Mapoly0048s0045



Description

AP2 domain

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
PFAM PF00847 AP2 domain
PANTHER PTHR32467 FAMILY NOT NAMED
PANTHER PTHR32467:SF7

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpAP2L3 transcription factor, AP2/ERF Mapoly0048s0045.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0048s0045.1 scaffold_48:370495..378104  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0048s0045.1  

Gene structure:

mRNA scaffold_48:370495..378104  ( - strand )
three_prime_UTR scaffold_48:370495..371046  ( - strand )
CDS scaffold_48:371047..371292  ( - strand )
CDS scaffold_48:371537..371661  ( - strand )
CDS scaffold_48:371978..372090  ( - strand )
CDS scaffold_48:372216..372333  ( - strand )
CDS scaffold_48:372515..372645  ( - strand )
CDS scaffold_48:372945..373074  ( - strand )
CDS scaffold_48:373223..373362  ( - strand )
CDS scaffold_48:374737..374866  ( - strand )
CDS scaffold_48:375153..375292  ( - strand )
CDS scaffold_48:375773..375902  ( - strand )
CDS scaffold_48:376164..376303  ( - strand )
CDS scaffold_48:376506..376629  ( - strand )
CDS scaffold_48:376798..376871  ( - strand )
CDS scaffold_48:377524..378035  ( - strand )
five_prime_UTR scaffold_48:378036..378104  ( - strand )

Sequences:

Gene

>Mapoly0048s0045.1
CTCGTGTTCTGAGACACGGATTGCGAGCGGAATGCGCTCTCCTGTAGCGGATTTGTGATTCGAACATCCATGGCGCCATTCTGCGCTCCATGCACAACGTCTGCCGCTGCTGCACGTTGTGCGGCGTTGCAATTCGGCGTGGGAGGTCTCGTCCAATCGAGCTCTTGTTGCGGTGGTAGCAATGTCGCGGATTTCCGAGTTCGCGAAGGCCGTGACGGCAAGCCTCGAGATGCAATGTTGTGCTCGCGGAGTGCGGGGATTTACGAGCTCGGAGGATTCGGTCGATTGAGTTTGCGGGATGGAGATGAATTTGTGCGGACGCTGGCAGCTGCTGGCACTGGCGGCGTTTGGTTCCGCAAAAAAAGGCGCTGGAAAGCTGCAAATTCGTCGTCTGCCAATGTGATCTGTGAAGTTAGTGGCGGCATTGGAACCGAGACCGAGGTTTTCGAAAGCCGGGTGCTCAATGTCTCGGTTTCTGTTTCTTCCAGCTCAAGCTCCTCTCCCTCTGGGTCTGCCGATGCCGCTTCGTCCAATCAAGTTGTTGCCAGTGAATCCATTTTCTTATCGTCGACCGAGAAGAGGTGACGGCATTTCCTCGCTCCCCACCGTTTCTCTCAGGCGCAGTTCTACTCGTGAATCTGAAAGTTGCCGAGAAGCCTAAGTAGTGCTTTTGCACTTGCCAAATTGGTTTCCTCGCTGAAATTAGAGGACAGGTAGTCATGGTCTCTCGTCTGATCAGCGCATGAGCCTGTTTTTGAATTTAGTCCTAAATTTGTACAAATTGAATCTCCACCCAATTTCACCAGAATTCTATATCGCAAGCTCAATTCACCCGGATGGGCCAATTTTTGAAACAGAAGTATTTAGCTTCTGTGAAGTACTTCGTTTCCACGTCTTTTAGCCACCGAATGTTGTTGCATTTGTTTCAATATCGAATTCGGTGGAACAAGCTGTTGGTGGAAATGGTTTAAGCGGGCATGACAGTTTATGGGAACTAGCCGACGATATCTCCCCACTTGTTCCAAACTGGGTAATGTGTGCTAGGACTCGTCAACGTCCAGGCCTGTGTTCGTTACTTCCAGCTACTGTGCTGATCGAGATGGTAAACCGTAGCTTTAGTTTGTGAACTCTGAAATTGGCTGTACGACTGCCGCTGCCTTTTTGGTTATGTGCTGAACTGACTACACGTCTGGCGTATACCCCAACTCATGGTGGAGAGTGTTAATTGTACAGGGAGGAAGATACCCGTGGTACTCCAGAAAGTGTGCTAAAAGACTCCAGTAACATCGAATCTGATAAGTCGCAAGGTATGATATTGCCTTTTACGTCGTATTGCTAATACTTGTCAGGGTTTGTTTTCTTGAGATCCAGTCCTTTACCTTCTGGATTTTCGCAATGTCTTACTGAACCTTACGTATCAGCAAGTATATGAACTTTGTCAGGGTTTGTCATGCGTTGGCTGGATGTACATTCAGGAGGCACGAAGTATTTTGGGGTTCAGCCAGTACGGGGCAGATTTGAAGTGGAGTTGCAAAAGGATGGAGTAGTGCACAAATTGATTTTTTTGTCTCAAGAAGAGGCTGCAAGATCCTACGACAAGTAAGAAAGAGCATTATTCCACGCAGAGGAAGCCCTTTTCATCGATATTTGTCACAGTTGTCACGAAGGCTGCTAATTTTTTTGGCCTGACATTCGCCTTCGTTCTTCATGAAAATGGACGCTAGTTGAGATTCGCTGGATCTTTTACGGTATACTGATGTTGCCCGCGCTGTTTGTTTTTTTTCTTTTAAATAATTTCTAGAGCTGCATTCAAACTCAGCGGAAGATCTGCGCGACTCAATTTTGACTTGACCGAGGAAGAAAAGCTGGAAATACAAGGCACTGGATGGGAAGACCTATTGTTGAAGATGCAACTTCAAGCTCTCTCGGAGAATTCTCCGGGTAGGTGCAGAGACGTTCCTCCTCTGCCATCAAGTATGGATCTATGCTCAACAGGAGTCTGACCAGTGTGGAAATTTAATCAGGGCAACCATTCGGTGATGATTTCATTAGCTGCCTGTCGTAGTTACAAAACCGAATGACGTGGTTGGGTAGGCTCACGTTGGAATTATGGATACGTCTGATGTTTCTTGGCGACTTGCCTCTGATCAGACTGCTGCATGTGGGGTGGACTTGCGACTAATTCTGGGCTGTGTCCTGCAGCTGGACTTGGATTTCCTGGTGTTCAATTTAAAGAGGACGAGCAGTTGTGGCAAGCGAAGATAAGGCATGACAAGGAAAACTACGTGGGATATTTCACGACTATGAACGATGCCACTAAAGCCTATGACTTGTAAGTAGAGCAACTTCAATTCGAGATTATATTCAGAGTGGAGTCAGACTGTAGATACTAGAATCGCTCTTGTGTTAATTTGAGGTTTCTTCGACGCGTACTTCAGTTTGGTAAAATAGAAATTTGGGCTGAACATTGTACCTTTTCAAGGAGGCAACCAGGATTGAATTGATGACCTATCGGACTGCAGCCGATTGCTCTACCACTGAGCTATACCTCCTTGTTACGAAGCTGGCTTCCAAGGCCATCTTACAGTCTGTGTCAAGCGACTCTTAACGATGCTCCTTGGAATTGTTTCCATTATATAGAATGCAGCTAACATCAATCAGGGGGAGGGAATTTCCTCTTACGAAAATGTACAGAATTAATGGGTTATCGCAAGTGCAATTATCCATCGTCAACCTTGGATTTGTCATCTTGGTTTACAAGTGTAATGTACGCGGTTATATCCTGACATTTCTTTGATTTGAGCGGGCGCAGAGCAGCTTACAAGCTTCATGGCAGTCATGCCCTTTTGAGTCAACCTCTTACTGCTAGTGAAAAGAAAGAGCTTGCAACAATGGACTGGGACGCACTTGTCGTAAGACTTGGTTTGGAGATCCAAGCTCGCAGAATTAGACGTATGTGATTGTGCTTTCACATAGCCAGTGTTTCCGTCGTGCTAATTATTGATCGCGAAGTCTAGATTGTCGATGATTGATCAGTCAATTTAATCAACCTATAACTTTAAATACGATTCATAATATCTGGACCGAAATGTAAGAAAGCACTGCACTAGTGAATTTTATCAGTTATTTATAACTGTATTTATTTATTTGTTTTCCCCTCTTTTCGCTTATAAAGGAATATGGTAATGCGATATCAATCTTGCTTTAAAGTTCTGAATTGTTGACTTCATTGTTGCAGGAAATTCCGGTTGTCGCGGTGTCCGTCTCACAACTTCTGGGGGTTGGCACGCTAGCTTCACCTACAAAAGCTATTATTTTTATCTAGGCACCTTCAAAACCAAAGAAACTGCAGCCAAAGCATATGACTTGTAAGTTCTTTTCATAATCTGAACTCTGTGGCACCAATTGATTAGGATGTCTTTTAGATGCTTCGGAGTCAATAGGACCATCAGTACGTGGTGCTCCTATTGACTCTCCTCTATTCTCTATTGTCCTGTTAATTGTAACACTAATGTTAAGACTCTTTTGATTGCTCTTTTCAAGTTTGAATCGTCATCAACTTGAAAGTCAGTTAGAATATAAATTAATTTCTACTTCTGACCAATTCCGCTTTTAAAATTGCAATTAGTACAGGAGGAAAAGATCATTTTGACGGTTTGTATCATGAATGATGTTTTAGCGATATATACAAGAGATGCATGATTCAAACTTGAAATTGAGGTCATAACTCGAATCTTAATCTTAATCTTGAGGTGGCCAATGGCCGCCACTCTACTTATTCCATATATTAAATTAGTATTTACTAATTCAATAAATGGAAGAAGTATGTAATAGTTAATATTGTTACAGTTAATAGGTAGACTTACTTGTTAACTATCTACGGTTTTTACCCTATGTAAAGAAAAAGAGATTGACTATAAGATTAACAAGTTAACGATTCTCACGTAATGAGAGGTAGGTATATCTTGCGCACTTTATGCGTTTCTCTCGAGGAAGTTTGAGTGAGCACAGCTACAGTCATGTTCTTGGTTGTACCGAGTCAGAGACATGACTGTAGCTGTGCTCACTCAAACTTCCTCGAGAGAAACGCACTAAAATGCGCATGATCACTTACAAGTAAGTGATCTTAAGAAGCTTTGGTGGAGTTAGAATTCTGGTTGGTTTTTGAGTTGGTTAGCTATAGTTTGTAAGCAGTCCCTCAAGTCGAGTATGAAAAACACTAAGGTCATGACTTTATGGACATGTGAACTGAAACGAACTCAAAAACCAACCAGAATTCTATCTCCACCAAAGCTTCTTAACATCACTGACAAGATGTGTACGCCAGTGTTCTTACAATATTTACGCAGTAATGTCTCAAACTTGATCCTGAATTCTTAACTCGAAGAACTCAGGATGAAGTTAAGACAGAAACAGATGTTACTTCTCCGTGGGAGTCACTTGACGTAATTTTTAATCCCACTGAGATTAAGAATTACATCAAGTTACTTGTACAGATTTTATCTTGGAATGAAGAGTGTCTTGTAGAGCATAAAAAAATTTTGCTATCAGTTAACCTCCTCATTTCTTCCTTCATGATCATGTCTACCTGGACTTTTCGTTACGACGATGCTTTTATGTCGGATGGTAATGTTGTACTGCTGCTCAGTGGGTTCACACTACGAAGCACGTTGAGCGTTAGTTTCTAAATTCGGCGTTGTGAAGGCTGACGACTTCGTAACAAAAATCATCGAATGTGGCAGGTTTGCATCTAAGCTCATTGGTGAGAGGGCCAAGGTTAACACGGAACTTAATCCTGAAGAACTGGCTTTTCTGTCAACACACTCTGTTAACAGTCTGCGCGAGTACCTGGCTGGTCAAGCGATGTTGGCACCCAAACAAGGTAATTGCGCTATTGCGTCAACGACTTGAGTATGATACATTCGTGACATTGTGACATTTCACAACGATCATGAGCAATCGTGGGAGGAACTTCCACCTTTTTACTGTTTCAGGGAAAATGTTCAATTGAATAACTGTCTGTGATGTAGCTTTTCTTGGAGCGCGAGGGGCACGTATGGTACAAGGCCGATGGGAAGTCTGTTTAGAAAACGCAAGGAAAGATCGTATTTTTACCTCGTCCGTCTCGAGTGAAGTTGAAGCCTTGAGAGTTCATGATCTGTAAGTACTTTTGCCCTTTTTCTTCTGTTCGCTCGACGGAGACTGCTACTTTTGGTGGTTGAGTTGATGAAATTGATGTCCATCTGTCTAAATGTGGGGTCAGTTTCATCCTCCATGTAATTTGGACGAATAGCTCAGGCGTCTATAATTACGAAGGTATTTGTGGACTTGCTCCTTTGCATGGTTACTTGCATCACAAAATTGTTCCAAGAGTTTTCTTCATAGGCTACTGCCTGGTTCCACTAATATTGAGTGTCGAATACTTTATTCTTCCTTCTAACTGTAAGTCAATCCTGCAGAGCCGCTTACAAGCTGCATAACGAGCTGGCAAAAACCTATCAAGAGCTATCTCAAGTCGAGAGACAGGAGGTGGAAGCTGCTGACTGGAGTTCTGTGGCTGCAAAGTTGGACCTGCAGCAACTACCATCATGTGCCTTACTCACCATTCTCCCTGTTGCGATTAGTGTTTGAGGATGTTCTGCTCAGTTGTAATCATGAGTACTCCAATCGTTTGTTTGCTCTGTGGATGTCAGTCGCGTGCACCTCGTTCTTCCGTTGTGTTGACGATCTTGAGGAGTCTTGGCTGCTAACCAGCTTTCGTTCTCGAGCAGATCATGGCGTTAACCGTCTCATTTCCGGCATGTGGCAAAGCTATATCCGTCATGGTGGTGCATATCTTGCCGTTGGTACTTATGATTCCTCTGAAGTGGCAGCTCGGGCCTCAGACATGTGAGCTGAATTTGAACCTCCAGTATTGGGTTCCACCTCGTTTTGTCGCCAAAGGCAGCTACAGGGTTTAGTAATGGTTTATGCCCTAGGTGCTTACGCTTCCAGTTTCGTCCAATTGGTGCCAGGTGCACTTACAAGCTTGAAGGGAGGAATGCGATTCTAAATTTTCCTCTTACTGAGTTACAACGGAGAGAAGTTGAAGCCATGGATTGGGGTAAACTTATACTAAGTCTTCGAGGTACGACTTACCGCAACTTTGTAGATTCTGCTACTGTGTTAGCGTGTTATGGAGAAATCAATTCAAAATCCAAAAGTTTTCCAAGTGTTAGCACGGTTTACGCTCGCTGGGCACTGAATAGCTGCTCGTCGACTGTTCGAGAAGTCCTGTGTAGCGTGTGCTTCAACGTTCAGCTCCAGTGATTAAACAATCTTCAGCTAGATATGACGCGGTATAATTTGAGTATACCAGCCATTTCGTCCATATATACCTGTATGCAGTAAAAAACTCTTACTTGACTTGGTCAGTGACTCACTTGTCTTCTTCTTTTTTCCAGAGATGCAAATAAAATCAGATGTGGATGAGGAACTGGGCGATCCTAAATCTCTTGCCATGGAAGATGTTTCAAGGGAGAAAAAGTGGACGATACTGCTGTGTCATGAGCAACTTTTGCAACAAAGGGTAATGAATGACTACCCTGCGTTCTGTGCCAAGGTTTTACTGAATTGAAGAGATGCAGAATCTCATGAAGAGATTCGTTCTAACTTCACGAAAAGATAGTTTAACGTATGCAAGTTGTGAAGTTGATGTCCTGTATGCGTCAAGTCCTTTCATTTACTGTCTCACTTCAAGAGGCAGTGATAAGTGTTGGATGTTTAGTGTCCGTGGAAAGGAGTTCTGACTTGGAAGAATATGTTCCCTTCAGATGATGAGACGAGCACCGAAAGTAGGTCGGCAGTTGGTAGTGGGCAACCCATCCATCGCGGCTCAGTTCTCTCACTTAAATCGTCGCCCCGATGGATCTCCTATGCTTGTGGAGGAGGTCATGGATGGAAGCAATACACCGCTTCTATGGAATTGCATTTGTGGTAATTTATTTTTGAAAGCTCCTGTTGGCCTGTTGAAGGCTAAACATGCCACATGTAGGATCGCAGGATGCCGAAAAAAGTGAATATATATACATATACATAGAAGTAGGAGATCGAAAGTTACCGAACCCATGGTGTTGATCACCCAATATTGTGATCAGAAAGGGAGCTTTTGATTCCATCCCTGGGTCATGATTATAGTGCAAGTAGGCTAGATATGACCGCAGTTAACCCTCGCTGTGGTCTAGAAGCTCAACAGATGTAGTGAAAAGTTGTGCATTTGTTCAGATCGGTTATAAACGAAGGTACATGCGTAATACGGCAGCAGTGCCCTGTGTCGTGCCACGAAGATAATTGAACTATCGACTATGAGCATGTTCAAGAGAGCCGTAAGAGTGCCACTGATTAACGTGCTCGACTTTCGTGAAAGAAGTATAAGAGTGTTGCCGAGAGAGCTTTTATCTTAGGGATTTAGCAGATCATATTTTGAGCCCTTCCTGTCACTCAGCAGTTGGGAACAGCATGTCGGTTTCTAGCATACAGTGTTGGATGAGTTCACATACTGCCTGTCAACACATTTTGAGTCACTTTAACATATATACTTTTTGTTACTTTAGATGGAGAAGATGTTATGG

