGACTGTGACTTCTCCAGAAGATCCCAGTGTTCCTGACCAACCCCTTGAGCAAGATCATGGAAATGCAATGGGGGATGATACTCCTCCCACGGGGGAGCCTACGTCTGAGACGCCCCATCAGCAAACATCCCATGAACCATCAAAGGGTGTTCCTGATCAGTCGTTAAATCAAGAGACACCTGCCTCTGTGGTGTCCACGCAAGGAGAGGGTTGATAGCTCTTCTTGTAGTTTCTGGATTTATGTTGGTTGGTAGTAAAGACTAGTAGAGGCAAACGCTTAGTTCATGGTGAGGAAGCCAGCAGTGGCAAGACAGTCTTCCAGTTTTCGATGTACCATACATTAGTCAGAGGGTTCAGTGGATAGTCAGTCAGGTTTAGGATTGAAAGGTAGATTCCGGTTTCATTCCAAGCAACCCTGTGGAGGATCTTGCTTCACGATTGTCATCATGAAGCGCTTCATCATCCATCTGCCAACACTGTACAGAAATCTGCCATACTTGGCCAGCTTAGCTTTATTCCCCATGGCGACCAGCTCCAACCATTTTCTTCGATATTTAGACGAAAAAAATCTCATATTCTCGATTGGAAATTCTTTTGTTTCTAACATGAGTGCATGTCACTTGTCTCTAATGTGTCAAATGACATCGTAATGTTTCAGCTCCGTTCCAGGCTGGGGTTATGATGAGCTTATTCTGGTCATTCATTTTCGAATTCAGTGCATGTTGCAACAATCACTTTGATTCATTATCCTTTTTTTACACGCGAGAGGGATGCTCAAGTTCACCGTGGTACTGTGGGCGCGGTGCACGCGACTATGTCCTGTTATGCGACAGTTATTTGTCTACATTCCGCGACTGTTGTCCTGTTATGCGACGGTTGTGTGTCTTCATTCCGTTGTGGAAGGCTGGCAGTTTGTATCTTTCTCATTTTGCGGAGGTCCTGGTATCGGATTGAATCGGCCCTTGCAGCTTCGAAGGATATCTGTTCTTGAGTTTTTTCTCACGCAACCATGGTCATCGAGGGGAAATTCACTTCTATAGGGTGGTTCAAGGAGATTCAGGAAGCATCAACAGGTTTTGTTTGTTGCAGTATCCTCTCAAATGTGGGAATGGTATGTACTTTCTTATTGGACATTTCCCATGATTGTTGTTCATGATTTACCTGAGCATATTTCATCTCAGTAATATCTCTGTAAGATATGTTAGTATGTGTATTGCTTCGTTATTACGTTGTACGCTAGTTCATTTTTGGCGATTCACTTTCACAAATCTACTTCTGTGCAAGACCTCTTCTACGACATTGCAAATCGAATAGATTTTGGATATCAAAAGGTGAAGCAATCTGTACTCAGAGTTTGGGAAATAATGTAACCTTTCGGGGATATTGGGAGCAGTTGCATTTCAGCTAAGGTTGAAGCAAAATCCTCTAGAGGTTATTTTATTTCGAAGGACGCGAAGTATATGTGTGGATATAATTAAGCGATGTATAGCTGTAATTTTACACTGCTAGTGACGGATTCAGGGCCACGTCTGGTATACCAACGGTTCATCCATTAGTGTCGAGTATCTTTCCTTTGTGGTCGAACAGTTTTCCATTGTTCAATGCCGAATATGTAGCGTATGAAGTTGGTCTCTCAGTTACATTCTTATCATTGTGTTCTGAGTTGATACGTCCTTAGTTTAAGTTGCGTGTCCGTGGTTCGTATAGTACGTATAGGCCGAGGTTCTGAACATCGCGACGAAGCGATGGCGCATCAACGTTACTGCGAGATGATTACTAACTGCTACCCAATTCAATTATGCCCAAGTGGGTGCGAGGAATGCCTTGCTTTCTCAAGTCATAGTTCCACTGATCTTGTGATCGATAGAAGAGGCGCGAGCACTGTCATCAATGAAAGGTTTTTTGGGTTGTCAAGCCTTCAGTGAATTTTCTCGCACCTGGGCTGAGTTCTGAGGTTCACTGACTCGCTGCTCATTGCTTCATACCGCTGTTTGCTTATCATGATGCGCTGTATTCTCGTGATCATACAATGATCAAAACATCGATAGTTCTATCGTACAAAAAGTTAATGTTCTTGTATATCTATAATATCAGTGTACAGTAAACAATTTAGTAACAGCTAAATTAACGGGTATTCTTGTGCACACAAGCAGCTTTTCAACATTGTTGAAAATTTACTTTCTGATGATATATTTGGTTACAACAACTTATAGAAAATTCTTACTTCTGCAATTTCAGGGTGTAATGCTATGGATCTTGAATTTGGACTATTAATACTGGCGGGTAACCTTTTTTATTTCACTATGGATGTTTTGACTGCAGAGTATACTACTATGTACCCATATTCCTGTCGCTCATTATTGTTGACGGAGACAAGCATTTGTTGCTCTTCCAAATCTCGGCTTCGCAAGAATTCATATATATAACTCTGTACGTTGATTAGAGATACAGTTGAATGCTTGTGTTTTGATGACAGCAAATGAACTCCAGGTATTGCAGTTCACTCTTCTGCATGTCGTACAAGCAACATTGTGATTGGAGGTCATCCCAAACCTGGTTCCTGACGTCGTCTTGAGCTATGTTCTTGGCGGTGCTACGGTTGTTCTACTTACGAATCTTTCTCTGCAAACGTAACTTTCATCCATATTTTTTTTTACAGGTTTAATAGTACTCTGATGTTCTACCTTAAAGTTGTTCTGTTCAACCCTCTTACTTTCCATAGACATGATGTAAGTTCTGAGACATCATGTTGTATGTTTTATGCTAAAATGTTGTGCGTTTAATTGTGCTAACGTCTTGCGCGCTCGCCGCGTTGCAGACCGGATTGGTATGGCTGTAATAAATGAACATCGTTGTGAAGCTACTAGGTACAGACGTATTTACAGTTTGGATACAATTGAAAGAACTGTGCAAGAAAATTGCACAAAGCTTATAATTAGTTCAAAAAGTGGTAGATCTGTTATCTCGGAACATCACTTTCCAGGAATAAGACTTGTCTGTTAAATACTCATGATTGTCATCCAAATGCCCCACATTATGATAAATAAAGTTAATGAACGATGAACGAAAAAAAACGTTCAATATTGATCGCGA

