Mapoly0055s0052



Description

(UnKnown)

Reference DB

Database ID Description
OrthoMCL OG5_153198
PANTHER PTHR16223 FAMILY NOT NAMED
PANTHER PTHR16223:SF11

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH45 transcription factor, bHLH Mapoly0055s0052.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0055s0052.1 scaffold_55:635292..639408  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0055s0052.2 scaffold_55:635292..639408  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0055s0052.1  

Gene structure:

mRNA scaffold_55:635292..639408  ( - strand )
three_prime_UTR scaffold_55:635292..635825  ( - strand )
CDS scaffold_55:635826..636008  ( - strand )
CDS scaffold_55:636157..636210  ( - strand )
CDS scaffold_55:636351..636416  ( - strand )
CDS scaffold_55:636542..636613  ( - strand )
CDS scaffold_55:636786..636941  ( - strand )
CDS scaffold_55:637099..637456  ( - strand )
CDS scaffold_55:639013..639056  ( - strand )
five_prime_UTR scaffold_55:639057..639408  ( - strand )

Sequences:

Gene

>Mapoly0055s0052.1
GAAGCAAACAAAAGAAGAGTATTATATTGCGGAGATACTATATGGGGGACGGGGCAGCAGCAGCAGCAGCTGCTGCTGATCGGAACTGAACTACAGTGGAGTTGGTAACTTTTGGACCGAGGGGAGCCCAGGCTGCCTGAACCGGGAGAAAGGGTGAGATGAGCCGCAAAAAACGCATTCTGCTGGCAAGACCATGTGATTCCCAATCCACCAAAAAATATAAAGCGGTCCACTCGTCGAGTCTGCTCTCCTCCTGCCTCTGTGCCATCGGTTGCTCCAGCTCATTCACACCTCCTTTTTCCAGTCCTCTTGCCCCCTCCTCTACTACAACTGATCATCACTGCGCACTGCCATGGCCACCTTGGCTAGTAGTATTCCTGTCTGGGCCCATCTCCTGTAAGCTCTTTCACATCCCTCGCCACCTCTGTGCAATGAATGAGTTCTGACTGCCTGCTCTCTGCGTGTAGTTGTTTGCGCTCCTCGCCAATCACTTTGTCTTGGTCGACTACGAAAGTCGCCGGTCGCTGCACTCACTGTCTCTACTCACTGCTCATAATACTCACATGTGGGCCGACGCCCCTCGCCCTTCTGCTGCTCCTGCTCCTGCTCCTGCTGCTGAATGAGGTCTTGTGAAAGTGTGCACCATCATCTGCTCGCTTCTGCTGCTCCCGTTGTCGTCGTCTTCATTGCCTTGTAATTAGCTGCTCGCTCCTTCGTCTGCTGCTGCCTCCGTGTCCTCCAGTTCATTCTTCGTCAGGTGGGTTTCCGAAGCGAGTCTGTGCGTCCTGCATCCTGCATCCTGCGTGCTCCTTGCTCCTTGTCTCGGTCTTGCAGAGCTCTCTCGTCATATCGCCACGAGCATTTTCGGCTGCGAGCTTCTGCGCTATCGACATTTCGGACCTTCGGCCAGCACCATGTTCGTGCTCGGGCTCCGAGTAAACTAAAATTCTATCTATTTACAGGCAAGGCAATGAACGCATGCATTTGTAAGATCGAATCACACGAGCTCGCTCATTCATTCCCTCGTTCTCGCTGCCGATGAAATCTGCGTCGGTCGATTGCTCAGAGGTCAGTCCATCTCGAGTCAATCTCGAATCCTCATGCCCCGCGTGTCTGTGTCGAGGGCCGACATCCTCCTCCGAACACCGCACGTACTGACGGGCTTCCGGCGTCTGCAAATCCACTTCTTACTCACATGGCCGCCTGCCTGGTCTCTGACCAGCTCCGCACCTCACTGCTTGGAAACAGGAGCGGCCATGCCGCTGGATCAGAATTAGACCTGCTGCTGAAATCAAAATTCCAGCAGCGGCGGTGCGGTCGCAGGCACCACGCGGCCTTCGAATGTGGTGCAGTCAGCGTCCACTGCTGTAGCCGCCATTCTCCCGAACGAAATGGGGGTATGGAATCAGATCGAGAGTGGTGTCTGAGCTGCTGAGGTCGGGTCGATGCATGACTCGACACGACACGACACGACACGACATGACATGCTATGCTGTTTCTGCTGCTGCTGCGGCGGCTGTGCTCGATTTGTTCTCTAAGCTTGACAGTGTTGTACAGAGATTGAATTTCGTGGTGCTTGGGGCATGGCTGGTTCACTGTGACTGCTACACTGGTCGGTCGGTCGCTTGTGCTTGGGTGAGGCCGTCATTTGGTTTGAGGGGTCTGCGATTGTATTGAGTCAAGTCAAGCTCGCTAGGTCGTCGAGGCGGGCACGGCGCGAAAGCTGCTGCTGCTGCTGCTGCTGCTCTCGATCGTAGAGATCCGTCTGATCAGCAGAATGAATGAATGAATGAGCATCCCTGATACATGCGTCAAAGGGTGCAAGGCTGGGCATGGGATTCAAATGCTCGTCTCGATAGGGTGGCATGACTTTGACCGGGGCCATGGAACAATGCGAGGATTGCTGATTGTCTCATGGTGCTCACCTTCGTTTGTAATGTAATGTAATGCAGCACAAGCGACAGCGGCGTGGTGGAGCACGGGCAGCTGCCGAGGTCGACGTCCGATGCGTTTACAGATTGCGGAAGCTCGCCTCTTTCACAGCATTGGGAAACTCACGAAATGGATTACTCGTCGCACTTCATCATCCCTCCTCAGGCGCACCTGACTTCCAACTCGCACATGTCGCCCTTGCAATGGGCCAACGCGCCCGACGCTGCCCACCATGCCAGCCTCCTGCAGCACTGCTCAGACTACCAGCAGCAGCAGCAGCAGCAGCAACAACAGCAGCTGGAGATTGCGCACCACCAGCAGCAGCAGGATCAACATCCTCACCTCCTTCGACAAGCGAAATCGCACGTGAATCATTTGGTTCGTTGCCTACCTCGCTCCTCTCTTTCTCTTTCTCTCCCTTCTTTGTGGTTGCCGGATCATTCCACGATCCCACTGTCATGGGAACTGGAGCTCCAATCCAAGGAGCTCTAGAAATCGCATGGGAATGATCCTCACTTCTCGCTGATGCTCGCAGGCCGACAGTCACGAAGACAGCCGCGATTCGAAGAGACCCGCCCCGAGCATGGGTGCTCAGGAGGAGCTCGCAAATTCTGAGGCTTTTATCAAGAGGCCGAGGCTGGAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACTCCCAACGTCCCGTTCAAGGTCAGATTGCACACTCGTTCCAGTTCTCGTCTGAGCGCTCCGATCTCGTCGTCTCGTCTTCGTGCATTCTGGCTGCGTTCACGAGCGTCGAAAAATCACTCGGAATTTATTAGGTTTTGTATGTTGCTGCACGAGCCTAACTTGAGGCTGCCATGGTTTTCCCGACGTGCAGATGCAGGTCCGGAAAGAGAAGCTGGGCGAGCGCATCACCGCTCTTCAGCAGCTCGTCTCGCCATTCGGCAAGGTGAGTTCTTCGATGATGGTCTTGATGTGGATACAGGTTTGTTTAGGATGCACGCTTTGCATGACGCTGCGCTGCACATCTCGAATGGATTGTGGTCTTTTTTTCATGTCCGCATTCTCCTGCAGACGGACACGGCGTCGGTGCTTCTGGAAGCAATTGGCTACATCAAGTTTCTGCAAGAGCAGGTCCAGGTACGAGAGGGGGCTCGAGGTTTGAAGTGCAAATTTATCAGATTTGAGGCACCTGTGATTTGAGATAGTGCCATCTCCATCCAGCTTACATGATTTGGGCCAAGCAGATGGATGATAATCTCGTGTGGCGTTCTGTGCAGGTGCTGAGCACACCGTACATGAAATCCAACGTCGGGCCCAGCAGCATGCACCATGTAAGTCTCACGACCTCCATTAGATGAGGTTCAGGTTCAGGTTGAGTAGTAGTATTATTAGTAGCAGCAGCAGCAGCAGCAGGAGGAGCAGGAATTTGGGAATGTTGGGCTGATTGGGGATTGGGGTGGATGTGTGATGTGACATCAGGACAATCCACACGATGTGAGCAAGATGGGATGGGCGTCGACCAAGGTGAAGAGCCAGGATGACGCCAGGCAGGATCTGCGAAGTAGGGGACTATGCCTAGTGCCCGTGTCTTGCACTCTACAGGTGGCAAACGACAACGGAGCCGATTTCTGGACGCCTGCCATTGGGGGAAGCTGCCGGTAGTGCGAGGAGGCGACGACGACGACGACGTCGTGCGCTTCTTCCTGTCTGCTGCTCCCTTTCCATCTTCTAGACAGTTTTGTTAAGTTGTTTAGTGCTCGAAGTTCTAGACCGACCGACCGACCGACCGACGACATTCTCCGATTCAGTAGTCAGTATCATCCACTGCTGCCCGCCCCCAAATGCAAGCTTCTGCAGCGCCCTGAGTTGCTTAGGTCCTACCTCGGAGCTGAATGTACATACACCGTCGCCAGTGTACTCAGGCGGACCATCCACTGAGCCATCATCCAAGCAAGCAAGCATATCAGATCAGATCAGTCAGGGCAATCAAACCCCCATGTGTGTCGAACATTAAAAGCGTCTTGGTGCTGCAGAGCTCGTCGAGAACTTAGATGAAGAGGGAGTGCACTGTGCCGTCTTCTCCCTGATATTCATTCCCCTCAAAAAGTTGAGGGAGTCAGTAAAAGTAAACAGTGTACATAAAATATGTATTGGCAATAAAACTGATGCAGCAATCATTGGACATCATTCACTTCC