mRNA

>Mapoly0048s0045.1
CTCGTGTTCTGAGACACGGATTGCGAGCGGAATGCGCTCTCCTGTAGCGGATTTGTGATTCGAACATCCATGGCGCCATTCTGCGCTCCATGCACAACGTCTGCCGCTGCTGCACGTTGTGCGGCGTTGCAATTCGGCGTGGGAGGTCTCGTCCAATCGAGCTCTTGTTGCGGTGGTAGCAATGTCGCGGATTTCCGAGTTCGCGAAGGCCGTGACGGCAAGCCTCGAGATGCAATGTTGTGCTCGCGGAGTGCGGGGATTTACGAGCTCGGAGGATTCGGTCGATTGAGTTTGCGGGATGGAGATGAATTTGTGCGGACGCTGGCAGCTGCTGGCACTGGCGGCGTTTGGTTCCGCAAAAAAAGGCGCTGGAAAGCTGCAAATTCGTCGTCTGCCAATGTGATCTGTGAAGTTAGTGGCGGCATTGGAACCGAGACCGAGGTTTTCGAAAGCCGGGTGCTCAATGTCTCGGTTTCTGTTTCTTCCAGCTCAAGCTCCTCTCCCTCTGGGTCTGCCGATGCCGCTTCGTCCAATCAAGTTGTTGCCAGTGAATCCATTTTCTTATCGTCGACCGAGAAGAGGGAGGAAGATACCCGTGGTACTCCAGAAAGTGTGCTAAAAGACTCCAGTAACATCGAATCTGATAAGTCGCAAGGAGGCACGAAGTATTTTGGGGTTCAGCCAGTACGGGGCAGATTTGAAGTGGAGTTGCAAAAGGATGGAGTAGTGCACAAATTGATTTTTTTGTCTCAAGAAGAGGCTGCAAGATCCTACGACAAAGCTGCATTCAAACTCAGCGGAAGATCTGCGCGACTCAATTTTGACTTGACCGAGGAAGAAAAGCTGGAAATACAAGGCACTGGATGGGAAGACCTATTGTTGAAGATGCAACTTCAAGCTCTCTCGGAGAATTCTCCGGCTGGACTTGGATTTCCTGGTGTTCAATTTAAAGAGGACGAGCAGTTGTGGCAAGCGAAGATAAGGCATGACAAGGAAAACTACGTGGGATATTTCACGACTATGAACGATGCCACTAAAGCCTATGACTTAGCAGCTTACAAGCTTCATGGCAGTCATGCCCTTTTGAGTCAACCTCTTACTGCTAGTGAAAAGAAAGAGCTTGCAACAATGGACTGGGACGCACTTGTCGTAAGACTTGGTTTGGAGATCCAAGCTCGCAGAATTAGACGAAATTCCGGTTGTCGCGGTGTCCGTCTCACAACTTCTGGGGGTTGGCACGCTAGCTTCACCTACAAAAGCTATTATTTTTATCTAGGCACCTTCAAAACCAAAGAAACTGCAGCCAAAGCATATGACTTGTTTGCATCTAAGCTCATTGGTGAGAGGGCCAAGGTTAACACGGAACTTAATCCTGAAGAACTGGCTTTTCTGTCAACACACTCTGTTAACAGTCTGCGCGAGTACCTGGCTGGTCAAGCGATGTTGGCACCCAAACAAGCTTTTCTTGGAGCGCGAGGGGCACGTATGGTACAAGGCCGATGGGAAGTCTGTTTAGAAAACGCAAGGAAAGATCGTATTTTTACCTCGTCCGTCTCGAGTGAAGTTGAAGCCTTGAGAGTTCATGATCTAGCCGCTTACAAGCTGCATAACGAGCTGGCAAAAACCTATCAAGAGCTATCTCAAGTCGAGAGACAGGAGGTGGAAGCTGCTGACTGGAGTTCTGTGGCTGCAAAGTTGGACCTGCAGCAACTACCATCATATCATGGCGTTAACCGTCTCATTTCCGGCATGTGGCAAAGCTATATCCGTCATGGTGGTGCATATCTTGCCGTTGGTACTTATGATTCCTCTGAAGTGGCAGCTCGGGCCTCAGACATGTGCACTTACAAGCTTGAAGGGAGGAATGCGATTCTAAATTTTCCTCTTACTGAGTTACAACGGAGAGAAGTTGAAGCCATGGATTGGGGTAAACTTATACTAAGTCTTCGAGAGATGCAAATAAAATCAGATGTGGATGAGGAACTGGGCGATCCTAAATCTCTTGCCATGGAAGATGTTTCAAGGGAGAAAAAGTGGACGATACTGCTGTGTCATGAGCAACTTTTGCAACAAAGGATGATGAGACGAGCACCGAAAGTAGGTCGGCAGTTGGTAGTGGGCAACCCATCCATCGCGGCTCAGTTCTCTCACTTAAATCGTCGCCCCGATGGATCTCCTATGCTTGTGGAGGAGGTCATGGATGGAAGCAATACACCGCTTCTATGGAATTGCATTTGTGGTAATTTATTTTTGAAAGCTCCTGTTGGCCTGTTGAAGGCTAAACATGCCACATGTAGGATCGCAGGATGCCGAAAAAAGTGAATATATATACATATACATAGAAGTAGGAGATCGAAAGTTACCGAACCCATGGTGTTGATCACCCAATATTGTGATCAGAAAGGGAGCTTTTGATTCCATCCCTGGGTCATGATTATAGTGCAAGTAGGCTAGATATGACCGCAGTTAACCCTCGCTGTGGTCTAGAAGCTCAACAGATGTAGTGAAAAGTTGTGCATTTGTTCAGATCGGTTATAAACGAAGGTACATGCGTAATACGGCAGCAGTGCCCTGTGTCGTGCCACGAAGATAATTGAACTATCGACTATGAGCATGTTCAAGAGAGCCGTAAGAGTGCCACTGATTAACGTGCTCGACTTTCGTGAAAGAAGTATAAGAGTGTTGCCGAGAGAGCTTTTATCTTAGGGATTTAGCAGATCATATTTTGAGCCCTTCCTGTCACTCAGCAGTTGGGAACAGCATGTCGGTTTCTAGCATACAGTGTTGGATGAGTTCACATACTGCCTGTCAACACATTTTGAGTCACTTTAACATATATACTTTTTGTTACTTTAGATGGAGAAGATGTTATGG