mRNA

>Mapoly0043s0128.3
TTTCTCATGCCTTTTCGAACTTGCGTTTCTCAAAGGGAGGGAAGCCCGAAAGAAGCTCAATACTACAAACATTTCTTCAATTTTGGTTCAGACGGTGGTTTCATGTGGCGCTCCCCGCAAGCGTTGCGACGTCTTTCGGGTGTGTTGATACTTTTTGCATTCTGCACATTGTAAGGTCAGGAAAGGCCGCTTGTCGAGTAAGCTGAGGGATTTCAGGCTAAAAGTGCAATACTTCAAACGATATTTGCGATCCAATCAGACTCACAGAGCTTGAAGACTTGTGGTGCCCAAGGGGCGTCACAATTTATGGAGAAGTGATGGAAAATTATTGGCTCATTTCTGAGTCTATGCGGATTATTGGAGTGTGCAGGTTCTCTTATGCTTGATACCAATTGCTGAAGAGGTTGCGATTTCAAAATGGCGACCGAAGCGGCTGTAGCAAATGTGCCACCTTCGGTACAAACACCAGCTAAAAATGCTGACACTGTAATGGTGGACGCGAAGGAGAGCCCTGTGGCTGTTCTCAGTACGCCTGCTCCTGTAACGACCAGTCAAGTCGCACCAACTCCTCAAGTTGCCACCCCTCAGACGCTCGTTCCTGCAATCAACCAGCAAGAATATCCAGCTGCTGTCGCCTCTAACGAGGCAGTTATAAGTGATGAGAGACTTTTTATGGATTCTTTCTACAAATTCCACGAAGCTTTGAAGTCGAAGCCAACGATTCCGAAAATGGGCGGGAAAGACTTGAACGTACACCTTCTGTACAAAGAAGTAACAGCTCGTGGAGGCTTGCAACAGGTCATCAGAGACAGGAAGTGGAAGGAAATCACAGGTGCTTTTGAGTTTCCTCGCACTACAACTAGTGCGTCATATGTCCTTCGGAAGTACTATGTAAATTTGCTGCATCATTTTGAACAAGTTTACAAGAACGGAGCCAAAGGACCTCTTATTCCTCCACCAGCAACTTTACCTGGGTCAAGCCCGTCTGTCCAACCTGGTGGTGATCCAGCACTTTCAGAGGGTGGTGATCAAGTCACCAAAAAAAGACCAAGAAAGCGGAAGATACAAATGCCGCTCATTCCTCAAGTGGACCCCGCGGAGGCTATTGGAACGTCATGCAAGGGCTCAATTGAGGCAAAACTTGACTTTGGATACTTGATTACAATGGTTGTCGGTGGAGAGAAGCTCAAAGGTGTTCTGTATCACGTTCCCACCGGAGTGAAAGTCCCATCTCAGTTCACGAATCTTCCAACCCTGCTGGCCAGTGTTAACGTGGACGCCGCAAAGACCACTGTGGAGAGCACCGCTCGTCGCAAAAGAAGGAGAAAGGAGGAGATGCCAAAGAAGGACCCAAATGCTCCGAGGCCAAACCGGACAGGGTACAATTTCTTTTTCGCTGAACAACGTCAGCGATTGAAGGCTCTGCATCCTGATAAGGATCGAGATATCAGTCGAATGATAGGCGAAGCTTGGAACAGTCTTTCTGAGGAGCAAAAAACGCCCTACCAAGAACGAGGTGTGAAAGACAAGGAGAGATTCAAAAGGGAGATGCGTGATTATCGGGAGAAGATGAAAAGCGGCCACTTTGATAGTGCTGCTGACCTTGGTACAGGGCAGACTGTGACTTCTCCAGAAGATCCCAGTGTTCCTGACCAACCCCTTGAGCAAGATCATGGAAATGCAATGGGGGATGATACTCCTCCCACGGGGGAGCCTACGTCTGAGACGCCCCATCAGCAAACATCCCATGAACCATCAAAGGGTGTTCCTGATCAGTCGTTAAATCAAGAGACACCTGCCTCTGTGGTGTCCACGCAAGGAGAGGGTTGATAGCTCTTCTTGTAGTTTCTGGATTTATGTTGGTTGGTAGTAAAGACTAGTAGAGGCAAACGCTTAGTTCATGGTGAGGAAGCCAGCAGTGGCAAGACAGTCTTCCAGTTTTCGATGTACCATACATTAGTCAGAGGGTTCAGTGGATAGTCAGTCAGGTTTAGGATTGAAAGGTAGATTCCGGTTTCATTCCAAGCAACCCTGTGGAGGATCTTGCTTCACGATTGTCATCATGAAGCGCTTCATCATCCATCTGCCAACACTGTACAGAAATCTGCCATACTTGGCCAGCTTAGCTTTATTCCCCATGGCGACCAGCTCCAACCATTTTCTTCGATATTTAGACGAAAAAAATCTCATATTCTCGATTGGAAATTCTTTTGTTTCTAACATGAGTGCATGTCACTTGTCTCTAATGTGTCAAATGACATCGTAATGTTTCAGCTCCGTTCCAGGCTGGGGTTATGATGAGCTTATTCTGGTCATTCATTTTCGAATTCAGTGCATGTTGCAACAATCACTTTGATTCATTATCCTTTTTTTACACGCGAGAGGGATGCTCAAGTTCACCGTGGTACTGTGGGCGCGGTGCACGCGACTATGTCCTGTTATGCGACAGTTATTTGTCTACATTCCGCGACTGTTGTCCTGTTATGCGACGGTTGTGTGTCTTCATTCCGTTGTGGAAGGCTGGCAGTTTGTATCTTTCTCATTTTGCGGAGGTCCTGGTATCGGATTGAATCGGCCCTTGCAGCTTCGAAGGATATCTGTTCTTGAGTTTTTTCTCACGCAACCATGGTCATCGAGGGGAAATTCACTTCTATAGGGTGGTTCAAGGAGATTCAGGAAGCATCAACAGGTTTTGTTTGTTGCAGTATCCTCTCAAATGTGGGAATGGTATTGCAGTTCACTCTTCTGCATGTCGTACAAGCAACATTGTGATTGGAGGTCATCCCAAACCTGGTTCCTGACGTCGTCTTGAGCTATGTTCTTGGCGGTGCTACGGTTGTTCTACTTACGAATCTTTCTCTGCAAACGTAACTTTCATCCATATTTTTTTTTACAGGTTTAATAGTACTCTGATGTTCTACCTTAAAGTTGTTCTGTTCAACCCTCTTACTTTCCATAGACATGATGTAAGTTCTGAGACATCATGTTGTATGTTTTATGCTAAAATGTTGTGCGTTTAATTGTGCTAACGTCTTGCGCGCTCGCCGCGTTGCAGACCGGATTGGTATGGCTGTAATAAATGAACATCGTTGTGAAGCTACTAGGTACAGACGTATTTACAGTTTGGATACAATTGAAAGAACTGTGCAAGAAAATTGCACAAAGCTTATAATTAGTTCAAAAAGTGGTAGATCTGTTATCTCGGAACATCACTTTCCAGGAATAAGACTTGTCTGTTAAATACTCATGATTGTCATCCAAATGCCCCACATTATGATAAATAAAGTTAATGAACGATGAACGAAAAAAAACGTTCAATATTGATCGCGA

