Mapoly0061s0023



Description

Zinc finger, C2H2 type // Zinc-finger double domain // C2H2-type zinc finger

Reference DB

Database ID Description
GO GO:0046872 Metal ion binding
OrthoMCL OG5_131821
PFAM PF00096 Zinc finger, C2H2 type
PFAM PF13465 Zinc-finger double domain
PFAM PF13894 C2H2-type zinc finger
PANTHER PTHR24409 FAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC2H2-8 transcription factor, C2H2-ZnF Mapoly0061s0023.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0061s0023.1 scaffold_61:180914..186829  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0061s0023.1  

Gene structure:

mRNA scaffold_61:180914..186829  ( - strand )
three_prime_UTR scaffold_61:180914..181291  ( - strand )
CDS scaffold_61:181292..181480  ( - strand )
CDS scaffold_61:182007..182150  ( - strand )
CDS scaffold_61:182306..182535  ( - strand )
CDS scaffold_61:182837..183131  ( - strand )
CDS scaffold_61:183634..183814  ( - strand )
CDS scaffold_61:184065..184152  ( - strand )
CDS scaffold_61:184362..184386  ( - strand )
five_prime_UTR scaffold_61:184387..185883  ( - strand )
five_prime_UTR scaffold_61:186146..186829  ( - strand )

Sequences:

Gene

>Mapoly0061s0023.1
CCAAATTGGCCCTCATTGCGCTATGACCTGATTACTACACATTACGTACCTCCCATTTTCTTCTCTGTTTCTGCACTCGCCTCCAACAAAATTAGAGGAACGATTAGAGGACGATATCATCTTCAAGTCCGTATGATTTGTCGAACGCACGCTCTATGGTTTATAAGCATATTTCTCTTTGTCTGCCGTGTCATGGAGCCGATTATCTATTTTCTGCAACGATGTTCTTAAACCCTGAGAAAAGCTCAAGGTTTAAGGCAATCGGTGGAACTCAAGCAATTGTATCGATTCTCGGGCAACAGCGAGGGGAGTCTGTAGGTCATGGGAGTCACCAGGTCACTACCCGTGTCGAACGCAACTTCGTCGTCTTCGTTTACACCGCGCGGTTCGATGTCGGTGGAGCATTTTGTACCTGCCAGTCTGCGCTTCGTTTGATGGCGAATGGAGGGCTGAAGAACCTATTTTCCGAAACCACTTGTTGATTTTACTGAAAAAACTTGGAGGATTTTGGGCACCTTTGAGAATACCCTGATTTTTCATCCCCTAACTCACACAGCAAATGACGGAATGACTGCCCGAAAATCTTCTGAAACAGAGGATTGTTGAAAGTGTCCAAAACACACATCTGGGGAACGATAAAGAGCACACAATACCAGGCAGCATCTTTAGAGACGACTGGTGGAGGTAATCCATGATAGACGACCACATTAGTTGATGATTTCTCGGATGCTCTGTAACTAATAATTTCAAAGGTTGAACATACTCTGTTCCGATGATATATTTTATCGTGTGTTGCTGTTGGGGCTAGCACCCTGCCCATAGCCTGTCCGAGGATTCCCGATGCTTTTGGTTATTTCACTTTGTATGGTCTCATTTCGTGCACACAACCAGAGGCTTGCGCCGAAGGGTTGTCTCATGAGAAGGCAAATTGTGGCATTGCTTCCAGGGTCTCGTACAACGAAGCAGGTGCTTTGTGACAGCCACGTTTGACAAGAATAGTGTCGATCGAGAGGGGACAGTGTGAAGCATCTGGCAAGAGGAATCTCGCCAATCTGTTCGTATACGGACGCAATCAATTATGGAAGTCTCTTGTCCAACGTAACGCAAGGAATTGAGGAAGGAGAAATTCCCAGTGCACAGTGTGGCCGCAGCACGTAACTCTAGGCTGAGCGGGGTCAGGATTTCTCTAGGACCCACAGGTACAGACAGACTCCGAAGGACGACGACGCACTGGCGCAGCAACGGCCATACATCCTTGCAGCTCTTCGTCTGCTCGTTTGATTCACGATATCGAAGCTACAGGTCGGCCAATTTTGTTTCCAGATACATAAGCAGGTCACTGGAGTACCGCAGTGGTCTAGGTTGTCGTCGTTGAACTCACCTCATCATACAGCTCCTCGAGCAAAGTGCACAATCATTGCTTGAGGAGAACAGAGGTGGTCAAACGCTCGAAGTTTGTGGTGCGCTGGCTGGTTGGTTGGCCAGGCCGGATTTTACACTTTAGGGACGACCGAGGGACTCGGTTGTTGATCGAACTTGATGTCAACAGAACGGAAGACAATCTGACTCGACCTTATCTACACGACCTCCGGCTCGAGAGATTCAATTTTTTGGGAAAACTCGAGGGATGGAGCATTGAATTGCTGCCGTTTCTTGAGCTTTGGTACGTCCTCTCATATGATTCCGCATTTGAGTGTCGGGGTTCTGGTGCAGGTGTGTGTTCTCACCGGGTTTTTTTCAACAGCGTGTCTAGTCTCTGTGTCCCTTCTGCACGGATTGCATGCCTATCTTCTTCCTGAAGCCGGAGAAAAAGAGTAAACCGCAGGGAAGGGGAAACGAAGGCCTCAAGGTTCAGCCAGGCAGAAGAAGGGAAAGAAAGACAGCAAAGATGTGTGGGACGAAGCCAGCTCTCATATTCTGAGAATTGATTTGGCCGAGTCTCAGCTAGATACTAGAAAATATTTCCAGGAGTATGACGAAGCAAATATCTACACCGATCTCAGCCTCACCAACTTCGTGACGAGGGAAATTCTCCAATTCACGTCCGCCGGTCTGCAGACGAGGCACGAATGGGCTCAATATCTCGCTCCAGACGAACGCATCACATTTATGGTCACATAAATTGTTCCGTGGACTGATCTCCAAAAAGCCCTGGCGTGATCGCTCAGACCGTGAACCCCAAGGCTCGCTGACCCTGGACTAGGTCTCAGTTTTTGTCAGAACACTACTGGGGAGTAGAGATCTGAGAGTGGCGTTTACAGTGCCCGTGGTATGAATTCAACAGCTCAATAGGACGATTGGCACAGTCTGTCAGATGCTCTGGACTTGTGCGCTCCTTCGTTTGAATTTCACCGAAGGATACAGGTTTACTTAAGCGGGAAGGTTGTTGCGTTCAGCTGCATATCTGGTAGAGCCTGGGAGGCCAGTGCTAAGATTTGATGTAATGTCGTGTCGTGTAGATGATCCAAGTAAGTCTTGCTTTAACAACTGACGAAGGATCAATGTTTTCTTGTTACCGGTTCTTCGTACTGCGCATAGAAGACACATCTAACAGCAGTAGGCGAATTTGTACATTTCTTGTCGTGCTCATTATATTCCAGCTTTTGTTATAATGATACTGCAACTAACCAGAGAAGACCGATGTTTTTGTCATGCAACACTGTCGTGGTTTATGCAGAACGTAAAAGGCATGAACTCATCGGACTTGGACTTCCCGAGGTGCCTCAAGAACATGACTCCCAAGCTGCAACGTATGAACATGTCAAGTATCCTCCATAAATTTGCTGTTTTGGGATCTAGTTGCTGTTTCATACTGATGTCATCATCTTAACCTCAAGGTGCTCGTCTTTGCCGAAGTTTTCTGTTTTCTTTAACCACTGTTGCGCTTACTTATAAGGTGACATGGTTGTGTGTTTCGCTGTAATCAAAGCTTTGACCATCATCACATTACCTGGATTCGCTTCTGCTAGTATATCTATTGGAACATAGTCAGGCTTGTTACCTTGACGGACACAGACATTTGAATGAGAAGATGGAAGCCGAAGAGATGGAGCAAGATTACCCCACGGAATCTTCTGATGAGGAGATGCCAAAAATAAAAAAAAGGGAAGAGAAGAAGTACAATTGTCAAGAGTGTGATTATGCTGCTAGTAAACCTGCGCTGCTCATACAGCACCTACGATCTCACTCTGAACAGGTTTGAGTCTCTTTTGCTGTGAAGGGGCTTCCCTTTTTTTGCTCTCTACATATATTTTACGTGAAAGCTTTACCTTGACAACAATTGGGTGATCTACCTTTGTTTATGAGCTTGACACATATTCCCGCTTTGAAGCAGCTTCGTCCGTCACTTGGAGACATGAGACCATCAGTTGAAGTGTGGAATGAGTTTCTCTGTGCACGTGGTTTTCCTTTCATTAAAAATTGGTTGTATTGTTCGTAACTTGATTAGTTTTCATGTTCAGGATTGCACACATGAGACTTACATCATGATGACCATGGTCTGATCAGCGCTGGCACACCGGATCTCATCCGAACTCCGAAGTTAAGTGTGCGATTGGACCACCAGATTAGTACTAGGGTGGGTGACCACCCAGGAAGTCCTGGTGCTGCTTACAAGACCGTGTCTTACGTATATGTAATGGGGAATTGTTCGATCCATAACTAAGTGAATTGGGCGTTCTTTGTTTTCTGAACAACAGAAACCTTTTTCTTGCCCCGTGAGTGGTTGCCCTAGCACATACAAGCGTCAGGATCACCTCAATCGTCATATGAAGATACACGATGGAGCCCGGTTTAGCTGTACAATACCAGGTTGTGACCGGTCTTTCAGCATGATGACTAATCTAACGCGTCATTTAAAGTATCATGCTGAAAAGTCCATTTTTCCGAAGCCCAAGTCTTCCGGAGAGAAAAAGCACAAATGTCTAAACCCTGGTTGTGAGAAGATATTTCGATATCAATCAGAGCTGCGATCTCACGAGGACAACGTTCATAGTGAGAAACTGCCTCCCTTTTTTCTACAAGTCTTTAGTCTAATTAGTAGTTGTTCCTCGAAGGCAGTTTGCCTGCTGGAAGCAAGTCCTGTAATAATCTCTGAGGAGAAGGTGATGCATCAAGCTCTTACTGGTTCTGTAGAGAACCTCTTTTACCTCAAGGAAGCTGAGCATTCTGTCAATATGGTTGAGGTTTATATGTTCATCTAGTGGGATTCTGAAAACGGGATTTATCAGGTCTCCAGATACCGTTGTGGTATATCCCTTATTCCTGAGTGGTGTTTTTGACATCTTTTGAACAGGCATCGTTTTTGCGGAGCATGTGTGCATATACCCCGGGTGTGGAGAGAAACTGACTAGCGAGGCAGCACTCTTGAAACATGCTGTAGAAGCACATCCATATCTTTTATGTGAGGTCTGCGGTGAAACTATTACAAGGCAAGCATACAGGCGGCACGTGCGCTCTCATGGAACGAAAAAGCCTGTAAAAGTTACATGTCCTTACGAGGGGTGCACACATCATTACACAAGGGTAAGTCGTCTCTCCGAGCTCGGTGAAACATAAATCCCTTTCCGTTGAATTAGATGTACAATCGTGGACAAGCAATTATACTTATGTAACCTGCTTGTTTCGTGATTTGTTGAAACTTTTCGGTCACCAACCTCTTGATGGATTGTACCTTGTAGGAATCGAACCTAAGGTCGCATATCAGGTCTTTCCACCTTAAGCTGAAGCCATTTGTATGTTCTTTCGAGGGTTGTGACAAAAGCTTCGCCCACAAGGCTGCAAGAAAGAGGCATGAAATGTCAGTAGTACACTGTCATACTGGAGTAAGGCATTCATTCACTTTATTCGCCTTTCTTTGTGTTGAAACCAGCTTAGAACAGCTCTTTTTCAAAGTTGTATCTGTTAGTTAGTGTCCGGGATCCCTTATCTACTAAGGCAGCTCCCATCAGAATTTCTGTCCAATTTTGGAGTTAATTATTGTAGGGACGTAGACGATGGCTTTTTTCTTACTTATCTATCCAGCACTGCTCAGACAAGGTGGGGGTGCAACGGTCTTCAGGCAACGAAATGCACATTCTCATGACAATATTCATTGACGATAGTTACCATGGTGCAAATTATCTCACGAAGTCATATAGGTCTTCTTGCGTACTTCCTAATAATGGCATATTTGTCCTGAAAGACAATGGAGCGAGGATAAGTTGACAATTCTCTTTTCATAGAAGTATAATCGCCAACATAGATGTTGGTGGAAGTACCCCATTAATATATCCAGTGTACACAGCGGACACCTGCAGATATCGAAATAAGCAGCGTTAACGTACGAGTTGTTTTGTATTTGCGACGCAGACCGATTTTGAGGCGGCAGAGCTGGCGGAGTCATCGAAGTCAAAGGGTGGCAGGAAGAAAGTCTGTTTTGAAAAGGTGGAGGACCTGTATATCAGAAGAGCAAAGAAGGTATCATCGAGTCGTGCTAAGGGGCAGCATCATCACATCGATAGTCAAGGAGAAGAAGAAATGAAGATTGGTACTTTATGAGCCAATACGTAAATAACAATGCGCAATTAGAGATCTGGTGTGAGGGGCTTATGTTCCCACCCAGACGCGTATACGTCATTACCTCGGCCATTAGAGTAGTAAACTGAAGAGCAGATTTATGTAGTATCATAGTCGCAGTTGGTCAGTAAGTTTCATCTTACAAGACTCGGTCTTTGCCGTCAGGTGCATTTGAGGGGTTCTTTTCTTTTGATGGCTGGTTCGAACGTATAGTACGGCTTTCTTTCTCTTTTCGGCAAGAAAGAAGGATATAGAATATTTATGTTTACTTCACAACGGGACCAGTGATTGTATCCTGAGTGAAAGAAGGCATGGTTGGCAAAATTAGTGGTTTCATATTGGAGAAGTTGAAAATTTCGC

