Mapoly0045s0043



Description

(UnKnown)

Reference DB

Database ID Description

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB13 transcription factor, MYB Mapoly0045s0043.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0045s0043.1 scaffold_45:392492..397907  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0045s0043.1  

Gene structure:

mRNA scaffold_45:392492..397907  ( - strand )
three_prime_UTR scaffold_45:392492..393056  ( - strand )
CDS scaffold_45:393057..396236  ( - strand )
CDS scaffold_45:396377..397285  ( - strand )
five_prime_UTR scaffold_45:397286..397552  ( - strand )
five_prime_UTR scaffold_45:397693..397907  ( - strand )

Sequences:

Gene

>Mapoly0045s0043.1
CACCCGAGAGCTTCCAGCTTCGCTTTGACTCCCGTCTACTGCAGCTGGAGCTTAACTGCGTGCTGGACTCGAACGACCAGAACTTGTTCTGCTTTGAGGAATTCAGCAGGGAAGGGAGGAGCAGGAGAGGAGGGGAGGACAGGAGTAGAAAGAGGAGCATTCGCAGAAGAGAGGAGTGGTAAGAGAAGAGGTGAACAGGAGAGAAGAGAGAAGAGGTGGGTGGATGGTGGCGGATTTTGTGAATTCACTGTCTTCTGTTTCTGGAAGATAGCATTCTTTGAAGATCGTCATTTCTTGAGGATGGAAGGTGCATACGTTCAAAATTAATCTCTGTGTATCTTGGTTGCGATTGCAGGCTGCTGGTGTGTGGTCATCAACGAAGGAGGATCGAATACCTCGACAGGCCAGCAGACCAGACGCGGAATGATACGATCTGCTGCCAATTCTCGATAGACTGCCTTTCGTTTCGTTTTTTGAGTGAGCGATTTCGGACCAGAAAACCGGAATGATCGAGGACCAGGACAAGATCTGGAGAGACTGGGGTTCTTTGCCTTTCATCCTGGGAATCGCAAGGAAGAGGAGGTGTAGATAAGGAAGCGATTTTGTGCTAGCTTGAGGAACCATGGAGACATCCGTGCCCAAAAACCGGGCCAAGGCGAAGCTTGGTAACAAGTATCAAGCGGAGATTCCTAGTTGTAAATCCAGTAGTCGGATTAGAGCTTGTGATTATAACACCAGAGGTCATTTATTTGCCAATGGACTTGAAGTTCCCGTCACCCGCATTGCAGTGGATTCACAATCCGCCAGCAAGAACCGAAATCTCCATACCAATCAAGCAAGTTGTAGTTTCATGTCAGCTGTCAACTCATCACGGTCTGCTGATACACAGGAGCCTCATGTCAGCAACACAACCACAATGGACATTCATGGACGAGGAGATAATGGCAAAGATGTTAACTCTTGTGCCTCTTCATCGAGGGAAGCGTTCACCTGGAATAGAGACTGCGCTACTACTGAAGACGGGTGTCAAGGTGCAGATGAGGAGGAAGGACAAGCTGTGAGCATTCATCCGAAGAAGAGGAAGAAGAAACGGAGTTGTAAGAGAAATTCCTGGCAGCCGAAGAGGAGGGTCACCAAAAAGGCTCGATTGGAAATAAATTCTGCACATTGCTTAGAAGACGAGGAAGTAGAGGAGGATTCGGACTGCAACCGGGATTTTGTTCCTGGTTCTAGACCGGAATCGTGGGGCAACAAGGAAGTCTCGTCTTTCAAACTCGCCATTTTCCTTTTTGGAAGAAGCTTCTCTGACATTTCCAAGTTCATCGGTACGAAGAGGGTGAGCGACGTCTCCCACTATTACTACTCCAAGTTCTATGGGAAATCTGCGTGGGGTCGATATAAAGCTGCCAAGGACATCAAGAGCAAAGTAGCCGTCAGGGGTGAAGCGATTCTAGAGGGGTCGCGTCAGGCTGAATTCTTGAGACGACTCAAGGCGCTTGTCTCAGACGATGCGTATCGCGACATCCTGATGGTGAGGGGCGATTGTAATCTGCTTAATCTCAATTCAATCTCTCCTAAAAAGTGTTTGAGTTATGTTGAATGCATGCCAGCAAGATCGAAATCTGAGGTCTGACGTTTTCTTTCTTCTTTGTGTGGCGTCGGGTTCTGCAGGCCACGAACACTTTCAATGCCCCCCTTCCAGAGACTCACATTCCTAGCGACAAGTATGTGCGGAGGAAGCAGGAGAAGTGGAAAACTTATGTTTTCAAGCTGAAGGACTTGATCGGACTGGAGCTTTTCGAGAGGTGTGTAGGAATCGGGGGTCCTCTGGATGGTCATAGCAGTAAACGGGACCTCACCGCTGGGTCTTATCCTCTCAATCACGGTATGCTGCCACGCCAAGTCAAGGAGAAACAATCTGCTCGCGGTGTTGGAAAATCTCATCAAACACTGCCCGTCTCTACCGGCAACGAGAACCATTGTCCTCTACGGAGTGAAGACTCCATGCAGTCTACGCTGTCTGTGGGCGAAAATTGGCTGCGGAGAAGTACGTCTTCTTCTGAAGATGTCGCTCAACATTTCTGGGAACAGGTCTGGCCGGTCCTGAAGAACGCCGGGTGGAAAATTGAGGAGCGGAAGGTGTCGATTAAGAGTTTAGAGAGGATGTTGTTTGTTCGCCCTGGGGTAGAGAGAATCCACAAGGATGACAAAGGAATCAGCCACTTCGATAACCTGAACGATGTCCTTGAGGCCGTCAAGGATGATCCCATTCTGAGTCAGTTTGCGGAAGAGAACATGGATGGCTCAGAAGCTCTTGACCAAGAAGAGGAAGTGCGGCGAGGGTGGTCAGAAGACGAAGATATGTTCACAACTCTCGATGGGAAGCGCACAATCGTGCCCATAGCCAATGCCTCGGTCAAGCCTAGGGTTGTAGAGGATAGCTCTGAGTCGTCCTCCGTGGACATAGATCTGAATAGAACACTGAGTGCTGTCAACTCCAAACCACAAGTGCAGTCGGCAATAGAATGTGAGCAACAAGTGGAGCGACCGAAGGAAGCGTTGAGTCATACTGAAAAGAAAAGTAGATTTCCACTGGGAGGTATAGACCTCAATCTGTTACCTGCCGATAACGAGTGTATATCCGATACTGGTGCAGAACCTCAAGTTTTCGATAGACTGGAATACTTAGATTACTCGAGTGGCCTGAAGGAGGAGGAGCCTGTTTCCGTTCTTGTCGATTCGGTCCATGCAGAAACGGAGTTGACCCTCTCAATAGGGAATTTTTTTGGTGGGCAATTTTCTGCTCCTTGTCCTTCACGTCTCTCGCAGGACTGCATCGACCAACCTTCTGTGCAGCTACGGAGCACTGAAGAAGATTACGACCGCAGCTGGTCGCCAGCATCAAGTCAGCTAGGAAGGCTCATAAATTCCACTCCTATTCAACTTCCTTCACGGAAAAGACCTTTGAGCTTTCAGGGATGTGATACGGGAGGAGACTGGTTCGACAATGGCAAGGAGTTGGTGTCATTGCCCAAGAAAAGGGCAATAACTTTAGAGATGATTCCCCGAGGGTTGGGTGAATTGCCGATTACGACTTATCTGATCCGCCTGAGTGATGCAGCTTTGGCTCAATTTTCCAGTAGATTATCTTCTCCTAATGCTGCTGTGCCTCGGAGATGGTCTTTTCCTAAAAGCCATATCGAGATGGGATTCTCCTTGGACGCCTTCCGGAGTTTCATCCAGGATACTGCCTTACTCGTGAACTCATCAGGCAGGGCGAGGGGAGACTTTCCTCGTAAGGCCTTTCCTAAAGCTTTGCAGGATGCTGGGTCCTCTGGCTCGACACATCGTACGAATATGGCCATCGTGCCTGGTTTCCATCAGCCTAGATGCAAGGAGGCTGAAGATTGCACTATCGAGGAGGAGGAGGAGGCCGGTTTTGCAGACAGCCAGCGACATGTTTCCGCATCAGAGGTTGTGGAAGACGGAGATGTTGATAATGCCGACTCTAAGATGAAGATTCAGCAGTCCGTGTCGTTCCAGTCAAATTTTTCGCATTTGTTGATGGGATCTTCTGAAGGAGAGCTTCAGACGGAGATTCCGGATCCTGCCCCTTACGTTGTGAGTTCTCAACGCAAGAGAAGTTCTCTCGTGACCGGTTCCAGGCCCCCCAAGTGCAGGGTGGTCGATGGCGACACCGTCACCACCGCTGAACAGGAACGGATTCCAGAGCCAAAATTAGGCCAGCGTGAAGGAAGTCCTGGTTGCACCGCCAAGCCACAATGTCAGATCAAGGCTATCAGATGCCACTTCCGAGACCCCAGCGACCAGCCGACTCTACACAAGGAAAGGTCCAAGAGAGTACCGCGTACTTACTCTTCTTGGGTAAAACCTAAGGTTTGGTCCCGAGGTGATGTCGGTGATTTTTCATCAGTTTCTGAGAGTTTGAACTCGTGTTTGACGACTGATAGCTTTCCTATTCATGGTAGGAATGAGGAAGAGGCACCTCAAGGTGCCCAACTGAGAGTGAAGCATGAAGACAGTGATAGATTGAGTCCTGGTTCCATTAGGTCCTGCGGCACGGCCGACCAGGATGAGGAAATTTTGAGCGAAGGTTACGAAGAAGAGAAGCCATTTCGGACTGAGTGTAAAACTTCCCGCGAGATGTATAGTCCATCAGCTGCAGGTGATTATCATGAAAGCAGCTTGTATAAAAAACCAGGGAAAATCAGCTGTGATACTTCTGCGGCGTGGAGGAGGGGCTCTCAGAATGTTTACCTCGGCGTAGACTCGGACAATAAGAGAAGCTCAGATGAGCTTGACATCAGTGAAGGGTGTGCGGACAGCACCGGTAAGCGAATAAAAGTCAGTGGCAGTGACATGTACAGTGCAGACCTTGGGGTTGGGGAAGAATGTGGCTCGAAAAGGAGACACAAGAGATCACCACAGAAGAATCAGATCAAGAATATCTATTGTAAGAGATTTTTGATCATGCTTCACATGGATTCCACAGAAGAAGAATTGCCCATGCAGAATCGCTCATCACAAGGGCCGTTCTCCATACACCTTCCCCACATGAGAGAGGCTAAACAGAAGAAGCTCAGGATAAGGCGTCCGTCTTTGCCCTGCCGCACGAAGGAGACAATTACAGCAGCGTCTCCAAAGCGACCTGCAGGCTCTGCAAATGTACCGGGTGAGAATGAAGTCGTCATCCCTCCAGTTTCGTGGCCCCAACAAGATGGACGCTTTTCCCTTCGACGGTCTCTCTCACAGGATTTTTCCAACAGGTCAGGACGTCAGTGTACGAAGAGGGGAGGAGGTCGTTGGCAGCATTGCTGTCCTGGGTGTTAGTGTCTCTCATCGACCTGAAGTATCCCGCAGGTTGATGCACATTTGTAGAGCAGGAAAGAATCATGTTAAGTCTCAAATTTTTCTGGTTAGAAACGCAAATTCGTTCACGTAGCCCAATTAGGAACTAGAATCTGGATAGAGAGCACAATCACGTTAGGAATAGAAAGCCTTTCAAGACATGCAATTCTACTCATAACTCCGCCATCACACATCTTGGGTCTTCTGTATGGATTCTCTTGCTCGCTTTCGTTTCATCTTAGAAGATCTTTGGTGTAGTGATTTTGTTAGATATTTTCACTCAACGAAGATTGTATGTCTTGCGATTCTTAGAAACCCTACCAGGGACTGGTAGATGTTGAGTCAACGCCTCTGTAGAAGTAGCATCTATCCTTGCTTCGTAGCCCTCCGGAGCTCTTGTACAGCGGCTGAACTTTTCATTTTTGAGCTTCTCAAACCGGGGCTCTGAGGTCATTTCGATTGTTTACAAGAGAGCACATGTAGGTAGAGGTCTGAATTGACAATATATATTTATATGTTCTTCAATAAACTCCCCTTCCTGATACGG