CDS

>Mapoly0043s0128.3
ATGGCGACCGAAGCGGCTGTAGCAAATGTGCCACCTTCGGTACAAACACCAGCTAAAAATGCTGACACTGTAATGGTGGACGCGAAGGAGAGCCCTGTGGCTGTTCTCAGTACGCCTGCTCCTGTAACGACCAGTCAAGTCGCACCAACTCCTCAAGTTGCCACCCCTCAGACGCTCGTTCCTGCAATCAACCAGCAAGAATATCCAGCTGCTGTCGCCTCTAACGAGGCAGTTATAAGTGATGAGAGACTTTTTATGGATTCTTTCTACAAATTCCACGAAGCTTTGAAGTCGAAGCCAACGATTCCGAAAATGGGCGGGAAAGACTTGAACGTACACCTTCTGTACAAAGAAGTAACAGCTCGTGGAGGCTTGCAACAGGTCATCAGAGACAGGAAGTGGAAGGAAATCACAGGTGCTTTTGAGTTTCCTCGCACTACAACTAGTGCGTCATATGTCCTTCGGAAGTACTATGTAAATTTGCTGCATCATTTTGAACAAGTTTACAAGAACGGAGCCAAAGGACCTCTTATTCCTCCACCAGCAACTTTACCTGGGTCAAGCCCGTCTGTCCAACCTGGTGGTGATCCAGCACTTTCAGAGGGTGGTGATCAAGTCACCAAAAAAAGACCAAGAAAGCGGAAGATACAAATGCCGCTCATTCCTCAAGTGGACCCCGCGGAGGCTATTGGAACGTCATGCAAGGGCTCAATTGAGGCAAAACTTGACTTTGGATACTTGATTACAATGGTTGTCGGTGGAGAGAAGCTCAAAGGTGTTCTGTATCACGTTCCCACCGGAGTGAAAGTCCCATCTCAGTTCACGAATCTTCCAACCCTGCTGGCCAGTGTTAACGTGGACGCCGCAAAGACCACTGTGGAGAGCACCGCTCGTCGCAAAAGAAGGAGAAAGGAGGAGATGCCAAAGAAGGACCCAAATGCTCCGAGGCCAAACCGGACAGGGTACAATTTCTTTTTCGCTGAACAACGTCAGCGATTGAAGGCTCTGCATCCTGATAAGGATCGAGATATCAGTCGAATGATAGGCGAAGCTTGGAACAGTCTTTCTGAGGAGCAAAAAACGCCCTACCAAGAACGAGGTGTGAAAGACAAGGAGAGATTCAAAAGGGAGATGCGTGATTATCGGGAGAAGATGAAAAGCGGCCACTTTGATAGTGCTGCTGACCTTGGTACAGGGCAGACTGTGACTTCTCCAGAAGATCCCAGTGTTCCTGACCAACCCCTTGAGCAAGATCATGGAAATGCAATGGGGGATGATACTCCTCCCACGGGGGAGCCTACGTCTGAGACGCCCCATCAGCAAACATCCCATGAACCATCAAAGGGTGTTCCTGATCAGTCGTTAAATCAAGAGACACCTGCCTCTGTGGTGTCCACGCAAGGAGAGGGTTGA

Protein

>Mapoly0043s0128.3
MATEAAVANVPPSVQTPAKNADTVMVDAKESPVAVLSTPAPVTTSQVAPTPQVATPQTLVPAINQQEYPAAVASNEAVISDERLFMDSFYKFHEALKSKPTIPKMGGKDLNVHLLYKEVTARGGLQQVIRDRKWKEITGAFEFPRTTTSASYVLRKYYVNLLHHFEQVYKNGAKGPLIPPPATLPGSSPSVQPGGDPALSEGGDQVTKKRPRKRKIQMPLIPQVDPAEAIGTSCKGSIEAKLDFGYLITMVVGGEKLKGVLYHVPTGVKVPSQFTNLPTLLASVNVDAAKTTVESTARRKRRRKEEMPKKDPNAPRPNRTGYNFFFAEQRQRLKALHPDKDRDISRMIGEAWNSLSEEQKTPYQERGVKDKERFKREMRDYREKMKSGHFDSAADLGTGQTVTSPEDPSVPDQPLEQDHGNAMGDDTPPTGEPTSETPHQQTSHEPSKGVPDQSLNQETPASVVSTQGEG

Mapoly0043s0128.4  

Gene structure:

mRNA scaffold_43:1235158..1240577  ( - strand )
three_prime_UTR scaffold_43:1235158..1236139  ( - strand )
CDS scaffold_43:1236140..1236469  ( - strand )
CDS scaffold_43:1237404..1237816  ( - strand )
CDS scaffold_43:1237990..1238115  ( - strand )
CDS scaffold_43:1238551..1238713  ( - strand )
CDS scaffold_43:1238906..1238984  ( - strand )
CDS scaffold_43:1239078..1239379  ( - strand )
five_prime_UTR scaffold_43:1239380..1239426  ( - strand )
five_prime_UTR scaffold_43:1240423..1240577  ( - strand )

Sequences:

Gene

>Mapoly0043s0128.4
GCTTTTCGGAGGATTATTTCTCATGCCTTTTCGAACTTGCGTTTCTCAAAGGGAGGGAAGCCCGAAAGAAGCTCAATACTACAAACATTTCTTCAATTTTGGTTCAGACGGTGGTTTCATGTGGCGCTCCCCGCAAGCGTTGCGACGTCTTTCGGGTATTGTTTAATATTTTCTTCAGGCTTACCTGTAGGCAGGAGAAATTTGGTGTTTTCGGTGTTTGGGCAGAGTTGCGTCTCCGAGATTTTTCATCTCAGGAAAATTATGATTGACGATAGGAAATGTGATACGCGCACGTCTTTATCAGTGGGATCCGAAGCTTTGTGCGTCGAGGTTGGGAGATTTATCTGTACTCCTGTGATGAATGAATCATGTCGTCGTCTAGGAGATTGAAATCCGCTCGGAATTTCGCTTTATACAGAACCTGTCATGGTGCCTCTAGTTTCCTGCGAGCGTGGGAGGTCCGAGCTCGTGCTTGTTGTCTGTGAAGAGATAGCTTTGCTGATCGTACAGGAGTGACCTGTGCTATGTCCTCTTGGTTAGACACACTTCTGTACCAGAAAACACCCTGGAGGGTTTTTTTTTGGGTTGGTTTTTTAGCATCTCAATTGCGCAGTCATGCTCTATCTCTAAGAGCTGGAATGATGCGAAAGTCAGAAGTGACTTTCGACTTACGTATGCTTACATGGCTTTCGACTTACGTGAAGGCATGGGAAAAGCATCTGAATTATCCACGTTATATTTTTATGTATTTTACTTCGCTTCTGCATATGACCTTCTCACACAAGGAATGTGTGATAGGAGGCCCTTCATGAATTTTGCGAAGTCAGTTCAATAACCTCGAGCTTTCTTTCGCGCGGAAAGCCCGTCCTTCTGTATTTTATCAGGCGATGTTGAAGGTTAGGGATGTTGGGTGTCTGCAGGTGTGTTGATACTTTTTGCATTCTGCACATTGTAAGGTCAGGAAAGGCCGCTTGTCGAGTAAGCTGAGGGATTTCAGGCTAAAAGTGCAATACTTCAAACGATATTTGCGATCCAATCAGACTCACAGAGCTTGAAGACTTGTGGTGCCCAAGGGGCGTCACAATTTATGGAGAAGTGATGGAAAATTATTGGCTCATTTCTGAGTCTATGCGGATTATTGGAGTGTGCAGGTTCTCTTATGCTTGATACCAATTGCTGAAGAGGTTGCGATTTCAAAATGGCGACCGAAGCGGCTGTAGCAAATGTGCCACCTTCGGTACAAACACCAGCTAAAAATGCTGACACTGTAATGGTGGACGCGAAGGAGAGCCCTGTGGCTGTTCTCAGTACGCCTGCTCCTGTAACGACCAGTCAAGTCGCACCAACTCCTCAAGTTGCCACCCCTCAGACGCTCGTTCCTGCAATCAACCAGCAAGAATATCCAGCTGCTGTCGCCTCTAACGAGGCAGTTATAAGTGATGAGAGACTTTTTATGGATTCTTTCTACAAATTCCACGAAGCTTTGAAGTCGAAGCCAACGTAAGTTTTGAAACTTGACAGTGGAATCGCATTTCTGTTGACTTAAGCTGCCAAAAGTTTCATGATTGAATAGACGGAGTTGCTTTTGGGCAGGATTCCGAAAATGGGCGGGAAAGACTTGAACGTACACCTTCTGTACAAAGAAGTAACAGCTCGTGGAGGCTTGCAACAGGTCTGTCCAATGTATATAATGTCACGTGTTACATTTTGCACGAGTTATATAGTCATCAAGTGGTGCGAGTTCTTGACAAGTGTAAAGTCTCGAAGTAAAGTCACTTTCAGTGAAGTTCATTTTAATGTTCGCTTGCACTGCTCAGTTCTTGACCTCGTTATCGTATGCTATTGCCACTCTGATATCCGTAAGGTCATCAGAGACAGGAAGTGGAAGGAAATCACAGGTGCTTTTGAGTTTCCTCGCACTACAACTAGTGCGTCATATGTCCTTCGGAAGTACTATGTAAATTTGCTGCATCATTTTGAACAAGTTTACAAGAACGGAGCCAAAGGACCTCTTATTCCTCCACCAGGTATGAGTTTTTCACAGTAGGGCATTCTTCCAGATCAGTGACGTGTTGAAGGGCATTTTGAAGTTGTATCCTTGTTGAACCTCTTTGGTTTTTTGTTCTCCTCTAGCCAAGAAATTTTGTTTCACACGGCTGTGGGTTGGCCGAGAACGTACTTACGATTTTATCTTGCTTCGGAGTGAACTTTTTTCATATACATATTGAACTTTTATTTCTTCTAAAAGACTCGCTTATTTCCGTGTCCTCTCATGAGAACAGAAAATATCACTACCGCATGTCTGAAAGAAGACATTTGCAGTTGGAGATTCTGCTACTTTCTGGAGCTTTGGTACCTTGTTTGATCAGAACTAGATGTGCAAATTCGTAGGTGGGAATGAGGTGTTGGTTGCTCTTATGTTAGCAAAGCTGATGAGGAGTAATCAATTAATTACCATGCAGCAACTTTACCTGGGTCAAGCCCGTCTGTCCAACCTGGTGGTGATCCAGCACTTTCAGAGGGTGGTGATCAAGTCACCAAAAAAAGACCAAGAAAGCGGAAGATACAAATGCCGCTCATTCCTCAAGGTTTGCCTCGGATATTTGACTAGAGACAAACGTTTCAAGTAACATGTTGTCTACCTATAACAGAGGTTTTTTTTAAAAAAATTACATATTTCTCTCTTTCTGTTCTTCTCTACGTCTTCATTAGCTATTTCTCTCTTTTTTAGTACATAATTCGAGATTTCTGTTTATTGCAGTGGACCCCGCGGAGGCTATTGGAACGTCATGCAAGGGCTCAATTGAGGCAAAACTTGACTTTGGATACTTGATTACAATGGTTGTCGGTGGAGAGAAGCTCAAAGGTGTTCTGTATCACGTTCCCACCGGAGTGAAAGTCCCATCTCAGTTCACGAATCTTCCAACCCTGCTGGCCAGTGTTAACGTGGACGCCGCAAAGACCACTGTGGAGAGCACCGCTCGTCGCAAAAGAAGGAGAAAGGAGGAGATGCCAAAGAAGGACCCAAATGCTCCGAGGCCAAACCGGACAGGGTACAATTTCTTTTTCGCTGAACAACGTCAGCGATTGAAGGCTCTGCATCCTGATAAGGATCGAGATATCAGTCGAATGATAGGCGAAGCTTGGAACAGTCTTTCTGAGGAGCAAAAAACGGTGAGTCAAACAGGGCATTTAATGGGCATAGTAAAACCCGGTTATGGCTCAAAAGCTGACAATGTCATGTATGTTGTCAGAGTTGAACTTGAAGCATGACGATGTGCTTTTCCAAATGTCATCCAAAATCGTTTTGTCATGTTCTTAATTTGCTTTTGAACTGGGACAGATACGTCCCATGTGTGTGCAAGATGGAAAGCAAGATGCAACATCCTACTTTGAGAGCTTGTGAGATGAAATTGATCGTCTGCTGTCTCCTGCCATTCTTAAAAGTATGTCCAGGGGATAAATTTAAACTAAAGCTCTTGCTTTAAGATATGTTGCTATTCTACTTTACCTCTGTCTGATGTTCCCTTCAAGTCTATCATTAGACTTGAAGTCTAATACTTTTTCCTTTAGAGCTTGAAAAGGTAAGACGGCAATATCTGGACCCAATGTCAATGTTGCACTCGGAACCTTTGATGTGAATCACACTGATATCTACATGTGATGAGGTATACTTGTGAGAATCATCGTCCGCTTATACAGACTTAAGCGAAGGAGGGTCAAAATGGGACCTAGACTTGCTATTCACTTTCAAAGAGTACCAGTCACACGCAAGGTCGACTCTCTTGGTTGCCTACGTAAACTGCCGAAAGTGAATAGCAAGTTTTAGTGTTTTTTTGGGGGATTATTTAGTTTTACCTTCAACATTGATGTGTTTTCCTAATTATTCGGAGTAAATTTGGGAGATGAGCCCTCCTTGAACAGATCCTACAAGATGAAGCTCTCCATCTCCGATGTGGTCTACTATGCCCGCTAAATGCCCTGTTTGGGAACTTCCACAAAATCAGTTGAGAATGTCTTTGGCTGCTAAAATAGTGTGTTTTTGCCACGATGTCTATAGGTCCCGATTTTGTAGCTCAGGAGTTCTGAACGTTCCATTTGCATGCAGCCCTACCAAGAACGAGGTGTGAAAGACAAGGAGAGATTCAAAAGGGAGATGCGTGATTATCGGGAGAAGATGAAAAGCGGCCACTTTGATAGTGCTGCTGACCTTGGTACAGGGCAGACTGTGACTTCTCCAGAAGATCCCAGTGTTCCTGACCAACCCCTTGAGCAAGATCATGGAAATGCAATGGGGGATGATACTCCTCCCACGGGGGAGCCTACGTCTGAGACGCCCCATCAGCAAACATCCCATGAACCATCAAAGGGTGTTCCTGATCAGTCGTTAAATCAAGAGACACCTGCCTCTGTGGTGTCCACGCAAGGAGAGGGTTGATAGCTCTTCTTGTAGTTTCTGGATTTATGTTGGTTGGTAGTAAAGACTAGTAGAGGCAAACGCTTAGTTCATGGTGAGGAAGCCAGCAGTGGCAAGACAGTCTTCCAGTTTTCGATGTACCATACATTAGTCAGAGGGTTCAGTGGATAGTCAGTCAGGTTTAGGATTGAAAGGTAGATTCCGGTTTCATTCCAAGCAACCCTGTGGAGGATCTTGCTTCACGATTGTCATCATGAAGCGCTTCATCATCCATCTGCCAACACTGTACAGAAATCTGCCATACTTGGCCAGCTTAGCTTTATTCCCCATGGCGACCAGCTCCAACCATTTTCTTCGATATTTAGACGAAAAAAATCTCATATTCTCGATTGGAAATTCTTTTGTTTCTAACATGAGTGCATGTCACTTGTCTCTAATGTGTCAAATGACATCGTAATGTTTCAGCTCCGTTCCAGGCTGGGGTTATGATGAGCTTATTCTGGTCATTCATTTTCGAATTCAGTGCATGTTGCAACAATCACTTTGATTCATTATCCTTTTTTTACACGCGAGAGGGATGCTCAAGTTCACCGTGGTACTGTGGGCGCGGTGCACGCGACTATGTCCTGTTATGCGACAGTTATTTGTCTACATTCCGCGACTGTTGTCCTGTTATGCGACGGTTGTGTGTCTTCATTCCGTTGTGGAAGGCTGGCAGTTTGTATCTTTCTCATTTTGCGGAGGTCCTGGTATCGGATTGAATCGGCCCTTGCAGCTTCGAAGGATATCTGTTCTTGAGTTTTTTCTCACGCAACCATGGTCATCGAGGGGAAATTCACTTCTATAGGGTGGTTCAAGGAGATTCAGGAAGCATCAACAGGTTTTGTTTGTTGCAGTATCCTCTCAAATGTGGGAATGGTATGTACTTTCTTATTGGACATTTCCCATGATTGTTGTTCATGATTTACCTGAGCATATTTCATCTCAGTAATATCTCTGTAAG