mRNA

>Mapoly0061s0023.1
CCAAATTGGCCCTCATTGCGCTATGACCTGATTACTACACATTACGTACCTCCCATTTTCTTCTCTGTTTCTGCACTCGCCTCCAACAAAATTAGAGGAACGATTAGAGGACGATATCATCTTCAAGTCCGTATGATTTGTCGAACGCACGCTCTATGGTTTATAAGCATATTTCTCTTTGTCTGCCGTGTCATGGAGCCGATTATCTATTTTCTGCAACGATGTTCTTAAACCCTGAGAAAAGCTCAAGGTTTAAGGCAATCGGTGGAACTCAAGCAATTGTATCGATTCTCGGGCAACAGCGAGGGGAGTCTGTAGGTCATGGGAGTCACCAGGTCACTACCCGTGTCGAACGCAACTTCGTCGTCTTCGTTTACACCGCGCGGTTCGATGTCGGTGGAGCATTTTGTACCTGCCAGTCTGCGCTTCGTTTGATGGCGAATGGAGGGCTGAAGAACCTATTTTCCGAAACCACTTGTTGATTTTACTGAAAAAACTTGGAGGATTTTGGGCACCTTTGAGAATACCCTGATTTTTCATCCCCTAACTCACACAGCAAATGACGGAATGACTGCCCGAAAATCTTCTGAAACAGAGGATTGTTGAAAGTGTCCAAAACACACATCTGGGGAACGATAAAGAGCACACAATACCAGGCAGCATCTTTAGAGACGACTGGTGGAGGGTCTCGTACAACGAAGCAGGTGCTTTGTGACAGCCACGTTTGACAAGAATAGTGTCGATCGAGAGGGGACAGTGTGAAGCATCTGGCAAGAGGAATCTCGCCAATCTGTTCGTATACGGACGCAATCAATTATGGAAGTCTCTTGTCCAACGTAACGCAAGGAATTGAGGAAGGAGAAATTCCCAGTGCACAGTGTGGCCGCAGCACGTAACTCTAGGCTGAGCGGGGTCAGGATTTCTCTAGGACCCACAGGTACAGACAGACTCCGAAGGACGACGACGCACTGGCGCAGCAACGGCCATACATCCTTGCAGCTCTTCGTCTGCTCGTTTGATTCACGATATCGAAGCTACAGGTCGGCCAATTTTGTTTCCAGATACATAAGCAGGTCACTGGAGTACCGCAGTGGTCTAGGTTGTCGTCGTTGAACTCACCTCATCATACAGCTCCTCGAGCAAAGTGCACAATCATTGCTTGAGGAGAACAGAGGTGGTCAAACGCTCGAAGTTTGTGGTGCGCTGGCTGGTTGGTTGGCCAGGCCGGATTTTACACTTTAGGGACGACCGAGGGACTCGGTTGTTGATCGAACTTGATGTCAACAGAACGGAAGACAATCTGACTCGACCTTATCTACACGACCTCCGGCTCGAGAGATTCAATTTTTTGGGAAAACTCGAGGGATGGAGCATTGAATTGCTGCCGTTTCTTGAGCTTTGGTACGTCCTCTCATATGATTCCGCATTTGAGTGTCGGGGTTCTGGTGCAGGTGTGTGTTCTCACCGGGTTTTTTTCAACAGCGTGTCTAGTCTCTGTGTCCCTTCTGCACGGATTGCATGCCTATCTTCTTCCTGAAGCCGGAGAAAAAGAGTAAACCGCAGGGAAGGGGAAACGAAGGCCTCAAGGTTCAGCCAGGCAGAAGAAGGGAAAGAAAGACAGCAAAGATGTGTGGGACGAAGCCAGCTCTCATATTCTGAGAATTGATTTGGCCGAGTCTCAGCTAGATACTAGAAAATATTTCCAGGAGTATGACGAAGCAAATATCTACACCGATCTCAGCCTCACCAACTTCGTGACGAGGGAAATTCTCCAATTCACGTCCGCCGGTCTGCAGACGAGGCACGAATGGGCTCAATATCTCGCTCCAGACGAACGCATCACATTTATGGTCACATAAATTGTTCCGTGGACTGATCTCCAAAAAGCCCTGGCGTGATCGCTCAGACCGTGAACCCCAAGGCTCGCTGACCCTGGACTAGGTCTCAGTTTTTGTCAGAACACTACTGGGGAGTAGAGATCTGAGAGTGGCGTTTACAGTGCCCGTGGTATGAATTCAACAGCTCAATAGGACGATTGGCACAGTCTGTCAGATGCTCTGGACTTGTGCGCTCCTTCGTTTGAATTTCACCGAAGGATACAGGTTTACTTAAGCGGGAAGGTTGTTGCGTTCAGCTGCATATCTGGTAGAGCCTGGGAGGCCAGTGCTAAGATTTGATGTAATGTCGTGTCGTGTAGATGATCCAAAACGTAAAAGGCATGAACTCATCGGACTTGGACTTCCCGAGGTGCCTCAAGAACATGACTCCCAAGCTGCAACGTATGAACATGTCAAACATTTGAATGAGAAGATGGAAGCCGAAGAGATGGAGCAAGATTACCCCACGGAATCTTCTGATGAGGAGATGCCAAAAATAAAAAAAAGGGAAGAGAAGAAGTACAATTGTCAAGAGTGTGATTATGCTGCTAGTAAACCTGCGCTGCTCATACAGCACCTACGATCTCACTCTGAACAGAAACCTTTTTCTTGCCCCGTGAGTGGTTGCCCTAGCACATACAAGCGTCAGGATCACCTCAATCGTCATATGAAGATACACGATGGAGCCCGGTTTAGCTGTACAATACCAGGTTGTGACCGGTCTTTCAGCATGATGACTAATCTAACGCGTCATTTAAAGTATCATGCTGAAAAGTCCATTTTTCCGAAGCCCAAGTCTTCCGGAGAGAAAAAGCACAAATGTCTAAACCCTGGTTGTGAGAAGATATTTCGATATCAATCAGAGCTGCGATCTCACGAGGACAACGTTCATAGCATCGTTTTTGCGGAGCATGTGTGCATATACCCCGGGTGTGGAGAGAAACTGACTAGCGAGGCAGCACTCTTGAAACATGCTGTAGAAGCACATCCATATCTTTTATGTGAGGTCTGCGGTGAAACTATTACAAGGCAAGCATACAGGCGGCACGTGCGCTCTCATGGAACGAAAAAGCCTGTAAAAGTTACATGTCCTTACGAGGGGTGCACACATCATTACACAAGGGAATCGAACCTAAGGTCGCATATCAGGTCTTTCCACCTTAAGCTGAAGCCATTTGTATGTTCTTTCGAGGGTTGTGACAAAAGCTTCGCCCACAAGGCTGCAAGAAAGAGGCATGAAATGTCAGTAGTACACTGTCATACTGGAACCGATTTTGAGGCGGCAGAGCTGGCGGAGTCATCGAAGTCAAAGGGTGGCAGGAAGAAAGTCTGTTTTGAAAAGGTGGAGGACCTGTATATCAGAAGAGCAAAGAAGGTATCATCGAGTCGTGCTAAGGGGCAGCATCATCACATCGATAGTCAAGGAGAAGAAGAAATGAAGATTGGTACTTTATGAGCCAATACGTAAATAACAATGCGCAATTAGAGATCTGGTGTGAGGGGCTTATGTTCCCACCCAGACGCGTATACGTCATTACCTCGGCCATTAGAGTAGTAAACTGAAGAGCAGATTTATGTAGTATCATAGTCGCAGTTGGTCAGTAAGTTTCATCTTACAAGACTCGGTCTTTGCCGTCAGGTGCATTTGAGGGGTTCTTTTCTTTTGATGGCTGGTTCGAACGTATAGTACGGCTTTCTTTCTCTTTTCGGCAAGAAAGAAGGATATAGAATATTTATGTTTACTTCACAACGGGACCAGTGATTGTATCCTGAGTGAAAGAAGGCATGGTTGGCAAAATTAGTGGTTTCATATTGGAGAAGTTGAAAATTTCGC

