Mapoly0049s0030



Description

B-box zinc finger

Reference DB

Database ID Description
GO GO:0005622 Intracellular
GO GO:0008270 Zinc ion binding
PFAM PF00643 B-box zinc finger
PANTHER PTHR31717 FAMILY NOT NAMED
PANTHER PTHR31717:SF5

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBBX2 transcription factor, BBX Mapoly0049s0030.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0049s0030.1 scaffold_49:328745..331507  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0049s0030.1  

Gene structure:

mRNA scaffold_49:328745..331507  ( - strand )
three_prime_UTR scaffold_49:328745..329638  ( - strand )
CDS scaffold_49:329639..329845  ( - strand )
CDS scaffold_49:330271..330798  ( - strand )
five_prime_UTR scaffold_49:330799..331507  ( - strand )

Sequences:

Gene

>Mapoly0049s0030.1
GCTCGATCCGCTCGCTCGCTCAAAAGCCCGTCGGAGAATCTGCCCTCTTGCATTCAGCGCCTCGCTTGTCGAAGGCTCATTCACTCACTCACTCCTGCACCCGAGACGCTCCCCACCCCCGTCTCACGACACAAACATCAAACACTTCTCCTGCTCCGCCCTCGCACCCCAAGTCTTCTCTCCTGCAAGAAATCTCCCGCACCTTTACGCTGCGTCGATCGCCTGCGTGATCTTCCTCCTTCCTCCTTCCTCCACTTCGACCGAGCTCATTGTTTTTCCTGGTGCAATCGGCTTGGCATTGCACAGTGCACAGGCTGCTGTTGATTGGCATTTTCCTGGTGGAAGGTCCACTCGCACAGACGAATGAGGTTTTCCTTGTCTACCTGCATCAGTAGGGTAGGAGGAATGCGCCTGGGGAAATTGACAAGTCAGTCATTGGTTTCATAAACATCAGTCTTGCGCGTCATTCTTATACGACGTCGAGAACTGAGTTTCACGACATTTCCTCCATCAAGATCCCTGGATCGTTGTGCTGCGACAAGAGTGTGGCGTGGGATAACAATTTACCAGAACGGCGTTGCGAAATCCTGGCTTGAGCTTTTATAGTCGTCGAGGTCGTCATTTGGACTTGTACACCGGGCTTCGCGGGCTGCATTATAGAGGATCGAATTGAAGTTATTACCTGCAAGCAAGGCAGATAGAAGTTGAGATGGAAAAGAAGTGTGAACTTTGTGGAGATCGGGCAACACTTTATTGCGCTGCAGACGATGCCAACGTGTGCTGGAGCTGCGACGCGAAAGTTCACAGTGCGAATTTCTTGGTTGCACGACACGCTCGTTCCGTCTTGTGCGGACGTTGCTGCCAGGAGACAGACTGCAAGACATCAGGTCCCCATCCGTCTCCTCTTTCTCGTCTTTGTCCCCGCTGCAACCCCTCCACGACGGCAGCAGTCGTGAACGATTGCAACGGTGACAGTGAGGAAATGGAGAACAGCGAGACTCTGAGTTATCCGAGCGCTACCACTGAAGCGGCAGACTCAGGATGCACCTGTGCAAGCCAGGAGAGCCACACCGGTGAGCACTTATCCCGTCAAGGCAGAAGGAAGTCAGCCGTAGAGATGGTGGGGCGAGCAAGGGGTTCTCGTAGATTCCACGGTGCCGAAATTAAACGATTGTGGGGTGTCGAGCGAGGGAAAACTCTTCAAGGAAGAAGGATTCAGAAGAGGAGTAGCTCTCCAGTAAGTGTCATACCTGTGGACGAGGTGTCTTTGAGGTTGTTGAAGAGGACCTTAAGACCTGATGTTGTGGAGGAGCAGATAGACTTGTTGTCTCGGATCTGTGTTGCTGTGTAAGATGTTAGCGCAGTTACGAAGCCGGATCTGTTTTCAAGACCTTCATTCATCTGGAGACAGTAGTATTTTTTTATATGTGTAGTCAGGCACACACACATCTTCATAGTGATTATAGCTCGTCGGAGAAACTGGAACGCGATCGGGAATCTTCACCAGTTCTTGGTCCTCACTAATTCACTTTGTTTCATCGATACGGTAGTTGTCATACTTGTAAGAGCCAAATGTGAACTACTGCAGCGAAGACGACGATGTGGACGACTTTAGCTGCGCCGCTGACGTCTCTGTTGGTGTTGATGTACGTGCTCACCCAGACTGGATTGGTAATCCAAACCCTTCAACTGGAATCCCGCAGCCAGCGGGCTGATCGATCTTTCGGGTACGGATCCGGAGTGGGAAGCAACTCAGTATCGCCGACGAAGGAGGTTTGTCAAAAACCAGTTTCTTGCGACCTCACGGAGGAGTCATCTTGCGTTTCGTATCTTGACGAGGAAGGTTCTTACAACGAAGATGCCGTCTGATGTTCCGGGAGTTCACCTCTGCCATTGAATATAGACCGACTTGGAGGGAGATCCTTGTGCGCATCGGAACTCACTGCGGCCCCAAGAAAGTACCGTACCAGTTCTGAAACGAAGAATGTGACCGGAGTCTTTTCATCGGTTCTTCTGGTCTATTCATCGACTCTAATCGATTCATGGACAATCGATTGTCTACTTACGCACATTGGTGCCTTCCATTTGTGGATATCGCCGACACATCCACTTCAGCAGCAGCTTGATGATTGATCGGGGCCAGAAACCCAATGTGAATACGAGGAAAGCGTATTTTTGTTCATAATCTTTACAGTAGTTCCTAGATGTTCCCTTCGGGGTTTACAGCAGCCGCGGCTTTCAGTAGTAGCTCTTTGTTATACGGCGGGCGACCCCGCAGAGTAGGTCACAGGCCGGAGGTTTCACCAATGGTCAGCATTGTAGAGACTCAGGACAAGCTTGTTGTGGAGATAGAGGATGAATGAGTCATATTTTTGAAAGCTCTCGACTATCCAAGATTGTTTAGATTGGTAACTTGCACGGTGTAGTTCTGCGATTGTCACATTTAATTGGATAGTTACAACCTACGAGGAGAAGATGAGAAGTCGTGGTACATAGCGCCAGTTTAGGACTACATGAACCTAGCAGTACTATTTGCGATACTACTTGTAGTTTGGGAGAATCATGTGCCAAAAGCACATTGCTTTCCCCTTGCATCCTGTCCTTGGTAGAAGGCTTCTTTCAGCAGATCAGCGAAGGAGGTGCCATTCGCAATTTAACGTTCTGTAAATGAGGATATCCAATCCTGCTGTTGTTCCCAGATTTTTTTTTCTTTTTCTTACACTACACCTTGGGATATTTGGGAATAAAATCGACCGATGTCTT