mRNA

>Mapoly0043s0128.4
GCTTTTCGGAGGATTATTTCTCATGCCTTTTCGAACTTGCGTTTCTCAAAGGGAGGGAAGCCCGAAAGAAGCTCAATACTACAAACATTTCTTCAATTTTGGTTCAGACGGTGGTTTCATGTGGCGCTCCCCGCAAGCGTTGCGACGTCTTTCGGGTTCTCTTATGCTTGATACCAATTGCTGAAGAGGTTGCGATTTCAAAATGGCGACCGAAGCGGCTGTAGCAAATGTGCCACCTTCGGTACAAACACCAGCTAAAAATGCTGACACTGTAATGGTGGACGCGAAGGAGAGCCCTGTGGCTGTTCTCAGTACGCCTGCTCCTGTAACGACCAGTCAAGTCGCACCAACTCCTCAAGTTGCCACCCCTCAGACGCTCGTTCCTGCAATCAACCAGCAAGAATATCCAGCTGCTGTCGCCTCTAACGAGGCAGTTATAAGTGATGAGAGACTTTTTATGGATTCTTTCTACAAATTCCACGAAGCTTTGAAGTCGAAGCCAACGATTCCGAAAATGGGCGGGAAAGACTTGAACGTACACCTTCTGTACAAAGAAGTAACAGCTCGTGGAGGCTTGCAACAGGTCATCAGAGACAGGAAGTGGAAGGAAATCACAGGTGCTTTTGAGTTTCCTCGCACTACAACTAGTGCGTCATATGTCCTTCGGAAGTACTATGTAAATTTGCTGCATCATTTTGAACAAGTTTACAAGAACGGAGCCAAAGGACCTCTTATTCCTCCACCAGCAACTTTACCTGGGTCAAGCCCGTCTGTCCAACCTGGTGGTGATCCAGCACTTTCAGAGGGTGGTGATCAAGTCACCAAAAAAAGACCAAGAAAGCGGAAGATACAAATGCCGCTCATTCCTCAAGTGGACCCCGCGGAGGCTATTGGAACGTCATGCAAGGGCTCAATTGAGGCAAAACTTGACTTTGGATACTTGATTACAATGGTTGTCGGTGGAGAGAAGCTCAAAGGTGTTCTGTATCACGTTCCCACCGGAGTGAAAGTCCCATCTCAGTTCACGAATCTTCCAACCCTGCTGGCCAGTGTTAACGTGGACGCCGCAAAGACCACTGTGGAGAGCACCGCTCGTCGCAAAAGAAGGAGAAAGGAGGAGATGCCAAAGAAGGACCCAAATGCTCCGAGGCCAAACCGGACAGGGTACAATTTCTTTTTCGCTGAACAACGTCAGCGATTGAAGGCTCTGCATCCTGATAAGGATCGAGATATCAGTCGAATGATAGGCGAAGCTTGGAACAGTCTTTCTGAGGAGCAAAAAACGCCCTACCAAGAACGAGGTGTGAAAGACAAGGAGAGATTCAAAAGGGAGATGCGTGATTATCGGGAGAAGATGAAAAGCGGCCACTTTGATAGTGCTGCTGACCTTGGTACAGGGCAGACTGTGACTTCTCCAGAAGATCCCAGTGTTCCTGACCAACCCCTTGAGCAAGATCATGGAAATGCAATGGGGGATGATACTCCTCCCACGGGGGAGCCTACGTCTGAGACGCCCCATCAGCAAACATCCCATGAACCATCAAAGGGTGTTCCTGATCAGTCGTTAAATCAAGAGACACCTGCCTCTGTGGTGTCCACGCAAGGAGAGGGTTGATAGCTCTTCTTGTAGTTTCTGGATTTATGTTGGTTGGTAGTAAAGACTAGTAGAGGCAAACGCTTAGTTCATGGTGAGGAAGCCAGCAGTGGCAAGACAGTCTTCCAGTTTTCGATGTACCATACATTAGTCAGAGGGTTCAGTGGATAGTCAGTCAGGTTTAGGATTGAAAGGTAGATTCCGGTTTCATTCCAAGCAACCCTGTGGAGGATCTTGCTTCACGATTGTCATCATGAAGCGCTTCATCATCCATCTGCCAACACTGTACAGAAATCTGCCATACTTGGCCAGCTTAGCTTTATTCCCCATGGCGACCAGCTCCAACCATTTTCTTCGATATTTAGACGAAAAAAATCTCATATTCTCGATTGGAAATTCTTTTGTTTCTAACATGAGTGCATGTCACTTGTCTCTAATGTGTCAAATGACATCGTAATGTTTCAGCTCCGTTCCAGGCTGGGGTTATGATGAGCTTATTCTGGTCATTCATTTTCGAATTCAGTGCATGTTGCAACAATCACTTTGATTCATTATCCTTTTTTTACACGCGAGAGGGATGCTCAAGTTCACCGTGGTACTGTGGGCGCGGTGCACGCGACTATGTCCTGTTATGCGACAGTTATTTGTCTACATTCCGCGACTGTTGTCCTGTTATGCGACGGTTGTGTGTCTTCATTCCGTTGTGGAAGGCTGGCAGTTTGTATCTTTCTCATTTTGCGGAGGTCCTGGTATCGGATTGAATCGGCCCTTGCAGCTTCGAAGGATATCTGTTCTTGAGTTTTTTCTCACGCAACCATGGTCATCGAGGGGAAATTCACTTCTATAGGGTGGTTCAAGGAGATTCAGGAAGCATCAACAGGTTTTGTTTGTTGCAGTATCCTCTCAAATGTGGGAATGGTATGTACTTTCTTATTGGACATTTCCCATGATTGTTGTTCATGATTTACCTGAGCATATTTCATCTCAGTAATATCTCTGTAAG