mRNA

>Mapoly0055s0052.1
GAAGCAAACAAAAGAAGAGTATTATATTGCGGAGATACTATATGGGGGACGGGGCAGCAGCAGCAGCAGCTGCTGCTGATCGGAACTGAACTACAGTGGAGTTGGTAACTTTTGGACCGAGGGGAGCCCAGGCTGCCTGAACCGGGAGAAAGGGTGAGATGAGCCGCAAAAAACGCATTCTGCTGGCAAGACCATGTGATTCCCAATCCACCAAAAAATATAAAGCGGTCCACTCGTCGAGTCTGCTCTCCTCCTGCCTCTGTGCCATCGGTTGCTCCAGCTCATTCACACCTCCTTTTTCCAGTCCTCTTGCCCCCTCCTCTACTACAACTGATCATCACTGCGCACTGCCATGGCCACCTTGGCTAGTAGTATTCCTGTCTGGGCCCATCTCCTCACAAGCGACAGCGGCGTGGTGGAGCACGGGCAGCTGCCGAGGTCGACGTCCGATGCGTTTACAGATTGCGGAAGCTCGCCTCTTTCACAGCATTGGGAAACTCACGAAATGGATTACTCGTCGCACTTCATCATCCCTCCTCAGGCGCACCTGACTTCCAACTCGCACATGTCGCCCTTGCAATGGGCCAACGCGCCCGACGCTGCCCACCATGCCAGCCTCCTGCAGCACTGCTCAGACTACCAGCAGCAGCAGCAGCAGCAGCAACAACAGCAGCTGGAGATTGCGCACCACCAGCAGCAGCAGGATCAACATCCTCACCTCCTTCGACAAGCGAAATCGCACGTGAATCATTTGGCCGACAGTCACGAAGACAGCCGCGATTCGAAGAGACCCGCCCCGAGCATGGGTGCTCAGGAGGAGCTCGCAAATTCTGAGGCTTTTATCAAGAGGCCGAGGCTGGAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACTCCCAACGTCCCGTTCAAGATGCAGGTCCGGAAAGAGAAGCTGGGCGAGCGCATCACCGCTCTTCAGCAGCTCGTCTCGCCATTCGGCAAGACGGACACGGCGTCGGTGCTTCTGGAAGCAATTGGCTACATCAAGTTTCTGCAAGAGCAGGTCCAGGTGCTGAGCACACCGTACATGAAATCCAACGTCGGGCCCAGCAGCATGCACCATGACAATCCACACGATGTGAGCAAGATGGGATGGGCGTCGACCAAGGTGAAGAGCCAGGATGACGCCAGGCAGGATCTGCGAAGTAGGGGACTATGCCTAGTGCCCGTGTCTTGCACTCTACAGGTGGCAAACGACAACGGAGCCGATTTCTGGACGCCTGCCATTGGGGGAAGCTGCCGGTAGTGCGAGGAGGCGACGACGACGACGACGTCGTGCGCTTCTTCCTGTCTGCTGCTCCCTTTCCATCTTCTAGACAGTTTTGTTAAGTTGTTTAGTGCTCGAAGTTCTAGACCGACCGACCGACCGACCGACGACATTCTCCGATTCAGTAGTCAGTATCATCCACTGCTGCCCGCCCCCAAATGCAAGCTTCTGCAGCGCCCTGAGTTGCTTAGGTCCTACCTCGGAGCTGAATGTACATACACCGTCGCCAGTGTACTCAGGCGGACCATCCACTGAGCCATCATCCAAGCAAGCAAGCATATCAGATCAGATCAGTCAGGGCAATCAAACCCCCATGTGTGTCGAACATTAAAAGCGTCTTGGTGCTGCAGAGCTCGTCGAGAACTTAGATGAAGAGGGAGTGCACTGTGCCGTCTTCTCCCTGATATTCATTCCCCTCAAAAAGTTGAGGGAGTCAGTAAAAGTAAACAGTGTACATAAAATATGTATTGGCAATAAAACTGATGCAGCAATCATTGGACATCATTCACTTCC

