Mapoly0054s0021



Description

Helix-loop-helix DNA-binding domain

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_164463
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR31945 FAMILY NOT NAMED
PANTHER PTHR31945:SF5

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH11 transcription factor, bHLH Mapoly0054s0021.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0054s0021.1 scaffold_54:180364..183730  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0054s0021.1  

Gene structure:

mRNA scaffold_54:180364..183730  ( + strand )
five_prime_UTR scaffold_54:180364..180767  ( + strand )
five_prime_UTR scaffold_54:181686..181765  ( + strand )
CDS scaffold_54:181766..182359  ( + strand )
CDS scaffold_54:182868..183098  ( + strand )
CDS scaffold_54:183249..183419  ( + strand )
CDS scaffold_54:183539..183691  ( + strand )
three_prime_UTR scaffold_54:183692..183730  ( + strand )

Sequences:

Gene

>Mapoly0054s0021.1
ATTCATCTGCAGCCTCGTGGGAAGCTACGGATCCATTTGCACCTCTTTTCTTTTCACGCTTCGAATGCTTCATTCGTACAAAATCTTGCCCCTGAGACCAAGAACGGCATCAGAGTTTGTGGAGCACGTTCGGGCCAACTTTGCCCAAGAGTCGGAGCTTGCAGCTGCAGAAGCGAATGAGACCCGGGCTCTTCGTGCAGCACTTTTCAGACATCCATGCTCCAGTTTTTCCTCCACGTCAGAAGAATGAATGTGATTCAGTAGCGGTGGATGGAGACTTGAATTGCGCTGAGCTGAGCTGACGAGAGTCGATCGTCGAGCGACTTCTGCAGTTGCTCTTGGCTCACATGCTCTCCACATCCCGACAGGATACAGTCGCAGCCTGCAGAGCTACGATATTTTAGGTGAGGCTGGTCACTTTCTGTGTACTTCGGTGGTGCTTGTCGTATAGATCTTCAACACGGGCGAAAGAACGAGAACAGCAAGTTCGTAGAATGAACTGTATCATCTGAAAAATTGAGACAAGGATCATTCATGCTATCCTTTCTGACAAAACTGGAATCGTCTGAACCAAAGTCAAGCCGTGACAACGATTGAAGCTGATTCAGACGCCTCCGTCTCCCTTCAGATGATACAGAAAGGCATCTCGTAGCGGCCTCGGGATTCAAGAAATTCATGCGGAGCTTATTGTCTTCTAATTGGAAAACGATAGACTTTCCTAGTTTGCTGAAGATCTTAGACTGTAGACTTTTTCCGCCCTTTGACGCCCACCGAGTTCATGATCACCAGTCATGTGTCAGAATTTACACTGTCAACGGGCTAAGTCTGCTTCAGCTGACCTGGAAATCATGCCATGGCTGCTAGTGACATAGTTCAAGAACCTCTAGCGCTTACACTGCGAACGAAGGCAAATGAATACTCAGAACCTCTTGGTTCGCGTTGCCTTCGTACTTTAGAGCCTATGATTCATCAGCTGACAATAGTTCACAAAAATCACGAGCCTTCAAGCATTGGAATTAATGTGCCACGGAAATATGGCTGCAAATACCATAAGAAATTGTCCATCGTCTCTCACAGTCATGGATTCACAGCGTACACTTTACTCATGACAATGGCTTTGAATTGCAATTGAGCGTCTCGTGAAGTTGGATTCATTCGTCAAACTGATGTTGATATCATTCAAATTTTTAAAGGATCGTTCGTGCACTCTGACCTTGGCCTTGCCATTTTCCTTTCACCTTGCCTATAGACCGATGGGACATGATGATTATATATTCTGTCGTTGTGGCTGACGTTTGCGTTTCTTCTGGTGTATTTGAAAGCTCCAGGTTCCTCCAGGACTGGGTGAATTTGGAAAGGTTGGCAATATTTCTCAAAATTGGATTCGAAAATTTGGCATAAAATGGTTCTATCGCCCGAAGCCTCTCTTAGTTCTGGATCGACCAGGGAGGTGGAGAGGACTCTGGACAAGAAAGACGGAAAATCGTTTTACAATCCGGGTGGCGAGGGATGTTCCCGGAACTTTGAATTAGATCCACATTCCGAGAATCCCTGGAGTACCCCAAGCGAAATTTGGGAACAGGAAGAGGCTTTGATGAATTCGCAAACACAGATGCAGCTGAATTTTCTCGATCAGAAGGATGTTCCGCTTGGAGGTTTAGGCCACCCATACGAAGAACTCGTCCCAGGAAATCAGACTCTTCATGACATAATCATGCCGGCCGCTGGAGTTCAGTCCTTACGTACAAGTCTAGGAGGGGATGCGTTTGGAGATGCGCTTTCGAAGGAGAGTGGCGACAGGGAGATAAAGCAAGAGATGCGTGCAGATTCCTCCGATGGCAGTGATCCGATGGATGAGGATGAAGACAAAGGTGGATCCGGCTCCCGATCTGGCAGGAGACACCTCTCGAAGAATCTGGTTGCAGAACGAAAGCGAAGAAAAAAGCTGAACGAGCGATTGTATGCCCTCCGTGCCCTGGTTCCAAAGATCACGAAGGTGATGCCTCGACCAAAGATTATCTCATGATTAGACCAAAGAATATACTCGTCCTTAATGGTTCCAGACTCTCTGCTTTCGATTCCTCCTATATATTCTTTTGTTTCAGGTGCTTCGTCCACCACAGACTGTTTCATCTTCTCCAAGATCTGGACACTTCGTGGCAGTCAGCTTTATGTCTCGTCTGTAGCTGTATTCAACAGCTTCTTGCATACGGACTATTTTGCAGCTTTTTCTGTCGTTGTATATTTAGAAGCAACTGTAGTACTTCCATATCCCGCTTCAGTTGGGATCGGTTGGGATCCACTTTTTGACGAAATTTTCTTCGGCATGGAAGAATGCAAGGTCCAGCAGCCCGAGCAGTGTTCAAAGGGACAGCTTATCTTGCTTCACATTGTTGTTAGTAAGTAAGTTTTGGATGCGACATGCGATTTTCAACGCACAGGTCCTCCTGAATTGAATTTTCAGGCAAGCAACGGAATCTTGAAGGGATTGTCTGTATCTGCAGATGGATCGAGCTTCAATTCTCGGTGATGCTATAGAGTACGTGCGGGAACTACAAGCTCGAGTAGATTGTCTCCAGAAGGAGCTGCTCGATGATGAAGAAATCCTTAACGTTGATGCCATACTGGAAGACGGTAACAGAGAAGGCTGCTTTGAAGACATCAAAACCTCTGAGCCACGGCTTGACATCATCCCCGAAGAACAACAAATAGAGAATCTTGTTCAGCCTATGGAAGTAAGTAGTTTTTCACAAAATATATTTCAAATCTTGTGATTGGCAGAGCATTACCTTTTCGCCCTCAAGTTTCTCGATACTTTTTGGAATGCTTCTGATTTTTTGTGATAATGCTGAATCCTTTGAACTCCACACACACTGAACGCGCAGGTCTATGTGCACAAGTTGGATGAAGCCGTATTTACTGTCCGAATTATAAGTGAAAAGTCTGAAGGAATGTTTCTGGGCGTCCTACGCATCATGGATGAGTATGGATTTGATATTTTACATGCGAATATCATTACCCACCGTGGCATTGCGCTGCACGTTTTCAGAGCAGAGGTAATGATTATCAGACTTTAAAAGCACACGTAACCGCTTGGAATATTCGTAGCGTTCAGATCATTATGTCACCGATGCTCGAATCCCACTTCCTGATCCAAGTTTCACTTTGTGTGCAGATTAGAGACAAGAAGACCCCCACGATAGAACAAGTGAAGGAGAGCTTATTACAATTATCTAAATTTCAGTTCGGCGGATTTGATAATCCAAATGAATTGGTGAATGAGCCTATGAATATAGTAAGTTCGACGCCTGATCATAGACAGTCGTGAATTTAGAAAAATTACACACATATCTGCGTTTCAATATCT