CDS

>Mapoly0043s0128.4
ATGGCGACCGAAGCGGCTGTAGCAAATGTGCCACCTTCGGTACAAACACCAGCTAAAAATGCTGACACTGTAATGGTGGACGCGAAGGAGAGCCCTGTGGCTGTTCTCAGTACGCCTGCTCCTGTAACGACCAGTCAAGTCGCACCAACTCCTCAAGTTGCCACCCCTCAGACGCTCGTTCCTGCAATCAACCAGCAAGAATATCCAGCTGCTGTCGCCTCTAACGAGGCAGTTATAAGTGATGAGAGACTTTTTATGGATTCTTTCTACAAATTCCACGAAGCTTTGAAGTCGAAGCCAACGATTCCGAAAATGGGCGGGAAAGACTTGAACGTACACCTTCTGTACAAAGAAGTAACAGCTCGTGGAGGCTTGCAACAGGTCATCAGAGACAGGAAGTGGAAGGAAATCACAGGTGCTTTTGAGTTTCCTCGCACTACAACTAGTGCGTCATATGTCCTTCGGAAGTACTATGTAAATTTGCTGCATCATTTTGAACAAGTTTACAAGAACGGAGCCAAAGGACCTCTTATTCCTCCACCAGCAACTTTACCTGGGTCAAGCCCGTCTGTCCAACCTGGTGGTGATCCAGCACTTTCAGAGGGTGGTGATCAAGTCACCAAAAAAAGACCAAGAAAGCGGAAGATACAAATGCCGCTCATTCCTCAAGTGGACCCCGCGGAGGCTATTGGAACGTCATGCAAGGGCTCAATTGAGGCAAAACTTGACTTTGGATACTTGATTACAATGGTTGTCGGTGGAGAGAAGCTCAAAGGTGTTCTGTATCACGTTCCCACCGGAGTGAAAGTCCCATCTCAGTTCACGAATCTTCCAACCCTGCTGGCCAGTGTTAACGTGGACGCCGCAAAGACCACTGTGGAGAGCACCGCTCGTCGCAAAAGAAGGAGAAAGGAGGAGATGCCAAAGAAGGACCCAAATGCTCCGAGGCCAAACCGGACAGGGTACAATTTCTTTTTCGCTGAACAACGTCAGCGATTGAAGGCTCTGCATCCTGATAAGGATCGAGATATCAGTCGAATGATAGGCGAAGCTTGGAACAGTCTTTCTGAGGAGCAAAAAACGCCCTACCAAGAACGAGGTGTGAAAGACAAGGAGAGATTCAAAAGGGAGATGCGTGATTATCGGGAGAAGATGAAAAGCGGCCACTTTGATAGTGCTGCTGACCTTGGTACAGGGCAGACTGTGACTTCTCCAGAAGATCCCAGTGTTCCTGACCAACCCCTTGAGCAAGATCATGGAAATGCAATGGGGGATGATACTCCTCCCACGGGGGAGCCTACGTCTGAGACGCCCCATCAGCAAACATCCCATGAACCATCAAAGGGTGTTCCTGATCAGTCGTTAAATCAAGAGACACCTGCCTCTGTGGTGTCCACGCAAGGAGAGGGTTGA

Protein

>Mapoly0043s0128.4
MATEAAVANVPPSVQTPAKNADTVMVDAKESPVAVLSTPAPVTTSQVAPTPQVATPQTLVPAINQQEYPAAVASNEAVISDERLFMDSFYKFHEALKSKPTIPKMGGKDLNVHLLYKEVTARGGLQQVIRDRKWKEITGAFEFPRTTTSASYVLRKYYVNLLHHFEQVYKNGAKGPLIPPPATLPGSSPSVQPGGDPALSEGGDQVTKKRPRKRKIQMPLIPQVDPAEAIGTSCKGSIEAKLDFGYLITMVVGGEKLKGVLYHVPTGVKVPSQFTNLPTLLASVNVDAAKTTVESTARRKRRRKEEMPKKDPNAPRPNRTGYNFFFAEQRQRLKALHPDKDRDISRMIGEAWNSLSEEQKTPYQERGVKDKERFKREMRDYREKMKSGHFDSAADLGTGQTVTSPEDPSVPDQPLEQDHGNAMGDDTPPTGEPTSETPHQQTSHEPSKGVPDQSLNQETPASVVSTQGEG

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>