CDS

>Mapoly0055s0052.1
ATGGCCACCTTGGCTAGTAGTATTCCTGTCTGGGCCCATCTCCTCACAAGCGACAGCGGCGTGGTGGAGCACGGGCAGCTGCCGAGGTCGACGTCCGATGCGTTTACAGATTGCGGAAGCTCGCCTCTTTCACAGCATTGGGAAACTCACGAAATGGATTACTCGTCGCACTTCATCATCCCTCCTCAGGCGCACCTGACTTCCAACTCGCACATGTCGCCCTTGCAATGGGCCAACGCGCCCGACGCTGCCCACCATGCCAGCCTCCTGCAGCACTGCTCAGACTACCAGCAGCAGCAGCAGCAGCAGCAACAACAGCAGCTGGAGATTGCGCACCACCAGCAGCAGCAGGATCAACATCCTCACCTCCTTCGACAAGCGAAATCGCACGTGAATCATTTGGCCGACAGTCACGAAGACAGCCGCGATTCGAAGAGACCCGCCCCGAGCATGGGTGCTCAGGAGGAGCTCGCAAATTCTGAGGCTTTTATCAAGAGGCCGAGGCTGGAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACTCCCAACGTCCCGTTCAAGATGCAGGTCCGGAAAGAGAAGCTGGGCGAGCGCATCACCGCTCTTCAGCAGCTCGTCTCGCCATTCGGCAAGACGGACACGGCGTCGGTGCTTCTGGAAGCAATTGGCTACATCAAGTTTCTGCAAGAGCAGGTCCAGGTGCTGAGCACACCGTACATGAAATCCAACGTCGGGCCCAGCAGCATGCACCATGACAATCCACACGATGTGAGCAAGATGGGATGGGCGTCGACCAAGGTGAAGAGCCAGGATGACGCCAGGCAGGATCTGCGAAGTAGGGGACTATGCCTAGTGCCCGTGTCTTGCACTCTACAGGTGGCAAACGACAACGGAGCCGATTTCTGGACGCCTGCCATTGGGGGAAGCTGCCGGTAG

Protein

>Mapoly0055s0052.1
MATLASSIPVWAHLLTSDSGVVEHGQLPRSTSDAFTDCGSSPLSQHWETHEMDYSSHFIIPPQAHLTSNSHMSPLQWANAPDAAHHASLLQHCSDYQQQQQQQQQQQLEIAHHQQQQDQHPHLLRQAKSHVNHLADSHEDSRDSKRPAPSMGAQEELANSEAFIKRPRLEQQQQQQQQQTPNVPFKMQVRKEKLGERITALQQLVSPFGKTDTASVLLEAIGYIKFLQEQVQVLSTPYMKSNVGPSSMHHDNPHDVSKMGWASTKVKSQDDARQDLRSRGLCLVPVSCTLQVANDNGADFWTPAIGGSCR