mRNA

>Mapoly0054s0021.1
ATTCATCTGCAGCCTCGTGGGAAGCTACGGATCCATTTGCACCTCTTTTCTTTTCACGCTTCGAATGCTTCATTCGTACAAAATCTTGCCCCTGAGACCAAGAACGGCATCAGAGTTTGTGGAGCACGTTCGGGCCAACTTTGCCCAAGAGTCGGAGCTTGCAGCTGCAGAAGCGAATGAGACCCGGGCTCTTCGTGCAGCACTTTTCAGACATCCATGCTCCAGTTTTTCCTCCACGTCAGAAGAATGAATGTGATTCAGTAGCGGTGGATGGAGACTTGAATTGCGCTGAGCTGAGCTGACGAGAGTCGATCGTCGAGCGACTTCTGCAGTTGCTCTTGGCTCACATGCTCTCCACATCCCGACAGGATACAGTCGCAGCCTGCAGAGCTACGATATTTTAGCTCCAGGTTCCTCCAGGACTGGGTGAATTTGGAAAGGTTGGCAATATTTCTCAAAATTGGATTCGAAAATTTGGCATAAAATGGTTCTATCGCCCGAAGCCTCTCTTAGTTCTGGATCGACCAGGGAGGTGGAGAGGACTCTGGACAAGAAAGACGGAAAATCGTTTTACAATCCGGGTGGCGAGGGATGTTCCCGGAACTTTGAATTAGATCCACATTCCGAGAATCCCTGGAGTACCCCAAGCGAAATTTGGGAACAGGAAGAGGCTTTGATGAATTCGCAAACACAGATGCAGCTGAATTTTCTCGATCAGAAGGATGTTCCGCTTGGAGGTTTAGGCCACCCATACGAAGAACTCGTCCCAGGAAATCAGACTCTTCATGACATAATCATGCCGGCCGCTGGAGTTCAGTCCTTACGTACAAGTCTAGGAGGGGATGCGTTTGGAGATGCGCTTTCGAAGGAGAGTGGCGACAGGGAGATAAAGCAAGAGATGCGTGCAGATTCCTCCGATGGCAGTGATCCGATGGATGAGGATGAAGACAAAGGTGGATCCGGCTCCCGATCTGGCAGGAGACACCTCTCGAAGAATCTGGTTGCAGAACGAAAGCGAAGAAAAAAGCTGAACGAGCGATTGTATGCCCTCCGTGCCCTGGTTCCAAAGATCACGAAGATGGATCGAGCTTCAATTCTCGGTGATGCTATAGAGTACGTGCGGGAACTACAAGCTCGAGTAGATTGTCTCCAGAAGGAGCTGCTCGATGATGAAGAAATCCTTAACGTTGATGCCATACTGGAAGACGGTAACAGAGAAGGCTGCTTTGAAGACATCAAAACCTCTGAGCCACGGCTTGACATCATCCCCGAAGAACAACAAATAGAGAATCTTGTTCAGCCTATGGAAGTCTATGTGCACAAGTTGGATGAAGCCGTATTTACTGTCCGAATTATAAGTGAAAAGTCTGAAGGAATGTTTCTGGGCGTCCTACGCATCATGGATGAGTATGGATTTGATATTTTACATGCGAATATCATTACCCACCGTGGCATTGCGCTGCACGTTTTCAGAGCAGAGATTAGAGACAAGAAGACCCCCACGATAGAACAAGTGAAGGAGAGCTTATTACAATTATCTAAATTTCAGTTCGGCGGATTTGATAATCCAAATGAATTGGTGAATGAGCCTATGAATATAGTAAGTTCGACGCCTGATCATAGACAGTCGTGAATTTAGAAAAATTACACACATATCTGCGTTTCAATATCT

