Mapoly0049s0067



Description

B-box zinc finger // CCT motif

Reference DB

Database ID Description
GO GO:0005515 Protein binding
GO GO:0005622 Intracellular
GO GO:0008270 Zinc ion binding
OrthoMCL OG5_141646
PFAM PF00643 B-box zinc finger
PFAM PF06203 CCT motif
PANTHER PTHR31874 FAMILY NOT NAMED
PANTHER PTHR31874:SF1

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBBX3 transcription factor, BBX Mapoly0049s0067.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0049s0067.1 scaffold_49:645333..647941  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0049s0067.1  

Gene structure:

mRNA scaffold_49:645333..647941  ( + strand )
five_prime_UTR scaffold_49:645333..645837  ( + strand )
CDS scaffold_49:645838..647028  ( + strand )
three_prime_UTR scaffold_49:647029..647941  ( + strand )

Sequences:

Gene

>Mapoly0049s0067.1
GGCTGCTCCAGGCTCGGAGGTAGGAGAAGGATCGAGATTGAGACACAGATCATCGAGATTGAGAGAGATTGAGAGATATAGATTGAGAGAGCGAGAGCTAGGAACCGGCAGTGAGCTCGGACGATTCGCAGTTGAATCCATGGTTGTCGAATTTGGTGGATGATTGCAAGCTTGTGATCCGATAGTGTCCCTGGAAATGGAACGCCTCATCGCCTCGTGCGAGAGAGGTCAATATTTTTCGTGTCGAAGGTCGAACCAGCCGCAGCTTCTGAGCCCAATTGGAAACGAGGGATCGTCAAGTGGCGGAGACGACGGCGGCGAGAGTGAAAATATCTCGAGTGGAAGGTGACGAAGGGAGGGAGGCCGGAGGTGGTTGGTTAGTCGATGCGCTATAGACCCCTTGCTGCCAGGAAGAAGCTTTGAGTGAGGTCTCGAGAGTTGTTGTTCGATTGTGTTCCCCGCAGTGCCATTTTTTGTGTTTTCCCAACTCGAGAAGGTCGCTGAGATGACTGCCACTACCGAAGACAGGTCGATGGATCCCAAAACCGCAACAGCCGTGATGTCCATGGCCGGACGGGCCGTGCGTGCATGCGACGTCTGCGGGCGCGACCGCGCTCGATGGTATTGCGCCGCCGACGAAGCTTACCTTTGTGGACGCTGCGACAATTCCATTCACTGCGTCAATGCTTTGGCGTCGCGCCACGAGCGCGTGCGCCTGAACCCCAATGGAACGGCATGCAAGGGCGGCGAGCGCACCTCGTCCAAGTCCTTCCCCGGGCTGCAAATCCGGAAGAGCAGCAAATCCCTGAAGCACCACGTGAACCCCAAGATGCGCATGATCAAGGACGAAATGCTCGCGCAAAGTTTTTTCTCCAACCCCGACGACACCTCGCGAGTGCCCGGGTACCCCGAGAGCCTTCCGGAGGACGAAAGCTCGCGGCTCGGCCTCCCCGCCTACGTCCCCGATCTGCAAGCATCCGTGGACGACCTCGGAGGGGACGGCAGCGCCAGCGATGGGTTTCCCATGGACATGCCCCAGGAGCTGGATTCTCTCGAGAGGGGCGACGAGGACTGCGTCGGCGGGAGCGACGATGAGTACCTGGACTTTACAGACATCGTCACCGAGGCGGATTTTCTCGACGACAAAGGAGACGAGGGATCTGTGTTCAGTCTAGACGACATCAAATCAGAACACTGTCACGATGCCGTGAAGAACGAGGGGTTCGGCCAATTCCAGCCCGTCTGCAACGACGGCTTCGAGTCGATTAATGTCAAAGTGGAGAAGGACGGGTCGTTGTTCCACCAGACGCAACAGTTCAGTGAGGAGGGCCAGACTAAGTGCCTGTCGCTGAAATTGAATTACGAGGACGTCCTGAGCGCATGGTCGGGACGAGGTCCGCTGTGGACTGAGGATGGGGGTCAACCCCAAACCGTGCCAATTCTCTCGAATATTGATATGGCGCTGAACCTGGACCTCGAGAGCTACCACAGAGAACAATTAGGCGAGGTCCCCGTGCTCGGGATGGGAGAGGAGGTGTCGGAAGTCGGAGTCGGACGCGAGGCTCGAGTCATGAGATATCGAGAAAAGCGCCGCACTCGACTCTTCTCCAAACAGATACGATACGAAGTGCGCAAGCTGAACGCCGAGCGCCGCCCACGTATGAAGGGCCGCTTCGTCAAGCGACTGCCGCCATGATTGTGGGGTACCTTTCTGCTTCTCTTCGGGGCCCCGGTACATCGAGCGGTGATATGTTTTTAGTTATTATCATGAATTTAGTTAGGGAGGACGGAGAGGGAGAGATTGGAGAGACCGAGACCGAGCGGAAGAAGAGATGTACAAATTTGACGACATATCCAAGCGGAACGCTTTTGTGAATTAGTAAGTTCGAGCAGAGAGAATGGAAGATTTCGCCTGATAGTCCACCTGCTTTCATGCACGTGGGAAGGAGCACTTAAAAATAAAGACCGTGCGAAAATGTACAAATGCGCTGATTATTCCAGCTGAAATCCATAAATTTTTGATTACCTACTCGAAAATGTGCGTCTTCCGGTCTTGGCGCAGTCTCCTGCTGTTGTGTCGTGAATCGTGAGCGCTGTGCAAGTTTCCCGTTCCCTTAGCACTGTGAACTCTCTTGTAGTCTCATGTGTCAATGATTATTACTGTTCAGATGTCGAGAGATCTCCCTATGCATTCCGCAACCCCGCTTCCACCTGGAAGACTCTTATTGTCTGAACTTGGGGCTATTATTTCATGAACGTACTGGACAGCCACCACGATGGCCGTCGGATGCACAATTGCAGCGCGAATGTTCCAAGCAATGGCCATGGAGTCGTGCGATGTCAAAATTAATGTCGTCCACTATAACCATGACCCCAGTTACTAGGCTTCGAGGAGGACTGACGCGTCTGGACCGAAGTGATCTCTACATTCAAATCTCGAGCACCTCGTAAGGTTGAGATGGTGGCCTTCCTTTGGGTGCTGTTCCTTGCTTTGTGCGCAGTACAGACAAGGAACTTGCCTCGCTTTCGAGAATCAGAGTTCCCGGCACTTCGTGGAGACGAAAAAATCTCAACACATCCAAAGGTAGGCAGCACCCCACGCCCCCAGC