Mapoly0055s0052.2  

Gene structure:

mRNA scaffold_55:635292..639408  ( - strand )
three_prime_UTR scaffold_55:635292..635825  ( - strand )
CDS scaffold_55:635826..636008  ( - strand )
CDS scaffold_55:636157..636210  ( - strand )
CDS scaffold_55:636351..636416  ( - strand )
CDS scaffold_55:636542..636613  ( - strand )
CDS scaffold_55:636786..636941  ( - strand )
CDS scaffold_55:637099..637347  ( - strand )
five_prime_UTR scaffold_55:637348..637456  ( - strand )
five_prime_UTR scaffold_55:638652..639408  ( - strand )

Sequences:

Gene

>Mapoly0055s0052.2
GAAGCAAACAAAAGAAGAGTATTATATTGCGGAGATACTATATGGGGGACGGGGCAGCAGCAGCAGCAGCTGCTGCTGATCGGAACTGAACTACAGTGGAGTTGGTAACTTTTGGACCGAGGGGAGCCCAGGCTGCCTGAACCGGGAGAAAGGGTGAGATGAGCCGCAAAAAACGCATTCTGCTGGCAAGACCATGTGATTCCCAATCCACCAAAAAATATAAAGCGGTCCACTCGTCGAGTCTGCTCTCCTCCTGCCTCTGTGCCATCGGTTGCTCCAGCTCATTCACACCTCCTTTTTCCAGTCCTCTTGCCCCCTCCTCTACTACAACTGATCATCACTGCGCACTGCCATGGCCACCTTGGCTAGTAGTATTCCTGTCTGGGCCCATCTCCTGTAAGCTCTTTCACATCCCTCGCCACCTCTGTGCAATGAATGAGTTCTGACTGCCTGCTCTCTGCGTGTAGTTGTTTGCGCTCCTCGCCAATCACTTTGTCTTGGTCGACTACGAAAGTCGCCGGTCGCTGCACTCACTGTCTCTACTCACTGCTCATAATACTCACATGTGGGCCGACGCCCCTCGCCCTTCTGCTGCTCCTGCTCCTGCTCCTGCTGCTGAATGAGGTCTTGTGAAAGTGTGCACCATCATCTGCTCGCTTCTGCTGCTCCCGTTGTCGTCGTCTTCATTGCCTTGTAATTAGCTGCTCGCTCCTTCGTCTGCTGCTGCCTCCGTGTCCTCCAGTTCATTCTTCGTCAGGTGGGTTTCCGAAGCGAGTCTGTGCGTCCTGCATCCTGCATCCTGCGTGCTCCTTGCTCCTTGTCTCGGTCTTGCAGAGCTCTCTCGTCATATCGCCACGAGCATTTTCGGCTGCGAGCTTCTGCGCTATCGACATTTCGGACCTTCGGCCAGCACCATGTTCGTGCTCGGGCTCCGAGTAAACTAAAATTCTATCTATTTACAGGCAAGGCAATGAACGCATGCATTTGTAAGATCGAATCACACGAGCTCGCTCATTCATTCCCTCGTTCTCGCTGCCGATGAAATCTGCGTCGGTCGATTGCTCAGAGGTCAGTCCATCTCGAGTCAATCTCGAATCCTCATGCCCCGCGTGTCTGTGTCGAGGGCCGACATCCTCCTCCGAACACCGCACGTACTGACGGGCTTCCGGCGTCTGCAAATCCACTTCTTACTCACATGGCCGCCTGCCTGGTCTCTGACCAGCTCCGCACCTCACTGCTTGGAAACAGGAGCGGCCATGCCGCTGGATCAGAATTAGACCTGCTGCTGAAATCAAAATTCCAGCAGCGGCGGTGCGGTCGCAGGCACCACGCGGCCTTCGAATGTGGTGCAGTCAGCGTCCACTGCTGTAGCCGCCATTCTCCCGAACGAAATGGGGGTATGGAATCAGATCGAGAGTGGTGTCTGAGCTGCTGAGGTCGGGTCGATGCATGACTCGACACGACACGACACGACACGACATGACATGCTATGCTGTTTCTGCTGCTGCTGCGGCGGCTGTGCTCGATTTGTTCTCTAAGCTTGACAGTGTTGTACAGAGATTGAATTTCGTGGTGCTTGGGGCATGGCTGGTTCACTGTGACTGCTACACTGGTCGGTCGGTCGCTTGTGCTTGGGTGAGGCCGTCATTTGGTTTGAGGGGTCTGCGATTGTATTGAGTCAAGTCAAGCTCGCTAGGTCGTCGAGGCGGGCACGGCGCGAAAGCTGCTGCTGCTGCTGCTGCTGCTCTCGATCGTAGAGATCCGTCTGATCAGCAGAATGAATGAATGAATGAGCATCCCTGATACATGCGTCAAAGGGTGCAAGGCTGGGCATGGGATTCAAATGCTCGTCTCGATAGGGTGGCATGACTTTGACCGGGGCCATGGAACAATGCGAGGATTGCTGATTGTCTCATGGTGCTCACCTTCGTTTGTAATGTAATGTAATGCAGCACAAGCGACAGCGGCGTGGTGGAGCACGGGCAGCTGCCGAGGTCGACGTCCGATGCGTTTACAGATTGCGGAAGCTCGCCTCTTTCACAGCATTGGGAAACTCACGAAATGGATTACTCGTCGCACTTCATCATCCCTCCTCAGGCGCACCTGACTTCCAACTCGCACATGTCGCCCTTGCAATGGGCCAACGCGCCCGACGCTGCCCACCATGCCAGCCTCCTGCAGCACTGCTCAGACTACCAGCAGCAGCAGCAGCAGCAGCAACAACAGCAGCTGGAGATTGCGCACCACCAGCAGCAGCAGGATCAACATCCTCACCTCCTTCGACAAGCGAAATCGCACGTGAATCATTTGGTTCGTTGCCTACCTCGCTCCTCTCTTTCTCTTTCTCTCCCTTCTTTGTGGTTGCCGGATCATTCCACGATCCCACTGTCATGGGAACTGGAGCTCCAATCCAAGGAGCTCTAGAAATCGCATGGGAATGATCCTCACTTCTCGCTGATGCTCGCAGGCCGACAGTCACGAAGACAGCCGCGATTCGAAGAGACCCGCCCCGAGCATGGGTGCTCAGGAGGAGCTCGCAAATTCTGAGGCTTTTATCAAGAGGCCGAGGCTGGAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACTCCCAACGTCCCGTTCAAGGTCAGATTGCACACTCGTTCCAGTTCTCGTCTGAGCGCTCCGATCTCGTCGTCTCGTCTTCGTGCATTCTGGCTGCGTTCACGAGCGTCGAAAAATCACTCGGAATTTATTAGGTTTTGTATGTTGCTGCACGAGCCTAACTTGAGGCTGCCATGGTTTTCCCGACGTGCAGATGCAGGTCCGGAAAGAGAAGCTGGGCGAGCGCATCACCGCTCTTCAGCAGCTCGTCTCGCCATTCGGCAAGGTGAGTTCTTCGATGATGGTCTTGATGTGGATACAGGTTTGTTTAGGATGCACGCTTTGCATGACGCTGCGCTGCACATCTCGAATGGATTGTGGTCTTTTTTTCATGTCCGCATTCTCCTGCAGACGGACACGGCGTCGGTGCTTCTGGAAGCAATTGGCTACATCAAGTTTCTGCAAGAGCAGGTCCAGGTACGAGAGGGGGCTCGAGGTTTGAAGTGCAAATTTATCAGATTTGAGGCACCTGTGATTTGAGATAGTGCCATCTCCATCCAGCTTACATGATTTGGGCCAAGCAGATGGATGATAATCTCGTGTGGCGTTCTGTGCAGGTGCTGAGCACACCGTACATGAAATCCAACGTCGGGCCCAGCAGCATGCACCATGTAAGTCTCACGACCTCCATTAGATGAGGTTCAGGTTCAGGTTGAGTAGTAGTATTATTAGTAGCAGCAGCAGCAGCAGCAGGAGGAGCAGGAATTTGGGAATGTTGGGCTGATTGGGGATTGGGGTGGATGTGTGATGTGACATCAGGACAATCCACACGATGTGAGCAAGATGGGATGGGCGTCGACCAAGGTGAAGAGCCAGGATGACGCCAGGCAGGATCTGCGAAGTAGGGGACTATGCCTAGTGCCCGTGTCTTGCACTCTACAGGTGGCAAACGACAACGGAGCCGATTTCTGGACGCCTGCCATTGGGGGAAGCTGCCGGTAGTGCGAGGAGGCGACGACGACGACGACGTCGTGCGCTTCTTCCTGTCTGCTGCTCCCTTTCCATCTTCTAGACAGTTTTGTTAAGTTGTTTAGTGCTCGAAGTTCTAGACCGACCGACCGACCGACCGACGACATTCTCCGATTCAGTAGTCAGTATCATCCACTGCTGCCCGCCCCCAAATGCAAGCTTCTGCAGCGCCCTGAGTTGCTTAGGTCCTACCTCGGAGCTGAATGTACATACACCGTCGCCAGTGTACTCAGGCGGACCATCCACTGAGCCATCATCCAAGCAAGCAAGCATATCAGATCAGATCAGTCAGGGCAATCAAACCCCCATGTGTGTCGAACATTAAAAGCGTCTTGGTGCTGCAGAGCTCGTCGAGAACTTAGATGAAGAGGGAGTGCACTGTGCCGTCTTCTCCCTGATATTCATTCCCCTCAAAAAGTTGAGGGAGTCAGTAAAAGTAAACAGTGTACATAAAATATGTATTGGCAATAAAACTGATGCAGCAATCATTGGACATCATTCACTTCC

