Mapoly0048s0099



Description

STEROL REGULATORY ELEMENT-BINDING PROTEIN

Reference DB

Database ID Description
OrthoMCL OG5_244115
PANTHER PTHR12565 STEROL REGULATORY ELEMENT-BINDING PROTEIN
PANTHER PTHR12565:SF74

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH42 transcription factor, bHLH Mapoly0048s0099.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0048s0099.1 scaffold_48:1220358..1222509  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0048s0099.1  

Gene structure:

mRNA scaffold_48:1220358..1222509  ( + strand )
five_prime_UTR scaffold_48:1220358..1220967  ( + strand )
CDS scaffold_48:1220968..1222098  ( + strand )
three_prime_UTR scaffold_48:1222099..1222509  ( + strand )

Sequences:

Gene

>Mapoly0048s0099.1
CCAATTGCCCTGTGCCCTCCCAGTCAGATCGCGCTCGCCCGGAACCCGTCTCCGCTCCGCTCCTCCTTCCCCTCCTCTTCTCACGCGACCAACGGAACCAACCTCTCGACGATTCGTTGGGCTTTTTTTATAAAGCAGTATCTTCAGCACTAACACCGCCTTTTTCCCTGCAGGTGCCTGTCCCAACTCTACAAATCTCAAGTGGATGTGTCTTTTGCGCTGAACTGTTGAGGCGTTCGTTCCCAGACTCTCTTGCTCGCTCCGCTCCACTCACCGGCGGAATTCTTCGTTCATTCTCAGCTTCGGGGTTCTCTCGATTGCAGGTGTCACTACTCGTAGATGGTTGCACACGCCGCCTTTTTTCACTCTAGCAAATCATTGTATTGCTCGACGCCGGTCATCCTACACTACACTACTCCTTCACCTTTAAATGCGAACAACAGCAGGAAACACATGATTTCGTTCGCGGCGTCGCATTCACAGACTGACATTTTGTGACATACATCATTCTCGCTGAAATCTGCTCAACGTTTCCAGCTGCCGTGTCGCCGCCCGTCCGGATTACTTTCGGACTGTAACATATCTCTCGGGGCGTACGTGAAGACTGGAAATGTTCGAGGATTTGGATTTGGGTACAGCTTGTAAGAATTTTCAGAATCTGGCCGCTGATTTAGTAGAGCGGTGGCAGTCCCAGAAACCGTGTACAGAGTCGGGACGTTTTAACTACATCATGTTTGATCAGAGCGGGGGAAAGGGGCGGATCTTCCAGCACCCTTCTCGCCTGCTGCACGAGTTCCCGACGAGCTCTTCGTCGCCTCCGCAGCCTAACTCTCCAGACTTGTACCAGGACATGTCTCTCCAGGAGTTCGAGGACACTCTTCTGAGGAACTCTGTGCAGGACAAATGCGATCCCCGAATGGCGGCCTGCCGAGAGACGGTGGCTTCGGCCTACGCTGCAGTCCAGCAGCAGCAGCAAGACAAAAACGACGATCAGATTCGCCATCAAAATCCGACAGCTTTGTTTCCCGAGGAGGTTTACAGCGCATTTCAAGCGAGCGAGGAGGAATCCAGCCGAGCCGCAGGAGGAGGCTACCTGTACGAGGATGCCGACGACTTGGAAGCGCTGCTAGGATGCTCCGACGAGGAAGAGAGCATCACCGGCAATGCGCCGAGCAGCGAATTGACCTGCCATTTCGGCCTTCAGGAGGACGACAACATCCGACCGTGCGAGCCTTCGTCGAGGAAGAGGCCGTGCGTGTTGGACGAGGAGGTCGACTCGAAATTCAAGCGGCAGAGGTCGCAGGAGGAGGAGGAAGAGGAAGTCGAGGACATTTGCATCGGCACCTGCTCGTCGAGTGTCTCGGTGGTCGATGCCTTCAGTGGCGATTCCCTGGGTCCCCCTTGCGCCCTGGAGAGCGAAGCAGACGACTGTCTGGACGAGTCTGCGCTCGAGCTGCAAATGCTGTGCGACGACTTCGGCTACGAGATGCCTGAGGAGCAACAATGTAGCTCATGCAGCAAGGAGGACGGAGACGAAGGCGACTCGATCTCATCCGGCTCGGCCAGGAAGTCTAGGCGAGATAAGATTAAGAAGACCGTGAAGCTCTTGAGAAACATCATTCCAGGCGGAGATTGCATGGACACGGCCATCGTTCTGGACGAGGCTATACACTATGTGAAGTTGCTCCAATTGCAGGTTCAGACTTTGGAGGCCAAGAGGCTCGTCGAGAGAGTTCGGTGACCCTTGGGGCTCTTATCTGCTCGAATCTTCATCCTCTTCCTACCTAATTAGTCTTATTTCTCGGCGAGGGTTTAGCCTAGTGAACGCACGCCCCGAATATAGAGAGGCTCATACTCATCTCCCCGCTTTGATCACTACACCCTCCCCCACCCTTAGGAATCTTGTGAAAAGCTCTCTCTTGTGAAAATTTCTCTCCTTTTAATCCCGACATTGTAAGCATGTTAACATTCAAACGAAATTTTTTTTTTGTGTTCCAGCACTTCTCGCGCTTAGGGTCATTTTCAGATGAGAGGGCATCGTGAAGTCACTACTGTCTTCGCGTTATGCCCTGTGAAATCGCGGAACCCCTCGTTCACTCACGCAATTTGCTCAATGTTGCCCTCAGGCTATTTGTCAATATTCACTAAATGC