mRNA

>Mapoly0049s0067.1
GGCTGCTCCAGGCTCGGAGGTAGGAGAAGGATCGAGATTGAGACACAGATCATCGAGATTGAGAGAGATTGAGAGATATAGATTGAGAGAGCGAGAGCTAGGAACCGGCAGTGAGCTCGGACGATTCGCAGTTGAATCCATGGTTGTCGAATTTGGTGGATGATTGCAAGCTTGTGATCCGATAGTGTCCCTGGAAATGGAACGCCTCATCGCCTCGTGCGAGAGAGGTCAATATTTTTCGTGTCGAAGGTCGAACCAGCCGCAGCTTCTGAGCCCAATTGGAAACGAGGGATCGTCAAGTGGCGGAGACGACGGCGGCGAGAGTGAAAATATCTCGAGTGGAAGGTGACGAAGGGAGGGAGGCCGGAGGTGGTTGGTTAGTCGATGCGCTATAGACCCCTTGCTGCCAGGAAGAAGCTTTGAGTGAGGTCTCGAGAGTTGTTGTTCGATTGTGTTCCCCGCAGTGCCATTTTTTGTGTTTTCCCAACTCGAGAAGGTCGCTGAGATGACTGCCACTACCGAAGACAGGTCGATGGATCCCAAAACCGCAACAGCCGTGATGTCCATGGCCGGACGGGCCGTGCGTGCATGCGACGTCTGCGGGCGCGACCGCGCTCGATGGTATTGCGCCGCCGACGAAGCTTACCTTTGTGGACGCTGCGACAATTCCATTCACTGCGTCAATGCTTTGGCGTCGCGCCACGAGCGCGTGCGCCTGAACCCCAATGGAACGGCATGCAAGGGCGGCGAGCGCACCTCGTCCAAGTCCTTCCCCGGGCTGCAAATCCGGAAGAGCAGCAAATCCCTGAAGCACCACGTGAACCCCAAGATGCGCATGATCAAGGACGAAATGCTCGCGCAAAGTTTTTTCTCCAACCCCGACGACACCTCGCGAGTGCCCGGGTACCCCGAGAGCCTTCCGGAGGACGAAAGCTCGCGGCTCGGCCTCCCCGCCTACGTCCCCGATCTGCAAGCATCCGTGGACGACCTCGGAGGGGACGGCAGCGCCAGCGATGGGTTTCCCATGGACATGCCCCAGGAGCTGGATTCTCTCGAGAGGGGCGACGAGGACTGCGTCGGCGGGAGCGACGATGAGTACCTGGACTTTACAGACATCGTCACCGAGGCGGATTTTCTCGACGACAAAGGAGACGAGGGATCTGTGTTCAGTCTAGACGACATCAAATCAGAACACTGTCACGATGCCGTGAAGAACGAGGGGTTCGGCCAATTCCAGCCCGTCTGCAACGACGGCTTCGAGTCGATTAATGTCAAAGTGGAGAAGGACGGGTCGTTGTTCCACCAGACGCAACAGTTCAGTGAGGAGGGCCAGACTAAGTGCCTGTCGCTGAAATTGAATTACGAGGACGTCCTGAGCGCATGGTCGGGACGAGGTCCGCTGTGGACTGAGGATGGGGGTCAACCCCAAACCGTGCCAATTCTCTCGAATATTGATATGGCGCTGAACCTGGACCTCGAGAGCTACCACAGAGAACAATTAGGCGAGGTCCCCGTGCTCGGGATGGGAGAGGAGGTGTCGGAAGTCGGAGTCGGACGCGAGGCTCGAGTCATGAGATATCGAGAAAAGCGCCGCACTCGACTCTTCTCCAAACAGATACGATACGAAGTGCGCAAGCTGAACGCCGAGCGCCGCCCACGTATGAAGGGCCGCTTCGTCAAGCGACTGCCGCCATGATTGTGGGGTACCTTTCTGCTTCTCTTCGGGGCCCCGGTACATCGAGCGGTGATATGTTTTTAGTTATTATCATGAATTTAGTTAGGGAGGACGGAGAGGGAGAGATTGGAGAGACCGAGACCGAGCGGAAGAAGAGATGTACAAATTTGACGACATATCCAAGCGGAACGCTTTTGTGAATTAGTAAGTTCGAGCAGAGAGAATGGAAGATTTCGCCTGATAGTCCACCTGCTTTCATGCACGTGGGAAGGAGCACTTAAAAATAAAGACCGTGCGAAAATGTACAAATGCGCTGATTATTCCAGCTGAAATCCATAAATTTTTGATTACCTACTCGAAAATGTGCGTCTTCCGGTCTTGGCGCAGTCTCCTGCTGTTGTGTCGTGAATCGTGAGCGCTGTGCAAGTTTCCCGTTCCCTTAGCACTGTGAACTCTCTTGTAGTCTCATGTGTCAATGATTATTACTGTTCAGATGTCGAGAGATCTCCCTATGCATTCCGCAACCCCGCTTCCACCTGGAAGACTCTTATTGTCTGAACTTGGGGCTATTATTTCATGAACGTACTGGACAGCCACCACGATGGCCGTCGGATGCACAATTGCAGCGCGAATGTTCCAAGCAATGGCCATGGAGTCGTGCGATGTCAAAATTAATGTCGTCCACTATAACCATGACCCCAGTTACTAGGCTTCGAGGAGGACTGACGCGTCTGGACCGAAGTGATCTCTACATTCAAATCTCGAGCACCTCGTAAGGTTGAGATGGTGGCCTTCCTTTGGGTGCTGTTCCTTGCTTTGTGCGCAGTACAGACAAGGAACTTGCCTCGCTTTCGAGAATCAGAGTTCCCGGCACTTCGTGGAGACGAAAAAATCTCAACACATCCAAAGGTAGGCAGCACCCCACGCCCCCAGC