mRNA

>Mapoly0055s0052.2
GAAGCAAACAAAAGAAGAGTATTATATTGCGGAGATACTATATGGGGGACGGGGCAGCAGCAGCAGCAGCTGCTGCTGATCGGAACTGAACTACAGTGGAGTTGGTAACTTTTGGACCGAGGGGAGCCCAGGCTGCCTGAACCGGGAGAAAGGGTGAGATGAGCCGCAAAAAACGCATTCTGCTGGCAAGACCATGTGATTCCCAATCCACCAAAAAATATAAAGCGGTCCACTCGTCGAGTCTGCTCTCCTCCTGCCTCTGTGCCATCGGTTGCTCCAGCTCATTCACACCTCCTTTTTCCAGTCCTCTTGCCCCCTCCTCTACTACAACTGATCATCACTGCGCACTGCCATGGCCACCTTGGCTAGTAGTATTCCTGTCTGGGCCCATCTCCTGTAAGCTCTTTCACATCCCTCGCCACCTCTGTGCAATGAATGAGTTCTGACTGCCTGCTCTCTGCGTGTAGTTGTTTGCGCTCCTCGCCAATCACTTTGTCTTGGTCGACTACGAAAGTCGCCGGTCGCTGCACTCACTGTCTCTACTCACTGCTCATAATACTCACATGTGGGCCGACGCCCCTCGCCCTTCTGCTGCTCCTGCTCCTGCTCCTGCTGCTGAATGAGGTCTTGTGAAAGTGTGCACCATCATCTGCTCGCTTCTGCTGCTCCCGTTGTCGTCGTCTTCATTGCCTTGTAATTAGCTGCTCGCTCCTTCGTCTGCTGCTGCCTCCGTGTCCTCCAGTTCATTCTTCGTCAGCACAAGCGACAGCGGCGTGGTGGAGCACGGGCAGCTGCCGAGGTCGACGTCCGATGCGTTTACAGATTGCGGAAGCTCGCCTCTTTCACAGCATTGGGAAACTCACGAAATGGATTACTCGTCGCACTTCATCATCCCTCCTCAGGCGCACCTGACTTCCAACTCGCACATGTCGCCCTTGCAATGGGCCAACGCGCCCGACGCTGCCCACCATGCCAGCCTCCTGCAGCACTGCTCAGACTACCAGCAGCAGCAGCAGCAGCAGCAACAACAGCAGCTGGAGATTGCGCACCACCAGCAGCAGCAGGATCAACATCCTCACCTCCTTCGACAAGCGAAATCGCACGTGAATCATTTGGCCGACAGTCACGAAGACAGCCGCGATTCGAAGAGACCCGCCCCGAGCATGGGTGCTCAGGAGGAGCTCGCAAATTCTGAGGCTTTTATCAAGAGGCCGAGGCTGGAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACTCCCAACGTCCCGTTCAAGATGCAGGTCCGGAAAGAGAAGCTGGGCGAGCGCATCACCGCTCTTCAGCAGCTCGTCTCGCCATTCGGCAAGACGGACACGGCGTCGGTGCTTCTGGAAGCAATTGGCTACATCAAGTTTCTGCAAGAGCAGGTCCAGGTGCTGAGCACACCGTACATGAAATCCAACGTCGGGCCCAGCAGCATGCACCATGACAATCCACACGATGTGAGCAAGATGGGATGGGCGTCGACCAAGGTGAAGAGCCAGGATGACGCCAGGCAGGATCTGCGAAGTAGGGGACTATGCCTAGTGCCCGTGTCTTGCACTCTACAGGTGGCAAACGACAACGGAGCCGATTTCTGGACGCCTGCCATTGGGGGAAGCTGCCGGTAGTGCGAGGAGGCGACGACGACGACGACGTCGTGCGCTTCTTCCTGTCTGCTGCTCCCTTTCCATCTTCTAGACAGTTTTGTTAAGTTGTTTAGTGCTCGAAGTTCTAGACCGACCGACCGACCGACCGACGACATTCTCCGATTCAGTAGTCAGTATCATCCACTGCTGCCCGCCCCCAAATGCAAGCTTCTGCAGCGCCCTGAGTTGCTTAGGTCCTACCTCGGAGCTGAATGTACATACACCGTCGCCAGTGTACTCAGGCGGACCATCCACTGAGCCATCATCCAAGCAAGCAAGCATATCAGATCAGATCAGTCAGGGCAATCAAACCCCCATGTGTGTCGAACATTAAAAGCGTCTTGGTGCTGCAGAGCTCGTCGAGAACTTAGATGAAGAGGGAGTGCACTGTGCCGTCTTCTCCCTGATATTCATTCCCCTCAAAAAGTTGAGGGAGTCAGTAAAAGTAAACAGTGTACATAAAATATGTATTGGCAATAAAACTGATGCAGCAATCATTGGACATCATTCACTTCC

