Mapoly0046s0102



Description

KELCH-RELATED

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
OrthoMCL OG5_146419
PFAM PF00170 BZIP transcription factor
PANTHER PTHR13690 FAMILY NOT NAMED
PANTHER PTHR13690:SF76 KELCH-RELATED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBZIP10 transcription factor, bZIP Mapoly0046s0102.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0046s0102.1 scaffold_46:1140780..1147418  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0046s0102.1  

Gene structure:

mRNA scaffold_46:1140780..1147418  ( + strand )
five_prime_UTR scaffold_46:1140780..1141959  ( + strand )
CDS scaffold_46:1141960..1143875  ( + strand )
CDS scaffold_46:1144049..1144181  ( + strand )
CDS scaffold_46:1144347..1144431  ( + strand )
CDS scaffold_46:1144701..1145020  ( + strand )
three_prime_UTR scaffold_46:1145021..1145058  ( + strand )
three_prime_UTR scaffold_46:1146056..1147418  ( + strand )

Sequences:

Gene

>Mapoly0046s0102.1
TGCGTCTGGCGCAGTGTCCGAGCATCTCATCTCGCGCTCTCTCTTCTCTTTCGGAGTCGTGGGGGCCGGGCGGCCATAGCAAATTGGCTCCCGAGCTCTTTTGTTCATGAAATCCGGGAGTGTTGGGTTGTAGTATCTTGTGGGCATTTCAGATTGTGCGGGGCTTACATTATTTGCGCTCCGATATTAGCTGCGGGTCGAATCTTTAGTATAGTTGAGTTTGTGTCTGGCTCGCGCCGAGAGTTCGTGCGAGCTTGGTTATCGGTGTCGTCAAGCGTGGGCCGAAGAGCAAGGGGTTGGTGTAGCGTTTTGCGCGTTTGTAGGCGTGTAGCACAGTAGTACTGTTGTCATATTCCTCCCTGCCTCGTTCTTCAATGCTCTGCGCTCTTTGTTCTTTTCTTGAATCGTCGTAGACTGTTATCGCCCGCCCCTCCGCGCGCTCGCCCGCGCGCACGCCCTCTTTCTTTTGACTCGGCTGTGAGACGTGCGAGTTTGCAGTGATCGTTCAGTGTAGGTGTGCAGTTCAGTGTACTTCTTTTTGTGCGGGTTACAGTTTTGATTCACTTCACGGCGTGTCTCCTGTTCTGTGGGGTTCAATTCCGGCGCAGATGTACTCTCTCATTGTTCTGAACTAGCTGTCAACTGCTTGTGCGCCTATGTGTCCGTGGGGCTGAAAGTTGGACTGCATTGTTCGCCTCTGTGGTTTAGATAGTACGACAGCAATTTCCTTCGTTGGTCCTGCCCCAAGCCGTTATTTGGTCACTTCTTTATCGTGGTTCTTGTCCCGCGCCTTGGGAAGAATGTATTTCAATGAGCTAGTTGGCATCCTTTTTGCCAATGGAGGGCTTTGAGCTACACTCCTCTCGTAACTGACTTTTCCTTTCTAACTTTTCCGTCACAATTACCTTCTGCAGTTCTCCAGCGGACTTCTGCCCTAAGCCCGTCCAAACTCCGTACTGTCTTCGTCTAGTGAAACGCCTGTAGATTGTGAATAGCTCTGTACTCAACGTTTTCTTCACTCTGTCTGACCCCGTTCTCTCATTTGATCGCGTATCTAAGCAGTGTTGCACGTGGTTCGGTTACAAATCTTAGTTACAGCAATCTCTTGAGGCATCTCTCCCAAGTAACAAGACAAATGACACTATAACAGAGGGGGAAGACTAATAGTTTTTCAGTCAAGATGTTTCCCATGGGAGAGATGGAGGGAACGGGGGACAGTTATAGTGAGATAATGCAGAGATTGCAGTCATCATTAGCAGCATCGTCTTTCCCGAAGTCGAACGCCAACTCTCTTCCTCTTCCACAGGTTCCATCTCATACTCTGTCGAACTCGCAGGCAACCTTGTCTCAATCTCAAAGCCTCTTTCAGTCCCAGTCGCACAGTCTGTCACAAACTCCGAGCTCCTTTGCCAAAACATCTCCTTTCTTACACACTCAATCCAAGTCTCAGGCTCATCCTTCCCGCTCCCTCTCACAGCCACTGTCCCAAACGCACACTGCTCCTCATGCTCCCACCCATTCTCGCTCAATGTCACAGCCGTCTATCCGATCTCACATGCCGCCACTTCAGTCGCAAACTCCGCCTGTTCATGCTCACTCTCAGCATTCCCCTCACTCCCTATCTCAGCCGGCTTCTCAGTCTCCACATTCCTCTCTCCCTCTTCCGCAAGTCACACCTCGATTCCCATCGACCTCGCAAGCCTCTCCTCCTACCCTTCATACTCGTTCCCTCTCCCAGCCAACCATTCTCAATCAGACCTCCTCTGGCGGACCACTTTCGCCACCCTCAATGGGTCATCTTCCTCCTCCCAATTCCATGTCTCATTCTCTGTTCGCCAGCTTCAACAGTCTCACACCCAATTATCCCGTGAAGAAAGAAGCGTCGCAGTCTCTTTCGGACTCATCCGCGAGAACCACCGTGTCGCTTGATGTCACCATGGAGGAGAGTTCACCTTGCCCTCCTGCAGGGAGCGGACCTTCTTCTTCGAAACCCCTTTCCCCACCTTTGAATCCTTTTCATACCATGAGTCAAAGGTACAGCAATGATCTGAGCCAAATGCCGGACAGTCCTCCTAAGCGACGGGGGCATCGAAGGGCTCAAAGTGAAATTGCATTTCGACAGGGCTCTTCCTTCGAGAAAGAATTAAGAGACGAAAGCAGGGACTTTGACAGGGATTCTGTGAAGGAGTCGGATATGGAAAGGGAGCTCAATCAAGGTCGAGTGGATCTGGACGAGGATATGGACAGGGCTACCAGTTGGGGTAGGGAGAGGCACAGAGATAGGGAAGGAGAAGGAGAAGGTGCAGAAGATCTTTTCTCTATGTACATCGATATGGAGAAGATCAACAGTTTCAGCAACTCTGGAGCAGGCGATGGTGGGGACAGTGATAGAGAGAAGCCGATGAGCAGGGTAGACGCTGGCAAAGATCGGCTCAAAACACTTGCCGAGAACGAGAAACCAACCTCTGGAAGTGTGGATGAGAATCAGCGAGATCGCTCCCGTGGGCCTGTAGAAGGTGACAAGGAGAGGAGCAGAGAAAGTTGGATGAAAACTGTCTCTGATAACGATCGAGAAGGCAGAAACACACCCGCAACCGAAGAGGAGAAAGGTGACAAGAACCGGGTAGATGAGTTGAGAACCAGTGAGAAACAAAAGGAGAAGGATGATCAAGAGATGTCCAAAGGTTCCGAAAGAGAGAACTGGTCCAGAAAGGATGAAGAAGACGATAAGGAAACTTCAAGTATGTGTGTCGAGAATGAGGGTGGCAAGGACAGATCAGATAATGAGCGAGAGAAGGGTAAGCTTGACAGAAGCTCGCCCAGTGGTGCCACTCACCACTCACGGAGCGTTTCCATGGATGGGTTCCTGAGCAACTTACAAGGATACAAGGCTGGTGACGCTGGCCATCTTTCCTCTTTCTCTGAAGATCGGAGGAGTAGACAGACTAGACATCATCACAGCATGTCCATGGACGGTAGTATGAGCCTGAAGATGGAATTTGGGCAAGGAGAGTTTGAGGGTATCGAGTTAAAGAAGGCCATGGCCAGCGACAAGCTAGCAGACCTTGCTCTGGTCGATCCCAAGCGGGCTAAGAGGTAAATCTGGAGGGATATCAAATATCTCGCATTGCCTATCCTTGCCTTGATAAGACTAGGTGTTAGATCTCCCTTTACATTTAGTCCCTTCAGAATACGTTTCGCTGCAGCAACGGGCAGTCCAAGAGATGGAAGAATGACTAATGTGTTTTTATGTTGATTCATTTGTGCAGGATCTTGGCTAACCGGCAGTCGGCAGCACGCTCGAAAGAACGTAAGATGAGATATATATCTGAACTTGAGCGGAAGGTGCAGACTTTGCAAACGGAGGCGACAACACTATCCGCCCAACTCACAATGCTACAGGTAAGGGGCGTTGCGAGTACTATCTTAAAATTTTAATTCATGGGAACAACTACTGGAGTTGAATAAAGAGAGTCGCCTAGTACGTTCTTGATTGCCGTCTTCTTGTTTCTTCATGCTGTTGAGCTGCCCAATCGAAGAAAGTTGACCCCCCAGTGCAATATGCAGAGAGACTCTACCGGGCTCACAACAGAAAATAGCGAACTAAAGCTTAGGTTGTCAGCAATGGAACAACAAGCACAACTTCGCGATGGTAAGGTTCTCTCTCAAGTCTAAAGCCACGACCTCACTCTCGAGAAAAATGGGTTTGACTTGTCTATTAACTCTGAATCCGAACTCTTGATTTGCGATGAGTTTGTTCAACTTTAACTCAAGTTACAGTGGAGTAATTGTCGTTTCATTGCATTGGTATTTTTACTCTAGTGCATCAGAGTAAATCGAAGCCTAATTTCAGTGAATATTTGGACAATTGCAACTTTTGTCTTCCTACTGCTGACACTGTTTTTCTATGCGGGACTACAGCTCTTAATGATGCATTGCGAGAGGAAGTTCAACGGTTGAAGCTAGCAACTGGACAACTTTCAAATGGACAGGGAATGAGCTTGGGGCAGCAAATGGGTGTCAATCCTCAATTGTACCAGCTCCATCAACAACTGCAGCAGCAACAGCAGCCGCAAGGCAATCACCAACATCAACCGGTGCAGCAAAACTCCCACGCAGACTTTCTTCAGCGTAGTGCATTTGGCGCACTTCAAGGACTTGCCGGGTCTCTTGGGGGAGCTTTCTTGAAATCAGAGGGAAACGGCATTGCCGTCAATCAGGGAAGCAGTGCATCGTTCTAAACACTTATTAGGAGGGCAGTATTGCCTTTTTTGGAAAGGTATGTCAGACCAAGGGAACTTGGTACGCCTTACAAAGTAGGAAAACTTTAACTTTTAATTTTGGAACTAGGAACTGGTAAATTGAGGAGTAAATCTGTCTCTTTGTGCTCTAGAAATCTTTATTCTTCACATCTAATCATCCGCTGGGCTGGTAGTCTATCCTTTATGTTGGCTCTTGCCGTAATGGTGTGCTACGAGCCTAGCCCCTACTGCCTGAAATTGTTTCCCCAAGGGCACATTTCTTGCATGATATCTGGCCGTCATTTGTAAATTCCCTCATTTAATCTATTTCTGTTGACCTGATTGAAGGACAACGTTCCAATATGCCATTTAATACTAGTTCCTAATTATTTGAAGACTCAGATAATTTCATTCAAAAGTTTTTGTTGTTTAAGTAAACCTGCGTGGGGGTTTTGTTGAAGAAATGTCAAGTGGAGGAGATGCTGAAGGTCTCATATGCTCCCAGTGTTCGCTACATCTCTGTTGATTTATAACTTGCTGAAATGATGGCTTCCTGTATACAGTATGTGCTTCGCGCGTCATGTAGGATGCCCATCAAGTCATCATTAGGCTCCGTCAGTGGAGTTCGCATGGTCGTTTTTGTGTGGTTCAATTTACTCTACTGGTGTATTGGACATACTAGATTCTTCAGCTCTTCGTAGGTGAAGATGGGAGCCTATCTGGTTCAAATGTGGACAACTTTAGTGGAGTTCATTTTGACTTTCTTTACCCTATCTCCCGAACTGTGACCGTTCTTCCCCGTAGCTGAGTTGTTCTGGCTAGCATGTTCTTCTTATTGGCTCAGACGTTTGATAATATGTTTTCAAGATCAGTGATCCCCGCCAAGGATTTGCTGATTGTCTCTCAACATCTTGTCCTTCTCTTGGTGAAAAATTTTGTCATGCGGGCACAAAAGCATTGACAGACGAGTGCATGCAGCTGTACATGTCATTAGAAGTCTCGTAGTGATCCTTTCTAATAATTTTGGCTTTGCAGGGTGGAGCTCACTGTGCCACTATATTTGAGGAATGTCTCAAAACCTTCACACAACCTCTTGGTTAAATTGTCTAAGCTGGCTGCTGCTGCTGCTGCTGCTGTTTGAACACCCAAGTACAGTTGACACAGGTGCGGTTGACTGGAGAGTCTTTAAGTACCGTAGTCTGTCAAACTCCTATTGTGGGCCTTTATTCGTATCTCCCGTTATCTCCTGGTAGTTTGGAAGATGCGAAGTACGAGGCAGGCACAGACGTACGAACTGTAAAATGCGTTCACATCGAGATAGCCATAGATCTGCGAGGTCATACTCCGATAAAACGCCGTAAAGACGTATTGTTTACTTCCGACGAGGCACGGTTGGGCGAAAGTGAGATGGACCGATTCCCCAGCGAATCCAGCTCAGCTGCCGTTACAGCTGCAGTATGAAGCACTCTGATCCTCAAGTCTGAGAGGATAAGTGCTGGAACAGACTACGTCCTAGTAAGAACACCTTGTTAAGAGAAGGAAAACTCATTGGACAATGCAGCAGCTTGAGCGATGAGGAAAGTTTCGAAAACCTTGTGTCAGCTCCAAACTGTTTTTTGATGCTTTTACAATCTGCGAGAGTTTTATTCACCAGCAACATCCGGGGGGCTCTGTGGGTGAAGCTGCCTCGCGGTTCTGCATTCTCGGTCATACTCTCTATCTCGAACTTGATACATGCTGCACTGAAGGCAGAGTCCAGTGGTCGACAGCAACGCCTCAGAACCTCAAACTCCTCGGTGGAGTTTCACTGTTACTTACATTACAACCTCTTGAAGGGGAATCGCTTTTCCGTTACGTACCGTCAACCAACCTGGACAATTACGAGGACTTACACGAGCTACCACAGGTAAACCGTCAGAGAACGGGCGAAGCCACTGTACGATATCAACGAGTGCCACCGCACGTATTGTCCTGCCAATCAGTGACATTTTCAAGTATCGTTGTTTTGCGAAGTTGTCACTTGTCTCGGGATATTCCCTTGTGACCACCAAACAAACCTGTTCGACTTGGAGTTCTTCGCTTACCTGTGGTGGTCGAGGGTGGTAAATTTTAGTTTCGCAAGATATCTGAGAAAGTCAGGGTACGCTGTGACCTGAGCATCTCTAAGGTATTGATGCAATTTTTCTGTCTCAGTATCGAGGGAAATAGTTCCTCCCAATTAGTTATTAAGCATGTTCGTAGACATCAGTTCTAAATGCACCTGATGCATTCAACTGCCAGCTTATCGAGAATGACAGCTCAGGTTTTCTTCATTCTTGGACATAAATGCCCGCCTCATTAATTTGGAGGAACTCACTTATAATCAACTTGATAATTTTCTCTCAGTCCTAATAGTGGG