mRNA

>Mapoly0049s0030.1
GCTCGATCCGCTCGCTCGCTCAAAAGCCCGTCGGAGAATCTGCCCTCTTGCATTCAGCGCCTCGCTTGTCGAAGGCTCATTCACTCACTCACTCCTGCACCCGAGACGCTCCCCACCCCCGTCTCACGACACAAACATCAAACACTTCTCCTGCTCCGCCCTCGCACCCCAAGTCTTCTCTCCTGCAAGAAATCTCCCGCACCTTTACGCTGCGTCGATCGCCTGCGTGATCTTCCTCCTTCCTCCTTCCTCCACTTCGACCGAGCTCATTGTTTTTCCTGGTGCAATCGGCTTGGCATTGCACAGTGCACAGGCTGCTGTTGATTGGCATTTTCCTGGTGGAAGGTCCACTCGCACAGACGAATGAGGTTTTCCTTGTCTACCTGCATCAGTAGGGTAGGAGGAATGCGCCTGGGGAAATTGACAAGTCAGTCATTGGTTTCATAAACATCAGTCTTGCGCGTCATTCTTATACGACGTCGAGAACTGAGTTTCACGACATTTCCTCCATCAAGATCCCTGGATCGTTGTGCTGCGACAAGAGTGTGGCGTGGGATAACAATTTACCAGAACGGCGTTGCGAAATCCTGGCTTGAGCTTTTATAGTCGTCGAGGTCGTCATTTGGACTTGTACACCGGGCTTCGCGGGCTGCATTATAGAGGATCGAATTGAAGTTATTACCTGCAAGCAAGGCAGATAGAAGTTGAGATGGAAAAGAAGTGTGAACTTTGTGGAGATCGGGCAACACTTTATTGCGCTGCAGACGATGCCAACGTGTGCTGGAGCTGCGACGCGAAAGTTCACAGTGCGAATTTCTTGGTTGCACGACACGCTCGTTCCGTCTTGTGCGGACGTTGCTGCCAGGAGACAGACTGCAAGACATCAGGTCCCCATCCGTCTCCTCTTTCTCGTCTTTGTCCCCGCTGCAACCCCTCCACGACGGCAGCAGTCGTGAACGATTGCAACGGTGACAGTGAGGAAATGGAGAACAGCGAGACTCTGAGTTATCCGAGCGCTACCACTGAAGCGGCAGACTCAGGATGCACCTGTGCAAGCCAGGAGAGCCACACCGGTGAGCACTTATCCCGTCAAGGCAGAAGGAAGTCAGCCGTAGAGATGGTGGGGCGAGCAAGGGGTTCTCGTAGATTCCACGGTGCCGAAATTAAACGATTGTGGGGTGTCGAGCGAGGGAAAACTCTTCAAGGAAGAAGGATTCAGAAGAGGAGTAGCTCTCCAACTGGATTGGTAATCCAAACCCTTCAACTGGAATCCCGCAGCCAGCGGGCTGATCGATCTTTCGGGTACGGATCCGGAGTGGGAAGCAACTCAGTATCGCCGACGAAGGAGGTTTGTCAAAAACCAGTTTCTTGCGACCTCACGGAGGAGTCATCTTGCGTTTCGTATCTTGACGAGGAAGGTTCTTACAACGAAGATGCCGTCTGATGTTCCGGGAGTTCACCTCTGCCATTGAATATAGACCGACTTGGAGGGAGATCCTTGTGCGCATCGGAACTCACTGCGGCCCCAAGAAAGTACCGTACCAGTTCTGAAACGAAGAATGTGACCGGAGTCTTTTCATCGGTTCTTCTGGTCTATTCATCGACTCTAATCGATTCATGGACAATCGATTGTCTACTTACGCACATTGGTGCCTTCCATTTGTGGATATCGCCGACACATCCACTTCAGCAGCAGCTTGATGATTGATCGGGGCCAGAAACCCAATGTGAATACGAGGAAAGCGTATTTTTGTTCATAATCTTTACAGTAGTTCCTAGATGTTCCCTTCGGGGTTTACAGCAGCCGCGGCTTTCAGTAGTAGCTCTTTGTTATACGGCGGGCGACCCCGCAGAGTAGGTCACAGGCCGGAGGTTTCACCAATGGTCAGCATTGTAGAGACTCAGGACAAGCTTGTTGTGGAGATAGAGGATGAATGAGTCATATTTTTGAAAGCTCTCGACTATCCAAGATTGTTTAGATTGGTAACTTGCACGGTGTAGTTCTGCGATTGTCACATTTAATTGGATAGTTACAACCTACGAGGAGAAGATGAGAAGTCGTGGTACATAGCGCCAGTTTAGGACTACATGAACCTAGCAGTACTATTTGCGATACTACTTGTAGTTTGGGAGAATCATGTGCCAAAAGCACATTGCTTTCCCCTTGCATCCTGTCCTTGGTAGAAGGCTTCTTTCAGCAGATCAGCGAAGGAGGTGCCATTCGCAATTTAACGTTCTGTAAATGAGGATATCCAATCCTGCTGTTGTTCCCAGATTTTTTTTTCTTTTTCTTACACTACACCTTGGGATATTTGGGAATAAAATCGACCGATGTCTT