CDS

>Mapoly0061s0023.1
ATGTCGTGTCGTGTAGATGATCCAAAACGTAAAAGGCATGAACTCATCGGACTTGGACTTCCCGAGGTGCCTCAAGAACATGACTCCCAAGCTGCAACGTATGAACATGTCAAACATTTGAATGAGAAGATGGAAGCCGAAGAGATGGAGCAAGATTACCCCACGGAATCTTCTGATGAGGAGATGCCAAAAATAAAAAAAAGGGAAGAGAAGAAGTACAATTGTCAAGAGTGTGATTATGCTGCTAGTAAACCTGCGCTGCTCATACAGCACCTACGATCTCACTCTGAACAGAAACCTTTTTCTTGCCCCGTGAGTGGTTGCCCTAGCACATACAAGCGTCAGGATCACCTCAATCGTCATATGAAGATACACGATGGAGCCCGGTTTAGCTGTACAATACCAGGTTGTGACCGGTCTTTCAGCATGATGACTAATCTAACGCGTCATTTAAAGTATCATGCTGAAAAGTCCATTTTTCCGAAGCCCAAGTCTTCCGGAGAGAAAAAGCACAAATGTCTAAACCCTGGTTGTGAGAAGATATTTCGATATCAATCAGAGCTGCGATCTCACGAGGACAACGTTCATAGCATCGTTTTTGCGGAGCATGTGTGCATATACCCCGGGTGTGGAGAGAAACTGACTAGCGAGGCAGCACTCTTGAAACATGCTGTAGAAGCACATCCATATCTTTTATGTGAGGTCTGCGGTGAAACTATTACAAGGCAAGCATACAGGCGGCACGTGCGCTCTCATGGAACGAAAAAGCCTGTAAAAGTTACATGTCCTTACGAGGGGTGCACACATCATTACACAAGGGAATCGAACCTAAGGTCGCATATCAGGTCTTTCCACCTTAAGCTGAAGCCATTTGTATGTTCTTTCGAGGGTTGTGACAAAAGCTTCGCCCACAAGGCTGCAAGAAAGAGGCATGAAATGTCAGTAGTACACTGTCATACTGGAACCGATTTTGAGGCGGCAGAGCTGGCGGAGTCATCGAAGTCAAAGGGTGGCAGGAAGAAAGTCTGTTTTGAAAAGGTGGAGGACCTGTATATCAGAAGAGCAAAGAAGGTATCATCGAGTCGTGCTAAGGGGCAGCATCATCACATCGATAGTCAAGGAGAAGAAGAAATGAAGATTGGTACTTTATGA

Protein

>Mapoly0061s0023.1
MSCRVDDPKRKRHELIGLGLPEVPQEHDSQAATYEHVKHLNEKMEAEEMEQDYPTESSDEEMPKIKKREEKKYNCQECDYAASKPALLIQHLRSHSEQKPFSCPVSGCPSTYKRQDHLNRHMKIHDGARFSCTIPGCDRSFSMMTNLTRHLKYHAEKSIFPKPKSSGEKKHKCLNPGCEKIFRYQSELRSHEDNVHSIVFAEHVCIYPGCGEKLTSEAALLKHAVEAHPYLLCEVCGETITRQAYRRHVRSHGTKKPVKVTCPYEGCTHHYTRESNLRSHIRSFHLKLKPFVCSFEGCDKSFAHKAARKRHEMSVVHCHTGTDFEAAELAESSKSKGGRKKVCFEKVEDLYIRRAKKVSSSRAKGQHHHIDSQGEEEMKIGTL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>