mRNA

>Mapoly0046s0102.1
TGCGTCTGGCGCAGTGTCCGAGCATCTCATCTCGCGCTCTCTCTTCTCTTTCGGAGTCGTGGGGGCCGGGCGGCCATAGCAAATTGGCTCCCGAGCTCTTTTGTTCATGAAATCCGGGAGTGTTGGGTTGTAGTATCTTGTGGGCATTTCAGATTGTGCGGGGCTTACATTATTTGCGCTCCGATATTAGCTGCGGGTCGAATCTTTAGTATAGTTGAGTTTGTGTCTGGCTCGCGCCGAGAGTTCGTGCGAGCTTGGTTATCGGTGTCGTCAAGCGTGGGCCGAAGAGCAAGGGGTTGGTGTAGCGTTTTGCGCGTTTGTAGGCGTGTAGCACAGTAGTACTGTTGTCATATTCCTCCCTGCCTCGTTCTTCAATGCTCTGCGCTCTTTGTTCTTTTCTTGAATCGTCGTAGACTGTTATCGCCCGCCCCTCCGCGCGCTCGCCCGCGCGCACGCCCTCTTTCTTTTGACTCGGCTGTGAGACGTGCGAGTTTGCAGTGATCGTTCAGTGTAGGTGTGCAGTTCAGTGTACTTCTTTTTGTGCGGGTTACAGTTTTGATTCACTTCACGGCGTGTCTCCTGTTCTGTGGGGTTCAATTCCGGCGCAGATGTACTCTCTCATTGTTCTGAACTAGCTGTCAACTGCTTGTGCGCCTATGTGTCCGTGGGGCTGAAAGTTGGACTGCATTGTTCGCCTCTGTGGTTTAGATAGTACGACAGCAATTTCCTTCGTTGGTCCTGCCCCAAGCCGTTATTTGGTCACTTCTTTATCGTGGTTCTTGTCCCGCGCCTTGGGAAGAATGTATTTCAATGAGCTAGTTGGCATCCTTTTTGCCAATGGAGGGCTTTGAGCTACACTCCTCTCGTAACTGACTTTTCCTTTCTAACTTTTCCGTCACAATTACCTTCTGCAGTTCTCCAGCGGACTTCTGCCCTAAGCCCGTCCAAACTCCGTACTGTCTTCGTCTAGTGAAACGCCTGTAGATTGTGAATAGCTCTGTACTCAACGTTTTCTTCACTCTGTCTGACCCCGTTCTCTCATTTGATCGCGTATCTAAGCAGTGTTGCACGTGGTTCGGTTACAAATCTTAGTTACAGCAATCTCTTGAGGCATCTCTCCCAAGTAACAAGACAAATGACACTATAACAGAGGGGGAAGACTAATAGTTTTTCAGTCAAGATGTTTCCCATGGGAGAGATGGAGGGAACGGGGGACAGTTATAGTGAGATAATGCAGAGATTGCAGTCATCATTAGCAGCATCGTCTTTCCCGAAGTCGAACGCCAACTCTCTTCCTCTTCCACAGGTTCCATCTCATACTCTGTCGAACTCGCAGGCAACCTTGTCTCAATCTCAAAGCCTCTTTCAGTCCCAGTCGCACAGTCTGTCACAAACTCCGAGCTCCTTTGCCAAAACATCTCCTTTCTTACACACTCAATCCAAGTCTCAGGCTCATCCTTCCCGCTCCCTCTCACAGCCACTGTCCCAAACGCACACTGCTCCTCATGCTCCCACCCATTCTCGCTCAATGTCACAGCCGTCTATCCGATCTCACATGCCGCCACTTCAGTCGCAAACTCCGCCTGTTCATGCTCACTCTCAGCATTCCCCTCACTCCCTATCTCAGCCGGCTTCTCAGTCTCCACATTCCTCTCTCCCTCTTCCGCAAGTCACACCTCGATTCCCATCGACCTCGCAAGCCTCTCCTCCTACCCTTCATACTCGTTCCCTCTCCCAGCCAACCATTCTCAATCAGACCTCCTCTGGCGGACCACTTTCGCCACCCTCAATGGGTCATCTTCCTCCTCCCAATTCCATGTCTCATTCTCTGTTCGCCAGCTTCAACAGTCTCACACCCAATTATCCCGTGAAGAAAGAAGCGTCGCAGTCTCTTTCGGACTCATCCGCGAGAACCACCGTGTCGCTTGATGTCACCATGGAGGAGAGTTCACCTTGCCCTCCTGCAGGGAGCGGACCTTCTTCTTCGAAACCCCTTTCCCCACCTTTGAATCCTTTTCATACCATGAGTCAAAGGTACAGCAATGATCTGAGCCAAATGCCGGACAGTCCTCCTAAGCGACGGGGGCATCGAAGGGCTCAAAGTGAAATTGCATTTCGACAGGGCTCTTCCTTCGAGAAAGAATTAAGAGACGAAAGCAGGGACTTTGACAGGGATTCTGTGAAGGAGTCGGATATGGAAAGGGAGCTCAATCAAGGTCGAGTGGATCTGGACGAGGATATGGACAGGGCTACCAGTTGGGGTAGGGAGAGGCACAGAGATAGGGAAGGAGAAGGAGAAGGTGCAGAAGATCTTTTCTCTATGTACATCGATATGGAGAAGATCAACAGTTTCAGCAACTCTGGAGCAGGCGATGGTGGGGACAGTGATAGAGAGAAGCCGATGAGCAGGGTAGACGCTGGCAAAGATCGGCTCAAAACACTTGCCGAGAACGAGAAACCAACCTCTGGAAGTGTGGATGAGAATCAGCGAGATCGCTCCCGTGGGCCTGTAGAAGGTGACAAGGAGAGGAGCAGAGAAAGTTGGATGAAAACTGTCTCTGATAACGATCGAGAAGGCAGAAACACACCCGCAACCGAAGAGGAGAAAGGTGACAAGAACCGGGTAGATGAGTTGAGAACCAGTGAGAAACAAAAGGAGAAGGATGATCAAGAGATGTCCAAAGGTTCCGAAAGAGAGAACTGGTCCAGAAAGGATGAAGAAGACGATAAGGAAACTTCAAGTATGTGTGTCGAGAATGAGGGTGGCAAGGACAGATCAGATAATGAGCGAGAGAAGGGTAAGCTTGACAGAAGCTCGCCCAGTGGTGCCACTCACCACTCACGGAGCGTTTCCATGGATGGGTTCCTGAGCAACTTACAAGGATACAAGGCTGGTGACGCTGGCCATCTTTCCTCTTTCTCTGAAGATCGGAGGAGTAGACAGACTAGACATCATCACAGCATGTCCATGGACGGTAGTATGAGCCTGAAGATGGAATTTGGGCAAGGAGAGTTTGAGGGTATCGAGTTAAAGAAGGCCATGGCCAGCGACAAGCTAGCAGACCTTGCTCTGGTCGATCCCAAGCGGGCTAAGAGGATCTTGGCTAACCGGCAGTCGGCAGCACGCTCGAAAGAACGTAAGATGAGATATATATCTGAACTTGAGCGGAAGGTGCAGACTTTGCAAACGGAGGCGACAACACTATCCGCCCAACTCACAATGCTACAGAGAGACTCTACCGGGCTCACAACAGAAAATAGCGAACTAAAGCTTAGGTTGTCAGCAATGGAACAACAAGCACAACTTCGCGATGCTCTTAATGATGCATTGCGAGAGGAAGTTCAACGGTTGAAGCTAGCAACTGGACAACTTTCAAATGGACAGGGAATGAGCTTGGGGCAGCAAATGGGTGTCAATCCTCAATTGTACCAGCTCCATCAACAACTGCAGCAGCAACAGCAGCCGCAAGGCAATCACCAACATCAACCGGTGCAGCAAAACTCCCACGCAGACTTTCTTCAGCGTAGTGCATTTGGCGCACTTCAAGGACTTGCCGGGTCTCTTGGGGGAGCTTTCTTGAAATCAGAGGGAAACGGCATTGCCGTCAATCAGGGAAGCAGTGCATCGTTCTAAACACTTATTAGGAGGGCAGTATTGCCTTTTTTGGAAAGGGTGGAGCTCACTGTGCCACTATATTTGAGGAATGTCTCAAAACCTTCACACAACCTCTTGGTTAAATTGTCTAAGCTGGCTGCTGCTGCTGCTGCTGCTGTTTGAACACCCAAGTACAGTTGACACAGGTGCGGTTGACTGGAGAGTCTTTAAGTACCGTAGTCTGTCAAACTCCTATTGTGGGCCTTTATTCGTATCTCCCGTTATCTCCTGGTAGTTTGGAAGATGCGAAGTACGAGGCAGGCACAGACGTACGAACTGTAAAATGCGTTCACATCGAGATAGCCATAGATCTGCGAGGTCATACTCCGATAAAACGCCGTAAAGACGTATTGTTTACTTCCGACGAGGCACGGTTGGGCGAAAGTGAGATGGACCGATTCCCCAGCGAATCCAGCTCAGCTGCCGTTACAGCTGCAGTATGAAGCACTCTGATCCTCAAGTCTGAGAGGATAAGTGCTGGAACAGACTACGTCCTAGTAAGAACACCTTGTTAAGAGAAGGAAAACTCATTGGACAATGCAGCAGCTTGAGCGATGAGGAAAGTTTCGAAAACCTTGTGTCAGCTCCAAACTGTTTTTTGATGCTTTTACAATCTGCGAGAGTTTTATTCACCAGCAACATCCGGGGGGCTCTGTGGGTGAAGCTGCCTCGCGGTTCTGCATTCTCGGTCATACTCTCTATCTCGAACTTGATACATGCTGCACTGAAGGCAGAGTCCAGTGGTCGACAGCAACGCCTCAGAACCTCAAACTCCTCGGTGGAGTTTCACTGTTACTTACATTACAACCTCTTGAAGGGGAATCGCTTTTCCGTTACGTACCGTCAACCAACCTGGACAATTACGAGGACTTACACGAGCTACCACAGGTAAACCGTCAGAGAACGGGCGAAGCCACTGTACGATATCAACGAGTGCCACCGCACGTATTGTCCTGCCAATCAGTGACATTTTCAAGTATCGTTGTTTTGCGAAGTTGTCACTTGTCTCGGGATATTCCCTTGTGACCACCAAACAAACCTGTTCGACTTGGAGTTCTTCGCTTACCTGTGGTGGTCGAGGGTGGTAAATTTTAGTTTCGCAAGATATCTGAGAAAGTCAGGGTACGCTGTGACCTGAGCATCTCTAAGGTATTGATGCAATTTTTCTGTCTCAGTATCGAGGGAAATAGTTCCTCCCAATTAGTTATTAAGCATGTTCGTAGACATCAGTTCTAAATGCACCTGATGCATTCAACTGCCAGCTTATCGAGAATGACAGCTCAGGTTTTCTTCATTCTTGGACATAAATGCCCGCCTCATTAATTTGGAGGAACTCACTTATAATCAACTTGATAATTTTCTCTCAGTCCTAATAGTGGG