CDS

>Mapoly0049s0030.1
ATGGAAAAGAAGTGTGAACTTTGTGGAGATCGGGCAACACTTTATTGCGCTGCAGACGATGCCAACGTGTGCTGGAGCTGCGACGCGAAAGTTCACAGTGCGAATTTCTTGGTTGCACGACACGCTCGTTCCGTCTTGTGCGGACGTTGCTGCCAGGAGACAGACTGCAAGACATCAGGTCCCCATCCGTCTCCTCTTTCTCGTCTTTGTCCCCGCTGCAACCCCTCCACGACGGCAGCAGTCGTGAACGATTGCAACGGTGACAGTGAGGAAATGGAGAACAGCGAGACTCTGAGTTATCCGAGCGCTACCACTGAAGCGGCAGACTCAGGATGCACCTGTGCAAGCCAGGAGAGCCACACCGGTGAGCACTTATCCCGTCAAGGCAGAAGGAAGTCAGCCGTAGAGATGGTGGGGCGAGCAAGGGGTTCTCGTAGATTCCACGGTGCCGAAATTAAACGATTGTGGGGTGTCGAGCGAGGGAAAACTCTTCAAGGAAGAAGGATTCAGAAGAGGAGTAGCTCTCCAACTGGATTGGTAATCCAAACCCTTCAACTGGAATCCCGCAGCCAGCGGGCTGATCGATCTTTCGGGTACGGATCCGGAGTGGGAAGCAACTCAGTATCGCCGACGAAGGAGGTTTGTCAAAAACCAGTTTCTTGCGACCTCACGGAGGAGTCATCTTGCGTTTCGTATCTTGACGAGGAAGGTTCTTACAACGAAGATGCCGTCTGA

Protein

>Mapoly0049s0030.1
MEKKCELCGDRATLYCAADDANVCWSCDAKVHSANFLVARHARSVLCGRCCQETDCKTSGPHPSPLSRLCPRCNPSTTAAVVNDCNGDSEEMENSETLSYPSATTEAADSGCTCASQESHTGEHLSRQGRRKSAVEMVGRARGSRRFHGAEIKRLWGVERGKTLQGRRIQKRSSSPTGLVIQTLQLESRSQRADRSFGYGSGVGSNSVSPTKEVCQKPVSCDLTEESSCVSYLDEEGSYNEDAV

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>