CDS

>Mapoly0048s0045.1
ATGGCGCCATTCTGCGCTCCATGCACAACGTCTGCCGCTGCTGCACGTTGTGCGGCGTTGCAATTCGGCGTGGGAGGTCTCGTCCAATCGAGCTCTTGTTGCGGTGGTAGCAATGTCGCGGATTTCCGAGTTCGCGAAGGCCGTGACGGCAAGCCTCGAGATGCAATGTTGTGCTCGCGGAGTGCGGGGATTTACGAGCTCGGAGGATTCGGTCGATTGAGTTTGCGGGATGGAGATGAATTTGTGCGGACGCTGGCAGCTGCTGGCACTGGCGGCGTTTGGTTCCGCAAAAAAAGGCGCTGGAAAGCTGCAAATTCGTCGTCTGCCAATGTGATCTGTGAAGTTAGTGGCGGCATTGGAACCGAGACCGAGGTTTTCGAAAGCCGGGTGCTCAATGTCTCGGTTTCTGTTTCTTCCAGCTCAAGCTCCTCTCCCTCTGGGTCTGCCGATGCCGCTTCGTCCAATCAAGTTGTTGCCAGTGAATCCATTTTCTTATCGTCGACCGAGAAGAGGGAGGAAGATACCCGTGGTACTCCAGAAAGTGTGCTAAAAGACTCCAGTAACATCGAATCTGATAAGTCGCAAGGAGGCACGAAGTATTTTGGGGTTCAGCCAGTACGGGGCAGATTTGAAGTGGAGTTGCAAAAGGATGGAGTAGTGCACAAATTGATTTTTTTGTCTCAAGAAGAGGCTGCAAGATCCTACGACAAAGCTGCATTCAAACTCAGCGGAAGATCTGCGCGACTCAATTTTGACTTGACCGAGGAAGAAAAGCTGGAAATACAAGGCACTGGATGGGAAGACCTATTGTTGAAGATGCAACTTCAAGCTCTCTCGGAGAATTCTCCGGCTGGACTTGGATTTCCTGGTGTTCAATTTAAAGAGGACGAGCAGTTGTGGCAAGCGAAGATAAGGCATGACAAGGAAAACTACGTGGGATATTTCACGACTATGAACGATGCCACTAAAGCCTATGACTTAGCAGCTTACAAGCTTCATGGCAGTCATGCCCTTTTGAGTCAACCTCTTACTGCTAGTGAAAAGAAAGAGCTTGCAACAATGGACTGGGACGCACTTGTCGTAAGACTTGGTTTGGAGATCCAAGCTCGCAGAATTAGACGAAATTCCGGTTGTCGCGGTGTCCGTCTCACAACTTCTGGGGGTTGGCACGCTAGCTTCACCTACAAAAGCTATTATTTTTATCTAGGCACCTTCAAAACCAAAGAAACTGCAGCCAAAGCATATGACTTGTTTGCATCTAAGCTCATTGGTGAGAGGGCCAAGGTTAACACGGAACTTAATCCTGAAGAACTGGCTTTTCTGTCAACACACTCTGTTAACAGTCTGCGCGAGTACCTGGCTGGTCAAGCGATGTTGGCACCCAAACAAGCTTTTCTTGGAGCGCGAGGGGCACGTATGGTACAAGGCCGATGGGAAGTCTGTTTAGAAAACGCAAGGAAAGATCGTATTTTTACCTCGTCCGTCTCGAGTGAAGTTGAAGCCTTGAGAGTTCATGATCTAGCCGCTTACAAGCTGCATAACGAGCTGGCAAAAACCTATCAAGAGCTATCTCAAGTCGAGAGACAGGAGGTGGAAGCTGCTGACTGGAGTTCTGTGGCTGCAAAGTTGGACCTGCAGCAACTACCATCATATCATGGCGTTAACCGTCTCATTTCCGGCATGTGGCAAAGCTATATCCGTCATGGTGGTGCATATCTTGCCGTTGGTACTTATGATTCCTCTGAAGTGGCAGCTCGGGCCTCAGACATGTGCACTTACAAGCTTGAAGGGAGGAATGCGATTCTAAATTTTCCTCTTACTGAGTTACAACGGAGAGAAGTTGAAGCCATGGATTGGGGTAAACTTATACTAAGTCTTCGAGAGATGCAAATAAAATCAGATGTGGATGAGGAACTGGGCGATCCTAAATCTCTTGCCATGGAAGATGTTTCAAGGGAGAAAAAGTGGACGATACTGCTGTGTCATGAGCAACTTTTGCAACAAAGGATGATGAGACGAGCACCGAAAGTAGGTCGGCAGTTGGTAGTGGGCAACCCATCCATCGCGGCTCAGTTCTCTCACTTAAATCGTCGCCCCGATGGATCTCCTATGCTTGTGGAGGAGGTCATGGATGGAAGCAATACACCGCTTCTATGGAATTGCATTTGTGGTAATTTATTTTTGAAAGCTCCTGTTGGCCTGTTGAAGGCTAAACATGCCACATGTAGGATCGCAGGATGCCGAAAAAAGTGA