mRNA

>Mapoly0048s0099.1
CCAATTGCCCTGTGCCCTCCCAGTCAGATCGCGCTCGCCCGGAACCCGTCTCCGCTCCGCTCCTCCTTCCCCTCCTCTTCTCACGCGACCAACGGAACCAACCTCTCGACGATTCGTTGGGCTTTTTTTATAAAGCAGTATCTTCAGCACTAACACCGCCTTTTTCCCTGCAGGTGCCTGTCCCAACTCTACAAATCTCAAGTGGATGTGTCTTTTGCGCTGAACTGTTGAGGCGTTCGTTCCCAGACTCTCTTGCTCGCTCCGCTCCACTCACCGGCGGAATTCTTCGTTCATTCTCAGCTTCGGGGTTCTCTCGATTGCAGGTGTCACTACTCGTAGATGGTTGCACACGCCGCCTTTTTTCACTCTAGCAAATCATTGTATTGCTCGACGCCGGTCATCCTACACTACACTACTCCTTCACCTTTAAATGCGAACAACAGCAGGAAACACATGATTTCGTTCGCGGCGTCGCATTCACAGACTGACATTTTGTGACATACATCATTCTCGCTGAAATCTGCTCAACGTTTCCAGCTGCCGTGTCGCCGCCCGTCCGGATTACTTTCGGACTGTAACATATCTCTCGGGGCGTACGTGAAGACTGGAAATGTTCGAGGATTTGGATTTGGGTACAGCTTGTAAGAATTTTCAGAATCTGGCCGCTGATTTAGTAGAGCGGTGGCAGTCCCAGAAACCGTGTACAGAGTCGGGACGTTTTAACTACATCATGTTTGATCAGAGCGGGGGAAAGGGGCGGATCTTCCAGCACCCTTCTCGCCTGCTGCACGAGTTCCCGACGAGCTCTTCGTCGCCTCCGCAGCCTAACTCTCCAGACTTGTACCAGGACATGTCTCTCCAGGAGTTCGAGGACACTCTTCTGAGGAACTCTGTGCAGGACAAATGCGATCCCCGAATGGCGGCCTGCCGAGAGACGGTGGCTTCGGCCTACGCTGCAGTCCAGCAGCAGCAGCAAGACAAAAACGACGATCAGATTCGCCATCAAAATCCGACAGCTTTGTTTCCCGAGGAGGTTTACAGCGCATTTCAAGCGAGCGAGGAGGAATCCAGCCGAGCCGCAGGAGGAGGCTACCTGTACGAGGATGCCGACGACTTGGAAGCGCTGCTAGGATGCTCCGACGAGGAAGAGAGCATCACCGGCAATGCGCCGAGCAGCGAATTGACCTGCCATTTCGGCCTTCAGGAGGACGACAACATCCGACCGTGCGAGCCTTCGTCGAGGAAGAGGCCGTGCGTGTTGGACGAGGAGGTCGACTCGAAATTCAAGCGGCAGAGGTCGCAGGAGGAGGAGGAAGAGGAAGTCGAGGACATTTGCATCGGCACCTGCTCGTCGAGTGTCTCGGTGGTCGATGCCTTCAGTGGCGATTCCCTGGGTCCCCCTTGCGCCCTGGAGAGCGAAGCAGACGACTGTCTGGACGAGTCTGCGCTCGAGCTGCAAATGCTGTGCGACGACTTCGGCTACGAGATGCCTGAGGAGCAACAATGTAGCTCATGCAGCAAGGAGGACGGAGACGAAGGCGACTCGATCTCATCCGGCTCGGCCAGGAAGTCTAGGCGAGATAAGATTAAGAAGACCGTGAAGCTCTTGAGAAACATCATTCCAGGCGGAGATTGCATGGACACGGCCATCGTTCTGGACGAGGCTATACACTATGTGAAGTTGCTCCAATTGCAGGTTCAGACTTTGGAGGCCAAGAGGCTCGTCGAGAGAGTTCGGTGACCCTTGGGGCTCTTATCTGCTCGAATCTTCATCCTCTTCCTACCTAATTAGTCTTATTTCTCGGCGAGGGTTTAGCCTAGTGAACGCACGCCCCGAATATAGAGAGGCTCATACTCATCTCCCCGCTTTGATCACTACACCCTCCCCCACCCTTAGGAATCTTGTGAAAAGCTCTCTCTTGTGAAAATTTCTCTCCTTTTAATCCCGACATTGTAAGCATGTTAACATTCAAACGAAATTTTTTTTTTGTGTTCCAGCACTTCTCGCGCTTAGGGTCATTTTCAGATGAGAGGGCATCGTGAAGTCACTACTGTCTTCGCGTTATGCCCTGTGAAATCGCGGAACCCCTCGTTCACTCACGCAATTTGCTCAATGTTGCCCTCAGGCTATTTGTCAATATTCACTAAATGC