mRNA

>Mapoly0045s0043.1
CACCCGAGAGCTTCCAGCTTCGCTTTGACTCCCGTCTACTGCAGCTGGAGCTTAACTGCGTGCTGGACTCGAACGACCAGAACTTGTTCTGCTTTGAGGAATTCAGCAGGGAAGGGAGGAGCAGGAGAGGAGGGGAGGACAGGAGTAGAAAGAGGAGCATTCGCAGAAGAGAGGAGTGGTAAGAGAAGAGGTGAACAGGAGAGAAGAGAGAAGAGGCTGCTGGTGTGTGGTCATCAACGAAGGAGGATCGAATACCTCGACAGGCCAGCAGACCAGACGCGGAATGATACGATCTGCTGCCAATTCTCGATAGACTGCCTTTCGTTTCGTTTTTTGAGTGAGCGATTTCGGACCAGAAAACCGGAATGATCGAGGACCAGGACAAGATCTGGAGAGACTGGGGTTCTTTGCCTTTCATCCTGGGAATCGCAAGGAAGAGGAGGTGTAGATAAGGAAGCGATTTTGTGCTAGCTTGAGGAACCATGGAGACATCCGTGCCCAAAAACCGGGCCAAGGCGAAGCTTGGTAACAAGTATCAAGCGGAGATTCCTAGTTGTAAATCCAGTAGTCGGATTAGAGCTTGTGATTATAACACCAGAGGTCATTTATTTGCCAATGGACTTGAAGTTCCCGTCACCCGCATTGCAGTGGATTCACAATCCGCCAGCAAGAACCGAAATCTCCATACCAATCAAGCAAGTTGTAGTTTCATGTCAGCTGTCAACTCATCACGGTCTGCTGATACACAGGAGCCTCATGTCAGCAACACAACCACAATGGACATTCATGGACGAGGAGATAATGGCAAAGATGTTAACTCTTGTGCCTCTTCATCGAGGGAAGCGTTCACCTGGAATAGAGACTGCGCTACTACTGAAGACGGGTGTCAAGGTGCAGATGAGGAGGAAGGACAAGCTGTGAGCATTCATCCGAAGAAGAGGAAGAAGAAACGGAGTTGTAAGAGAAATTCCTGGCAGCCGAAGAGGAGGGTCACCAAAAAGGCTCGATTGGAAATAAATTCTGCACATTGCTTAGAAGACGAGGAAGTAGAGGAGGATTCGGACTGCAACCGGGATTTTGTTCCTGGTTCTAGACCGGAATCGTGGGGCAACAAGGAAGTCTCGTCTTTCAAACTCGCCATTTTCCTTTTTGGAAGAAGCTTCTCTGACATTTCCAAGTTCATCGGTACGAAGAGGGTGAGCGACGTCTCCCACTATTACTACTCCAAGTTCTATGGGAAATCTGCGTGGGGTCGATATAAAGCTGCCAAGGACATCAAGAGCAAAGTAGCCGTCAGGGGTGAAGCGATTCTAGAGGGGTCGCGTCAGGCTGAATTCTTGAGACGACTCAAGGCGCTTGTCTCAGACGATGCGTATCGCGACATCCTGATGGCCACGAACACTTTCAATGCCCCCCTTCCAGAGACTCACATTCCTAGCGACAAGTATGTGCGGAGGAAGCAGGAGAAGTGGAAAACTTATGTTTTCAAGCTGAAGGACTTGATCGGACTGGAGCTTTTCGAGAGGTGTGTAGGAATCGGGGGTCCTCTGGATGGTCATAGCAGTAAACGGGACCTCACCGCTGGGTCTTATCCTCTCAATCACGGTATGCTGCCACGCCAAGTCAAGGAGAAACAATCTGCTCGCGGTGTTGGAAAATCTCATCAAACACTGCCCGTCTCTACCGGCAACGAGAACCATTGTCCTCTACGGAGTGAAGACTCCATGCAGTCTACGCTGTCTGTGGGCGAAAATTGGCTGCGGAGAAGTACGTCTTCTTCTGAAGATGTCGCTCAACATTTCTGGGAACAGGTCTGGCCGGTCCTGAAGAACGCCGGGTGGAAAATTGAGGAGCGGAAGGTGTCGATTAAGAGTTTAGAGAGGATGTTGTTTGTTCGCCCTGGGGTAGAGAGAATCCACAAGGATGACAAAGGAATCAGCCACTTCGATAACCTGAACGATGTCCTTGAGGCCGTCAAGGATGATCCCATTCTGAGTCAGTTTGCGGAAGAGAACATGGATGGCTCAGAAGCTCTTGACCAAGAAGAGGAAGTGCGGCGAGGGTGGTCAGAAGACGAAGATATGTTCACAACTCTCGATGGGAAGCGCACAATCGTGCCCATAGCCAATGCCTCGGTCAAGCCTAGGGTTGTAGAGGATAGCTCTGAGTCGTCCTCCGTGGACATAGATCTGAATAGAACACTGAGTGCTGTCAACTCCAAACCACAAGTGCAGTCGGCAATAGAATGTGAGCAACAAGTGGAGCGACCGAAGGAAGCGTTGAGTCATACTGAAAAGAAAAGTAGATTTCCACTGGGAGGTATAGACCTCAATCTGTTACCTGCCGATAACGAGTGTATATCCGATACTGGTGCAGAACCTCAAGTTTTCGATAGACTGGAATACTTAGATTACTCGAGTGGCCTGAAGGAGGAGGAGCCTGTTTCCGTTCTTGTCGATTCGGTCCATGCAGAAACGGAGTTGACCCTCTCAATAGGGAATTTTTTTGGTGGGCAATTTTCTGCTCCTTGTCCTTCACGTCTCTCGCAGGACTGCATCGACCAACCTTCTGTGCAGCTACGGAGCACTGAAGAAGATTACGACCGCAGCTGGTCGCCAGCATCAAGTCAGCTAGGAAGGCTCATAAATTCCACTCCTATTCAACTTCCTTCACGGAAAAGACCTTTGAGCTTTCAGGGATGTGATACGGGAGGAGACTGGTTCGACAATGGCAAGGAGTTGGTGTCATTGCCCAAGAAAAGGGCAATAACTTTAGAGATGATTCCCCGAGGGTTGGGTGAATTGCCGATTACGACTTATCTGATCCGCCTGAGTGATGCAGCTTTGGCTCAATTTTCCAGTAGATTATCTTCTCCTAATGCTGCTGTGCCTCGGAGATGGTCTTTTCCTAAAAGCCATATCGAGATGGGATTCTCCTTGGACGCCTTCCGGAGTTTCATCCAGGATACTGCCTTACTCGTGAACTCATCAGGCAGGGCGAGGGGAGACTTTCCTCGTAAGGCCTTTCCTAAAGCTTTGCAGGATGCTGGGTCCTCTGGCTCGACACATCGTACGAATATGGCCATCGTGCCTGGTTTCCATCAGCCTAGATGCAAGGAGGCTGAAGATTGCACTATCGAGGAGGAGGAGGAGGCCGGTTTTGCAGACAGCCAGCGACATGTTTCCGCATCAGAGGTTGTGGAAGACGGAGATGTTGATAATGCCGACTCTAAGATGAAGATTCAGCAGTCCGTGTCGTTCCAGTCAAATTTTTCGCATTTGTTGATGGGATCTTCTGAAGGAGAGCTTCAGACGGAGATTCCGGATCCTGCCCCTTACGTTGTGAGTTCTCAACGCAAGAGAAGTTCTCTCGTGACCGGTTCCAGGCCCCCCAAGTGCAGGGTGGTCGATGGCGACACCGTCACCACCGCTGAACAGGAACGGATTCCAGAGCCAAAATTAGGCCAGCGTGAAGGAAGTCCTGGTTGCACCGCCAAGCCACAATGTCAGATCAAGGCTATCAGATGCCACTTCCGAGACCCCAGCGACCAGCCGACTCTACACAAGGAAAGGTCCAAGAGAGTACCGCGTACTTACTCTTCTTGGGTAAAACCTAAGGTTTGGTCCCGAGGTGATGTCGGTGATTTTTCATCAGTTTCTGAGAGTTTGAACTCGTGTTTGACGACTGATAGCTTTCCTATTCATGGTAGGAATGAGGAAGAGGCACCTCAAGGTGCCCAACTGAGAGTGAAGCATGAAGACAGTGATAGATTGAGTCCTGGTTCCATTAGGTCCTGCGGCACGGCCGACCAGGATGAGGAAATTTTGAGCGAAGGTTACGAAGAAGAGAAGCCATTTCGGACTGAGTGTAAAACTTCCCGCGAGATGTATAGTCCATCAGCTGCAGGTGATTATCATGAAAGCAGCTTGTATAAAAAACCAGGGAAAATCAGCTGTGATACTTCTGCGGCGTGGAGGAGGGGCTCTCAGAATGTTTACCTCGGCGTAGACTCGGACAATAAGAGAAGCTCAGATGAGCTTGACATCAGTGAAGGGTGTGCGGACAGCACCGGTAAGCGAATAAAAGTCAGTGGCAGTGACATGTACAGTGCAGACCTTGGGGTTGGGGAAGAATGTGGCTCGAAAAGGAGACACAAGAGATCACCACAGAAGAATCAGATCAAGAATATCTATTGTAAGAGATTTTTGATCATGCTTCACATGGATTCCACAGAAGAAGAATTGCCCATGCAGAATCGCTCATCACAAGGGCCGTTCTCCATACACCTTCCCCACATGAGAGAGGCTAAACAGAAGAAGCTCAGGATAAGGCGTCCGTCTTTGCCCTGCCGCACGAAGGAGACAATTACAGCAGCGTCTCCAAAGCGACCTGCAGGCTCTGCAAATGTACCGGGTGAGAATGAAGTCGTCATCCCTCCAGTTTCGTGGCCCCAACAAGATGGACGCTTTTCCCTTCGACGGTCTCTCTCACAGGATTTTTCCAACAGGTCAGGACGTCAGTGTACGAAGAGGGGAGGAGGTCGTTGGCAGCATTGCTGTCCTGGGTGTTAGTGTCTCTCATCGACCTGAAGTATCCCGCAGGTTGATGCACATTTGTAGAGCAGGAAAGAATCATGTTAAGTCTCAAATTTTTCTGGTTAGAAACGCAAATTCGTTCACGTAGCCCAATTAGGAACTAGAATCTGGATAGAGAGCACAATCACGTTAGGAATAGAAAGCCTTTCAAGACATGCAATTCTACTCATAACTCCGCCATCACACATCTTGGGTCTTCTGTATGGATTCTCTTGCTCGCTTTCGTTTCATCTTAGAAGATCTTTGGTGTAGTGATTTTGTTAGATATTTTCACTCAACGAAGATTGTATGTCTTGCGATTCTTAGAAACCCTACCAGGGACTGGTAGATGTTGAGTCAACGCCTCTGTAGAAGTAGCATCTATCCTTGCTTCGTAGCCCTCCGGAGCTCTTGTACAGCGGCTGAACTTTTCATTTTTGAGCTTCTCAAACCGGGGCTCTGAGGTCATTTCGATTGTTTACAAGAGAGCACATGTAGGTAGAGGTCTGAATTGACAATATATATTTATATGTTCTTCAATAAACTCCCCTTCCTGATACGG