CDS

>Mapoly0046s0102.1
ATGTTTCCCATGGGAGAGATGGAGGGAACGGGGGACAGTTATAGTGAGATAATGCAGAGATTGCAGTCATCATTAGCAGCATCGTCTTTCCCGAAGTCGAACGCCAACTCTCTTCCTCTTCCACAGGTTCCATCTCATACTCTGTCGAACTCGCAGGCAACCTTGTCTCAATCTCAAAGCCTCTTTCAGTCCCAGTCGCACAGTCTGTCACAAACTCCGAGCTCCTTTGCCAAAACATCTCCTTTCTTACACACTCAATCCAAGTCTCAGGCTCATCCTTCCCGCTCCCTCTCACAGCCACTGTCCCAAACGCACACTGCTCCTCATGCTCCCACCCATTCTCGCTCAATGTCACAGCCGTCTATCCGATCTCACATGCCGCCACTTCAGTCGCAAACTCCGCCTGTTCATGCTCACTCTCAGCATTCCCCTCACTCCCTATCTCAGCCGGCTTCTCAGTCTCCACATTCCTCTCTCCCTCTTCCGCAAGTCACACCTCGATTCCCATCGACCTCGCAAGCCTCTCCTCCTACCCTTCATACTCGTTCCCTCTCCCAGCCAACCATTCTCAATCAGACCTCCTCTGGCGGACCACTTTCGCCACCCTCAATGGGTCATCTTCCTCCTCCCAATTCCATGTCTCATTCTCTGTTCGCCAGCTTCAACAGTCTCACACCCAATTATCCCGTGAAGAAAGAAGCGTCGCAGTCTCTTTCGGACTCATCCGCGAGAACCACCGTGTCGCTTGATGTCACCATGGAGGAGAGTTCACCTTGCCCTCCTGCAGGGAGCGGACCTTCTTCTTCGAAACCCCTTTCCCCACCTTTGAATCCTTTTCATACCATGAGTCAAAGGTACAGCAATGATCTGAGCCAAATGCCGGACAGTCCTCCTAAGCGACGGGGGCATCGAAGGGCTCAAAGTGAAATTGCATTTCGACAGGGCTCTTCCTTCGAGAAAGAATTAAGAGACGAAAGCAGGGACTTTGACAGGGATTCTGTGAAGGAGTCGGATATGGAAAGGGAGCTCAATCAAGGTCGAGTGGATCTGGACGAGGATATGGACAGGGCTACCAGTTGGGGTAGGGAGAGGCACAGAGATAGGGAAGGAGAAGGAGAAGGTGCAGAAGATCTTTTCTCTATGTACATCGATATGGAGAAGATCAACAGTTTCAGCAACTCTGGAGCAGGCGATGGTGGGGACAGTGATAGAGAGAAGCCGATGAGCAGGGTAGACGCTGGCAAAGATCGGCTCAAAACACTTGCCGAGAACGAGAAACCAACCTCTGGAAGTGTGGATGAGAATCAGCGAGATCGCTCCCGTGGGCCTGTAGAAGGTGACAAGGAGAGGAGCAGAGAAAGTTGGATGAAAACTGTCTCTGATAACGATCGAGAAGGCAGAAACACACCCGCAACCGAAGAGGAGAAAGGTGACAAGAACCGGGTAGATGAGTTGAGAACCAGTGAGAAACAAAAGGAGAAGGATGATCAAGAGATGTCCAAAGGTTCCGAAAGAGAGAACTGGTCCAGAAAGGATGAAGAAGACGATAAGGAAACTTCAAGTATGTGTGTCGAGAATGAGGGTGGCAAGGACAGATCAGATAATGAGCGAGAGAAGGGTAAGCTTGACAGAAGCTCGCCCAGTGGTGCCACTCACCACTCACGGAGCGTTTCCATGGATGGGTTCCTGAGCAACTTACAAGGATACAAGGCTGGTGACGCTGGCCATCTTTCCTCTTTCTCTGAAGATCGGAGGAGTAGACAGACTAGACATCATCACAGCATGTCCATGGACGGTAGTATGAGCCTGAAGATGGAATTTGGGCAAGGAGAGTTTGAGGGTATCGAGTTAAAGAAGGCCATGGCCAGCGACAAGCTAGCAGACCTTGCTCTGGTCGATCCCAAGCGGGCTAAGAGGATCTTGGCTAACCGGCAGTCGGCAGCACGCTCGAAAGAACGTAAGATGAGATATATATCTGAACTTGAGCGGAAGGTGCAGACTTTGCAAACGGAGGCGACAACACTATCCGCCCAACTCACAATGCTACAGAGAGACTCTACCGGGCTCACAACAGAAAATAGCGAACTAAAGCTTAGGTTGTCAGCAATGGAACAACAAGCACAACTTCGCGATGCTCTTAATGATGCATTGCGAGAGGAAGTTCAACGGTTGAAGCTAGCAACTGGACAACTTTCAAATGGACAGGGAATGAGCTTGGGGCAGCAAATGGGTGTCAATCCTCAATTGTACCAGCTCCATCAACAACTGCAGCAGCAACAGCAGCCGCAAGGCAATCACCAACATCAACCGGTGCAGCAAAACTCCCACGCAGACTTTCTTCAGCGTAGTGCATTTGGCGCACTTCAAGGACTTGCCGGGTCTCTTGGGGGAGCTTTCTTGAAATCAGAGGGAAACGGCATTGCCGTCAATCAGGGAAGCAGTGCATCGTTCTAA