CDS

>Mapoly0054s0021.1
ATGGTTCTATCGCCCGAAGCCTCTCTTAGTTCTGGATCGACCAGGGAGGTGGAGAGGACTCTGGACAAGAAAGACGGAAAATCGTTTTACAATCCGGGTGGCGAGGGATGTTCCCGGAACTTTGAATTAGATCCACATTCCGAGAATCCCTGGAGTACCCCAAGCGAAATTTGGGAACAGGAAGAGGCTTTGATGAATTCGCAAACACAGATGCAGCTGAATTTTCTCGATCAGAAGGATGTTCCGCTTGGAGGTTTAGGCCACCCATACGAAGAACTCGTCCCAGGAAATCAGACTCTTCATGACATAATCATGCCGGCCGCTGGAGTTCAGTCCTTACGTACAAGTCTAGGAGGGGATGCGTTTGGAGATGCGCTTTCGAAGGAGAGTGGCGACAGGGAGATAAAGCAAGAGATGCGTGCAGATTCCTCCGATGGCAGTGATCCGATGGATGAGGATGAAGACAAAGGTGGATCCGGCTCCCGATCTGGCAGGAGACACCTCTCGAAGAATCTGGTTGCAGAACGAAAGCGAAGAAAAAAGCTGAACGAGCGATTGTATGCCCTCCGTGCCCTGGTTCCAAAGATCACGAAGATGGATCGAGCTTCAATTCTCGGTGATGCTATAGAGTACGTGCGGGAACTACAAGCTCGAGTAGATTGTCTCCAGAAGGAGCTGCTCGATGATGAAGAAATCCTTAACGTTGATGCCATACTGGAAGACGGTAACAGAGAAGGCTGCTTTGAAGACATCAAAACCTCTGAGCCACGGCTTGACATCATCCCCGAAGAACAACAAATAGAGAATCTTGTTCAGCCTATGGAAGTCTATGTGCACAAGTTGGATGAAGCCGTATTTACTGTCCGAATTATAAGTGAAAAGTCTGAAGGAATGTTTCTGGGCGTCCTACGCATCATGGATGAGTATGGATTTGATATTTTACATGCGAATATCATTACCCACCGTGGCATTGCGCTGCACGTTTTCAGAGCAGAGATTAGAGACAAGAAGACCCCCACGATAGAACAAGTGAAGGAGAGCTTATTACAATTATCTAAATTTCAGTTCGGCGGATTTGATAATCCAAATGAATTGGTGAATGAGCCTATGAATATAGTAAGTTCGACGCCTGATCATAGACAGTCGTGA

Protein

>Mapoly0054s0021.1
MVLSPEASLSSGSTREVERTLDKKDGKSFYNPGGEGCSRNFELDPHSENPWSTPSEIWEQEEALMNSQTQMQLNFLDQKDVPLGGLGHPYEELVPGNQTLHDIIMPAAGVQSLRTSLGGDAFGDALSKESGDREIKQEMRADSSDGSDPMDEDEDKGGSGSRSGRRHLSKNLVAERKRRKKLNERLYALRALVPKITKMDRASILGDAIEYVRELQARVDCLQKELLDDEEILNVDAILEDGNREGCFEDIKTSEPRLDIIPEEQQIENLVQPMEVYVHKLDEAVFTVRIISEKSEGMFLGVLRIMDEYGFDILHANIITHRGIALHVFRAEIRDKKTPTIEQVKESLLQLSKFQFGGFDNPNELVNEPMNIVSSTPDHRQS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>