CDS

>Mapoly0045s0043.1
ATGGAGACATCCGTGCCCAAAAACCGGGCCAAGGCGAAGCTTGGTAACAAGTATCAAGCGGAGATTCCTAGTTGTAAATCCAGTAGTCGGATTAGAGCTTGTGATTATAACACCAGAGGTCATTTATTTGCCAATGGACTTGAAGTTCCCGTCACCCGCATTGCAGTGGATTCACAATCCGCCAGCAAGAACCGAAATCTCCATACCAATCAAGCAAGTTGTAGTTTCATGTCAGCTGTCAACTCATCACGGTCTGCTGATACACAGGAGCCTCATGTCAGCAACACAACCACAATGGACATTCATGGACGAGGAGATAATGGCAAAGATGTTAACTCTTGTGCCTCTTCATCGAGGGAAGCGTTCACCTGGAATAGAGACTGCGCTACTACTGAAGACGGGTGTCAAGGTGCAGATGAGGAGGAAGGACAAGCTGTGAGCATTCATCCGAAGAAGAGGAAGAAGAAACGGAGTTGTAAGAGAAATTCCTGGCAGCCGAAGAGGAGGGTCACCAAAAAGGCTCGATTGGAAATAAATTCTGCACATTGCTTAGAAGACGAGGAAGTAGAGGAGGATTCGGACTGCAACCGGGATTTTGTTCCTGGTTCTAGACCGGAATCGTGGGGCAACAAGGAAGTCTCGTCTTTCAAACTCGCCATTTTCCTTTTTGGAAGAAGCTTCTCTGACATTTCCAAGTTCATCGGTACGAAGAGGGTGAGCGACGTCTCCCACTATTACTACTCCAAGTTCTATGGGAAATCTGCGTGGGGTCGATATAAAGCTGCCAAGGACATCAAGAGCAAAGTAGCCGTCAGGGGTGAAGCGATTCTAGAGGGGTCGCGTCAGGCTGAATTCTTGAGACGACTCAAGGCGCTTGTCTCAGACGATGCGTATCGCGACATCCTGATGGCCACGAACACTTTCAATGCCCCCCTTCCAGAGACTCACATTCCTAGCGACAAGTATGTGCGGAGGAAGCAGGAGAAGTGGAAAACTTATGTTTTCAAGCTGAAGGACTTGATCGGACTGGAGCTTTTCGAGAGGTGTGTAGGAATCGGGGGTCCTCTGGATGGTCATAGCAGTAAACGGGACCTCACCGCTGGGTCTTATCCTCTCAATCACGGTATGCTGCCACGCCAAGTCAAGGAGAAACAATCTGCTCGCGGTGTTGGAAAATCTCATCAAACACTGCCCGTCTCTACCGGCAACGAGAACCATTGTCCTCTACGGAGTGAAGACTCCATGCAGTCTACGCTGTCTGTGGGCGAAAATTGGCTGCGGAGAAGTACGTCTTCTTCTGAAGATGTCGCTCAACATTTCTGGGAACAGGTCTGGCCGGTCCTGAAGAACGCCGGGTGGAAAATTGAGGAGCGGAAGGTGTCGATTAAGAGTTTAGAGAGGATGTTGTTTGTTCGCCCTGGGGTAGAGAGAATCCACAAGGATGACAAAGGAATCAGCCACTTCGATAACCTGAACGATGTCCTTGAGGCCGTCAAGGATGATCCCATTCTGAGTCAGTTTGCGGAAGAGAACATGGATGGCTCAGAAGCTCTTGACCAAGAAGAGGAAGTGCGGCGAGGGTGGTCAGAAGACGAAGATATGTTCACAACTCTCGATGGGAAGCGCACAATCGTGCCCATAGCCAATGCCTCGGTCAAGCCTAGGGTTGTAGAGGATAGCTCTGAGTCGTCCTCCGTGGACATAGATCTGAATAGAACACTGAGTGCTGTCAACTCCAAACCACAAGTGCAGTCGGCAATAGAATGTGAGCAACAAGTGGAGCGACCGAAGGAAGCGTTGAGTCATACTGAAAAGAAAAGTAGATTTCCACTGGGAGGTATAGACCTCAATCTGTTACCTGCCGATAACGAGTGTATATCCGATACTGGTGCAGAACCTCAAGTTTTCGATAGACTGGAATACTTAGATTACTCGAGTGGCCTGAAGGAGGAGGAGCCTGTTTCCGTTCTTGTCGATTCGGTCCATGCAGAAACGGAGTTGACCCTCTCAATAGGGAATTTTTTTGGTGGGCAATTTTCTGCTCCTTGTCCTTCACGTCTCTCGCAGGACTGCATCGACCAACCTTCTGTGCAGCTACGGAGCACTGAAGAAGATTACGACCGCAGCTGGTCGCCAGCATCAAGTCAGCTAGGAAGGCTCATAAATTCCACTCCTATTCAACTTCCTTCACGGAAAAGACCTTTGAGCTTTCAGGGATGTGATACGGGAGGAGACTGGTTCGACAATGGCAAGGAGTTGGTGTCATTGCCCAAGAAAAGGGCAATAACTTTAGAGATGATTCCCCGAGGGTTGGGTGAATTGCCGATTACGACTTATCTGATCCGCCTGAGTGATGCAGCTTTGGCTCAATTTTCCAGTAGATTATCTTCTCCTAATGCTGCTGTGCCTCGGAGATGGTCTTTTCCTAAAAGCCATATCGAGATGGGATTCTCCTTGGACGCCTTCCGGAGTTTCATCCAGGATACTGCCTTACTCGTGAACTCATCAGGCAGGGCGAGGGGAGACTTTCCTCGTAAGGCCTTTCCTAAAGCTTTGCAGGATGCTGGGTCCTCTGGCTCGACACATCGTACGAATATGGCCATCGTGCCTGGTTTCCATCAGCCTAGATGCAAGGAGGCTGAAGATTGCACTATCGAGGAGGAGGAGGAGGCCGGTTTTGCAGACAGCCAGCGACATGTTTCCGCATCAGAGGTTGTGGAAGACGGAGATGTTGATAATGCCGACTCTAAGATGAAGATTCAGCAGTCCGTGTCGTTCCAGTCAAATTTTTCGCATTTGTTGATGGGATCTTCTGAAGGAGAGCTTCAGACGGAGATTCCGGATCCTGCCCCTTACGTTGTGAGTTCTCAACGCAAGAGAAGTTCTCTCGTGACCGGTTCCAGGCCCCCCAAGTGCAGGGTGGTCGATGGCGACACCGTCACCACCGCTGAACAGGAACGGATTCCAGAGCCAAAATTAGGCCAGCGTGAAGGAAGTCCTGGTTGCACCGCCAAGCCACAATGTCAGATCAAGGCTATCAGATGCCACTTCCGAGACCCCAGCGACCAGCCGACTCTACACAAGGAAAGGTCCAAGAGAGTACCGCGTACTTACTCTTCTTGGGTAAAACCTAAGGTTTGGTCCCGAGGTGATGTCGGTGATTTTTCATCAGTTTCTGAGAGTTTGAACTCGTGTTTGACGACTGATAGCTTTCCTATTCATGGTAGGAATGAGGAAGAGGCACCTCAAGGTGCCCAACTGAGAGTGAAGCATGAAGACAGTGATAGATTGAGTCCTGGTTCCATTAGGTCCTGCGGCACGGCCGACCAGGATGAGGAAATTTTGAGCGAAGGTTACGAAGAAGAGAAGCCATTTCGGACTGAGTGTAAAACTTCCCGCGAGATGTATAGTCCATCAGCTGCAGGTGATTATCATGAAAGCAGCTTGTATAAAAAACCAGGGAAAATCAGCTGTGATACTTCTGCGGCGTGGAGGAGGGGCTCTCAGAATGTTTACCTCGGCGTAGACTCGGACAATAAGAGAAGCTCAGATGAGCTTGACATCAGTGAAGGGTGTGCGGACAGCACCGGTAAGCGAATAAAAGTCAGTGGCAGTGACATGTACAGTGCAGACCTTGGGGTTGGGGAAGAATGTGGCTCGAAAAGGAGACACAAGAGATCACCACAGAAGAATCAGATCAAGAATATCTATTGTAAGAGATTTTTGATCATGCTTCACATGGATTCCACAGAAGAAGAATTGCCCATGCAGAATCGCTCATCACAAGGGCCGTTCTCCATACACCTTCCCCACATGAGAGAGGCTAAACAGAAGAAGCTCAGGATAAGGCGTCCGTCTTTGCCCTGCCGCACGAAGGAGACAATTACAGCAGCGTCTCCAAAGCGACCTGCAGGCTCTGCAAATGTACCGGGTGAGAATGAAGTCGTCATCCCTCCAGTTTCGTGGCCCCAACAAGATGGACGCTTTTCCCTTCGACGGTCTCTCTCACAGGATTTTTCCAACAGGTCAGGACGTCAGTGTACGAAGAGGGGAGGAGGTCGTTGGCAGCATTGCTGTCCTGGGTGTTAG