Protein

>Mapoly0048s0045.1
MAPFCAPCTTSAAAARCAALQFGVGGLVQSSSCCGGSNVADFRVREGRDGKPRDAMLCSRSAGIYELGGFGRLSLRDGDEFVRTLAAAGTGGVWFRKKRRWKAANSSSANVICEVSGGIGTETEVFESRVLNVSVSVSSSSSSSPSGSADAASSNQVVASESIFLSSTEKREEDTRGTPESVLKDSSNIESDKSQGGTKYFGVQPVRGRFEVELQKDGVVHKLIFLSQEEAARSYDKAAFKLSGRSARLNFDLTEEEKLEIQGTGWEDLLLKMQLQALSENSPAGLGFPGVQFKEDEQLWQAKIRHDKENYVGYFTTMNDATKAYDLAAYKLHGSHALLSQPLTASEKKELATMDWDALVVRLGLEIQARRIRRNSGCRGVRLTTSGGWHASFTYKSYYFYLGTFKTKETAAKAYDLFASKLIGERAKVNTELNPEELAFLSTHSVNSLREYLAGQAMLAPKQAFLGARGARMVQGRWEVCLENARKDRIFTSSVSSEVEALRVHDLAAYKLHNELAKTYQELSQVERQEVEAADWSSVAAKLDLQQLPSYHGVNRLISGMWQSYIRHGGAYLAVGTYDSSEVAARASDMCTYKLEGRNAILNFPLTELQRREVEAMDWGKLILSLREMQIKSDVDEELGDPKSLAMEDVSREKKWTILLCHEQLLQQRMMRRAPKVGRQLVVGNPSIAAQFSHLNRRPDGSPMLVEEVMDGSNTPLLWNCICGNLFLKAPVGLLKAKHATCRIAGCRKK

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>