CDS

>Mapoly0048s0099.1
ATGTTCGAGGATTTGGATTTGGGTACAGCTTGTAAGAATTTTCAGAATCTGGCCGCTGATTTAGTAGAGCGGTGGCAGTCCCAGAAACCGTGTACAGAGTCGGGACGTTTTAACTACATCATGTTTGATCAGAGCGGGGGAAAGGGGCGGATCTTCCAGCACCCTTCTCGCCTGCTGCACGAGTTCCCGACGAGCTCTTCGTCGCCTCCGCAGCCTAACTCTCCAGACTTGTACCAGGACATGTCTCTCCAGGAGTTCGAGGACACTCTTCTGAGGAACTCTGTGCAGGACAAATGCGATCCCCGAATGGCGGCCTGCCGAGAGACGGTGGCTTCGGCCTACGCTGCAGTCCAGCAGCAGCAGCAAGACAAAAACGACGATCAGATTCGCCATCAAAATCCGACAGCTTTGTTTCCCGAGGAGGTTTACAGCGCATTTCAAGCGAGCGAGGAGGAATCCAGCCGAGCCGCAGGAGGAGGCTACCTGTACGAGGATGCCGACGACTTGGAAGCGCTGCTAGGATGCTCCGACGAGGAAGAGAGCATCACCGGCAATGCGCCGAGCAGCGAATTGACCTGCCATTTCGGCCTTCAGGAGGACGACAACATCCGACCGTGCGAGCCTTCGTCGAGGAAGAGGCCGTGCGTGTTGGACGAGGAGGTCGACTCGAAATTCAAGCGGCAGAGGTCGCAGGAGGAGGAGGAAGAGGAAGTCGAGGACATTTGCATCGGCACCTGCTCGTCGAGTGTCTCGGTGGTCGATGCCTTCAGTGGCGATTCCCTGGGTCCCCCTTGCGCCCTGGAGAGCGAAGCAGACGACTGTCTGGACGAGTCTGCGCTCGAGCTGCAAATGCTGTGCGACGACTTCGGCTACGAGATGCCTGAGGAGCAACAATGTAGCTCATGCAGCAAGGAGGACGGAGACGAAGGCGACTCGATCTCATCCGGCTCGGCCAGGAAGTCTAGGCGAGATAAGATTAAGAAGACCGTGAAGCTCTTGAGAAACATCATTCCAGGCGGAGATTGCATGGACACGGCCATCGTTCTGGACGAGGCTATACACTATGTGAAGTTGCTCCAATTGCAGGTTCAGACTTTGGAGGCCAAGAGGCTCGTCGAGAGAGTTCGGTGA

Protein

>Mapoly0048s0099.1
MFEDLDLGTACKNFQNLAADLVERWQSQKPCTESGRFNYIMFDQSGGKGRIFQHPSRLLHEFPTSSSSPPQPNSPDLYQDMSLQEFEDTLLRNSVQDKCDPRMAACRETVASAYAAVQQQQQDKNDDQIRHQNPTALFPEEVYSAFQASEEESSRAAGGGYLYEDADDLEALLGCSDEEESITGNAPSSELTCHFGLQEDDNIRPCEPSSRKRPCVLDEEVDSKFKRQRSQEEEEEEVEDICIGTCSSSVSVVDAFSGDSLGPPCALESEADDCLDESALELQMLCDDFGYEMPEEQQCSSCSKEDGDEGDSISSGSARKSRRDKIKKTVKLLRNIIPGGDCMDTAIVLDEAIHYVKLLQLQVQTLEAKRLVERVR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>