Protein

>Mapoly0045s0043.1
METSVPKNRAKAKLGNKYQAEIPSCKSSSRIRACDYNTRGHLFANGLEVPVTRIAVDSQSASKNRNLHTNQASCSFMSAVNSSRSADTQEPHVSNTTTMDIHGRGDNGKDVNSCASSSREAFTWNRDCATTEDGCQGADEEEGQAVSIHPKKRKKKRSCKRNSWQPKRRVTKKARLEINSAHCLEDEEVEEDSDCNRDFVPGSRPESWGNKEVSSFKLAIFLFGRSFSDISKFIGTKRVSDVSHYYYSKFYGKSAWGRYKAAKDIKSKVAVRGEAILEGSRQAEFLRRLKALVSDDAYRDILMATNTFNAPLPETHIPSDKYVRRKQEKWKTYVFKLKDLIGLELFERCVGIGGPLDGHSSKRDLTAGSYPLNHGMLPRQVKEKQSARGVGKSHQTLPVSTGNENHCPLRSEDSMQSTLSVGENWLRRSTSSSEDVAQHFWEQVWPVLKNAGWKIEERKVSIKSLERMLFVRPGVERIHKDDKGISHFDNLNDVLEAVKDDPILSQFAEENMDGSEALDQEEEVRRGWSEDEDMFTTLDGKRTIVPIANASVKPRVVEDSSESSSVDIDLNRTLSAVNSKPQVQSAIECEQQVERPKEALSHTEKKSRFPLGGIDLNLLPADNECISDTGAEPQVFDRLEYLDYSSGLKEEEPVSVLVDSVHAETELTLSIGNFFGGQFSAPCPSRLSQDCIDQPSVQLRSTEEDYDRSWSPASSQLGRLINSTPIQLPSRKRPLSFQGCDTGGDWFDNGKELVSLPKKRAITLEMIPRGLGELPITTYLIRLSDAALAQFSSRLSSPNAAVPRRWSFPKSHIEMGFSLDAFRSFIQDTALLVNSSGRARGDFPRKAFPKALQDAGSSGSTHRTNMAIVPGFHQPRCKEAEDCTIEEEEEAGFADSQRHVSASEVVEDGDVDNADSKMKIQQSVSFQSNFSHLLMGSSEGELQTEIPDPAPYVVSSQRKRSSLVTGSRPPKCRVVDGDTVTTAEQERIPEPKLGQREGSPGCTAKPQCQIKAIRCHFRDPSDQPTLHKERSKRVPRTYSSWVKPKVWSRGDVGDFSSVSESLNSCLTTDSFPIHGRNEEEAPQGAQLRVKHEDSDRLSPGSIRSCGTADQDEEILSEGYEEEKPFRTECKTSREMYSPSAAGDYHESSLYKKPGKISCDTSAAWRRGSQNVYLGVDSDNKRSSDELDISEGCADSTGKRIKVSGSDMYSADLGVGEECGSKRRHKRSPQKNQIKNIYCKRFLIMLHMDSTEEELPMQNRSSQGPFSIHLPHMREAKQKKLRIRRPSLPCRTKETITAASPKRPAGSANVPGENEVVIPPVSWPQQDGRFSLRRSLSQDFSNRSGRQCTKRGGGRWQHCCPGC

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>