CDS

>Mapoly0049s0067.1
ATGACTGCCACTACCGAAGACAGGTCGATGGATCCCAAAACCGCAACAGCCGTGATGTCCATGGCCGGACGGGCCGTGCGTGCATGCGACGTCTGCGGGCGCGACCGCGCTCGATGGTATTGCGCCGCCGACGAAGCTTACCTTTGTGGACGCTGCGACAATTCCATTCACTGCGTCAATGCTTTGGCGTCGCGCCACGAGCGCGTGCGCCTGAACCCCAATGGAACGGCATGCAAGGGCGGCGAGCGCACCTCGTCCAAGTCCTTCCCCGGGCTGCAAATCCGGAAGAGCAGCAAATCCCTGAAGCACCACGTGAACCCCAAGATGCGCATGATCAAGGACGAAATGCTCGCGCAAAGTTTTTTCTCCAACCCCGACGACACCTCGCGAGTGCCCGGGTACCCCGAGAGCCTTCCGGAGGACGAAAGCTCGCGGCTCGGCCTCCCCGCCTACGTCCCCGATCTGCAAGCATCCGTGGACGACCTCGGAGGGGACGGCAGCGCCAGCGATGGGTTTCCCATGGACATGCCCCAGGAGCTGGATTCTCTCGAGAGGGGCGACGAGGACTGCGTCGGCGGGAGCGACGATGAGTACCTGGACTTTACAGACATCGTCACCGAGGCGGATTTTCTCGACGACAAAGGAGACGAGGGATCTGTGTTCAGTCTAGACGACATCAAATCAGAACACTGTCACGATGCCGTGAAGAACGAGGGGTTCGGCCAATTCCAGCCCGTCTGCAACGACGGCTTCGAGTCGATTAATGTCAAAGTGGAGAAGGACGGGTCGTTGTTCCACCAGACGCAACAGTTCAGTGAGGAGGGCCAGACTAAGTGCCTGTCGCTGAAATTGAATTACGAGGACGTCCTGAGCGCATGGTCGGGACGAGGTCCGCTGTGGACTGAGGATGGGGGTCAACCCCAAACCGTGCCAATTCTCTCGAATATTGATATGGCGCTGAACCTGGACCTCGAGAGCTACCACAGAGAACAATTAGGCGAGGTCCCCGTGCTCGGGATGGGAGAGGAGGTGTCGGAAGTCGGAGTCGGACGCGAGGCTCGAGTCATGAGATATCGAGAAAAGCGCCGCACTCGACTCTTCTCCAAACAGATACGATACGAAGTGCGCAAGCTGAACGCCGAGCGCCGCCCACGTATGAAGGGCCGCTTCGTCAAGCGACTGCCGCCATGA

Protein

>Mapoly0049s0067.1
MTATTEDRSMDPKTATAVMSMAGRAVRACDVCGRDRARWYCAADEAYLCGRCDNSIHCVNALASRHERVRLNPNGTACKGGERTSSKSFPGLQIRKSSKSLKHHVNPKMRMIKDEMLAQSFFSNPDDTSRVPGYPESLPEDESSRLGLPAYVPDLQASVDDLGGDGSASDGFPMDMPQELDSLERGDEDCVGGSDDEYLDFTDIVTEADFLDDKGDEGSVFSLDDIKSEHCHDAVKNEGFGQFQPVCNDGFESINVKVEKDGSLFHQTQQFSEEGQTKCLSLKLNYEDVLSAWSGRGPLWTEDGGQPQTVPILSNIDMALNLDLESYHREQLGEVPVLGMGEEVSEVGVGREARVMRYREKRRTRLFSKQIRYEVRKLNAERRPRMKGRFVKRLPP

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>