Protein

>Mapoly0046s0102.1
MFPMGEMEGTGDSYSEIMQRLQSSLAASSFPKSNANSLPLPQVPSHTLSNSQATLSQSQSLFQSQSHSLSQTPSSFAKTSPFLHTQSKSQAHPSRSLSQPLSQTHTAPHAPTHSRSMSQPSIRSHMPPLQSQTPPVHAHSQHSPHSLSQPASQSPHSSLPLPQVTPRFPSTSQASPPTLHTRSLSQPTILNQTSSGGPLSPPSMGHLPPPNSMSHSLFASFNSLTPNYPVKKEASQSLSDSSARTTVSLDVTMEESSPCPPAGSGPSSSKPLSPPLNPFHTMSQRYSNDLSQMPDSPPKRRGHRRAQSEIAFRQGSSFEKELRDESRDFDRDSVKESDMERELNQGRVDLDEDMDRATSWGRERHRDREGEGEGAEDLFSMYIDMEKINSFSNSGAGDGGDSDREKPMSRVDAGKDRLKTLAENEKPTSGSVDENQRDRSRGPVEGDKERSRESWMKTVSDNDREGRNTPATEEEKGDKNRVDELRTSEKQKEKDDQEMSKGSERENWSRKDEEDDKETSSMCVENEGGKDRSDNEREKGKLDRSSPSGATHHSRSVSMDGFLSNLQGYKAGDAGHLSSFSEDRRSRQTRHHHSMSMDGSMSLKMEFGQGEFEGIELKKAMASDKLADLALVDPKRAKRILANRQSAARSKERKMRYISELERKVQTLQTEATTLSAQLTMLQRDSTGLTTENSELKLRLSAMEQQAQLRDALNDALREEVQRLKLATGQLSNGQGMSLGQQMGVNPQLYQLHQQLQQQQQPQGNHQHQPVQQNSHADFLQRSAFGALQGLAGSLGGAFLKSEGNGIAVNQGSSASF

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>