CDS

>Mapoly0055s0052.2
ATGGATTACTCGTCGCACTTCATCATCCCTCCTCAGGCGCACCTGACTTCCAACTCGCACATGTCGCCCTTGCAATGGGCCAACGCGCCCGACGCTGCCCACCATGCCAGCCTCCTGCAGCACTGCTCAGACTACCAGCAGCAGCAGCAGCAGCAGCAACAACAGCAGCTGGAGATTGCGCACCACCAGCAGCAGCAGGATCAACATCCTCACCTCCTTCGACAAGCGAAATCGCACGTGAATCATTTGGCCGACAGTCACGAAGACAGCCGCGATTCGAAGAGACCCGCCCCGAGCATGGGTGCTCAGGAGGAGCTCGCAAATTCTGAGGCTTTTATCAAGAGGCCGAGGCTGGAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACTCCCAACGTCCCGTTCAAGATGCAGGTCCGGAAAGAGAAGCTGGGCGAGCGCATCACCGCTCTTCAGCAGCTCGTCTCGCCATTCGGCAAGACGGACACGGCGTCGGTGCTTCTGGAAGCAATTGGCTACATCAAGTTTCTGCAAGAGCAGGTCCAGGTGCTGAGCACACCGTACATGAAATCCAACGTCGGGCCCAGCAGCATGCACCATGACAATCCACACGATGTGAGCAAGATGGGATGGGCGTCGACCAAGGTGAAGAGCCAGGATGACGCCAGGCAGGATCTGCGAAGTAGGGGACTATGCCTAGTGCCCGTGTCTTGCACTCTACAGGTGGCAAACGACAACGGAGCCGATTTCTGGACGCCTGCCATTGGGGGAAGCTGCCGGTAG

Protein

>Mapoly0055s0052.2
MDYSSHFIIPPQAHLTSNSHMSPLQWANAPDAAHHASLLQHCSDYQQQQQQQQQQQLEIAHHQQQQDQHPHLLRQAKSHVNHLADSHEDSRDSKRPAPSMGAQEELANSEAFIKRPRLEQQQQQQQQQTPNVPFKMQVRKEKLGERITALQQLVSPFGKTDTASVLLEAIGYIKFLQEQVQVLSTPYMKSNVGPSSMHHDNPHDVSKMGWASTKVKSQDDARQDLRSRGLCLVPVSCTLQVANDNGADFWTPAIGGSCR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>