Mapoly0061s0069



Description

MYB-LIKE DNA-BINDING PROTEIN MYB

Reference DB

Database ID Description
GO GO:0003682 Chromatin binding
KEGGORTH K09422 Myb proto-oncogene protein, plant
KOG KOG0048 Transcription factor, Myb superfamily
OrthoMCL OG5_131091
PFAM PF00249 Myb-like DNA-binding domain
PFAM PF13921 Myb-like DNA-binding domain
PANTHER PTHR10641 MYB-LIKE DNA-BINDING PROTEIN MYB
PANTHER PTHR10641:SF464

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp4R-MYB1 transcription factor, MYB Mapoly0061s0069.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0061s0069.1 scaffold_61:563470..571251  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0061s0069.1  

Gene structure:

mRNA scaffold_61:563470..571251  ( + strand )
five_prime_UTR scaffold_61:563470..563714  ( + strand )
five_prime_UTR scaffold_61:563888..564082  ( + strand )
CDS scaffold_61:564083..564503  ( + strand )
CDS scaffold_61:564780..565276  ( + strand )
CDS scaffold_61:565606..565790  ( + strand )
CDS scaffold_61:565987..566151  ( + strand )
CDS scaffold_61:566659..566973  ( + strand )
CDS scaffold_61:567142..567300  ( + strand )
CDS scaffold_61:567461..567613  ( + strand )
CDS scaffold_61:567941..568288  ( + strand )
CDS scaffold_61:568554..570092  ( + strand )
CDS scaffold_61:570225..570228  ( + strand )
three_prime_UTR scaffold_61:570229..570455  ( + strand )
three_prime_UTR scaffold_61:570631..570696  ( + strand )
three_prime_UTR scaffold_61:570906..571251  ( + strand )

Sequences:

Gene

>Mapoly0061s0069.1
GGAACTAGCGATGCTACGGAGGACGGCGAGCGAAGGTTGGCGAAGTTACGAACCCTGCAGCGTTCTCGAAGGCGCAGCTGGAGGCCAGGTCAGTCTTGCGGCTGCCTCTAAACCCTTGGGGTTGTACTGAGCTCCTGCGAAGTAGTAGTAGTAGTACAGGATGCGGCAAGGAACTTTTCGCTGAAGGAGTTGCGCTGCGCTGCTCTTCCTGTGCGCTCGATCGCTCGTGGAAGCCTTGAAATGAGGTAGTTTTTGTCGTCGTGCAGCGCTCGCTTCTCTTGCTACATGGACGAGAATTTGAATTTTTCTGCTGCCCTGCGCATCTCTCTGCGAACGAGTTTAAATCGAGGGCTTTGGATTTCGCGTCAGTCTTGGTTTGATTTCGATGTCTGACGGAAGCGATGTCGGTTTTTTCCAGAGAACGACTCGCGTCAGGTTCCGGACGCGTGAGTGTGTGTGTCGTAGAGTTGTTTGGTTCCGTGGTTGCGTTCAAGCTGCGGTCGCTGTATGGCGAAGGTCCGATTCTGCACGGCGAATTGCGTGGAGATGGTCGATGGAGTGATTTGATGCTAGTTTAGCCCCTGGCTCCTGAGTCGGTCGAGGGCTGCCGAAGATGGTAATTCACGCAGGAGATGATTCGGAGGAGGAGGAGGATGATGAAGATATCGCAATGGAAGAGGGATTCCAGGGTCATCTCGATGCTTTGAAGCGAGCATGCCTGCTAAACATTGGGCAGGATAGTTTTCTGACCACCGGAGCTGGGTCTCTTCCTGATACCGCTTCTACTCTAGAAGAAGATGATGAGGAGCTGTTCGAATCCATCCAGAAGAAATATTTTTTGGGCTCCCTGGACAAGGTTTCGATTCCGCAAGGGAGACCCTCAAGCAACAGTGATGACGAGGACGAGGAGCAGGACGATGAAGAAATCTTGCGGTCTGTGGAAAAGCTTTACAGTGTAACTGAACTTTCGAGACAAATAAGTAATGAAGTTGATGAGAATGCAGTTTTTTTGGAGGTTCGAATTGATTCTCCAGGTACAAATTCTCGCTAGTTCTAAAAAGCAAGCTCTTTGCGTCTCTCTTTTCTCTTTGAATTTCCAAATTTCAGTTGACTTCATGAGAAAGGAGAAATAGAAGCACAGTGTGTCTTGAGTCAATTTTGGGTTCAGAGCCTAGTTTCGGAGTCTGAATTCCGAGAACCGTCACGATGAGTCAAAGTCTCAACGTCCATACCAAATTGTCAGTCAATCTGTAACTTGATAATTTTCGAGATGAAAGAGATTCAAATCCGTAAGAAAGTCGTTTCTACAGTCCATGCAGGGAGTGAAGCACCAGATGAGAGCAGCAGCCGACCCGAAGACTCTGATAAGGATGTCACTCATCCCGTCAAGGATTTGGGGAGAGCAGTTTCGACGTTGCTGCCGTCGAACTGGAACGAGGAAGAAGATCCGGAGTTCAATCCCCCCAGTCCCAACTCGGCTGTTGTTGCCTATGATCCATACAAACACCATACAGATGAGCTTCTATGTGAAGATTATGGGAATTATGGCTCTGAAGATAAAGAGAAAATGATCGGGGAGGCATTGCAAAAAAATCTATCTTATCAGCAAAACTTGAGAAACATTCTAAATCGAATAGAGTCGAAACAGAAGCACAATGCCGAAATGCAGAGACGTGTGAGGACCCTGCTCGATTTCGAGAAGTACTGTAAGCGTAAATATGCGGTTTTCTTCACCGATCAGGCTAATCCTTCCCTGAAGCTATTTTCTGTCGGTAGAGGCGGATACCAAAGCAGGAATGATGACAAGGTTTTTTTCTTCGGCACCCAAGACCTTCAAGTGTGACAAGCACTATCTCAAGTTAGCTGAAGCCTGAACTAGGTTGTCGGTCTGATGTTTGGTTACAACCAGATCATTCATATCTTGTTTCCATAAAAGTTTCCCTCTCATCGTCAGGGCCGTGCTATTCAAGATGTTTTTCAGTCTTTCTCTGCATCTTCTGCCGGAACCGAAATTGCCTGTTGTGGCTACCAAAAGTTAATGTGCACCTCTAACCTATTCTGCACAGTATGTCTTTATTATGTTTGATTGCTGTTACACTCAGTGTCTTCTGCTCGGTTTTGAATCTGCTTTGGCAGAGTGATTACCACCCTGGCGGACCTCCAGATAATGCAGACGTCGAAGTTTACAAAATGTTAAAGCAGAAAGCAACATTTGCCTCGATGAGCAGAAGATGGCGAGCAGAAGAGCTGAGAGAGTTAGCCAAGGGCGTAAAACAACAAATCTATGAAGTCTTGGTTTGTGAAGCCATGGACGCAATAAGGTAACTTCAGCATGAATAAGTTCAGCTTTGATTGAGTTGGTAACCTATCCGAATATTTTTGGGGTTTACACTCAAGCGATGTTCTTACACTCACTTGCTTTTAAAGACTTGTTATCGTGCAGATGACTTATATCATTTACGGAGTTTGATGTAATCCTGGGGCCTGTTTCTGACATGGTTGTTTCTACATCCGCAGCAATGGAGATATAATAGGAGACAATGCACTAGAGAACTCTCTGAGTGCAATAAGGAATAAGGAACTGACTCCTGAAGAGATGAGAAACGCCATTGCGGATGTCAACTGGAATGAGGTAGCAAGGGTGTATGTAGTAAATCGCACCCCAGAGGAATGTCGCACACGGTACAGTCCGATGCCTTTAATTAGCTCTTCCCCTGCTTCCAACCGAATGGGATTACGTTGTGATATTATTGTCTGATAGGAGATACGGAAGTGAAAAGTCAATCTCTTTGTCATAACTGGCGTCTCTGACGCCCGGTTAGATTCTAGCCCTCGTAAGTGTCCACATTCCTCACGATCTTGATTAATAAACTTACAAGTTAATTTAAGTTCACTCATGCAGTCAAGATTTGCAGCTGAAATGAGACGTGAATATGAAGACAGAAAGTAGAAAGTGAATGGAGGTTTACAAAACTAGTTCCGGTTCTCCTACCAACTTTATCTCTGGTTCTGTCAGTTTGTTATTGTGCTTTCAAGGATCCCTAATCATCTGCTAAGCAGAACTGATTTGTTATTTTAAAAGGTGGTAACTGTTCAAAGACCTTCGTGGGTTCTGTTGCTGTTTCTGCTAACATACAAGTGATTTATTTGCTGGTAAGTTCATCACCGTTCTGATTTGTTTCCTGGCAGATGGCTGAATCATGAAGATCCTCTTATAAATAAGTCTTCTTGGACCAAGACAGAAGACAAGAAGCTTCTCAGTATCGCGCAACGAAATAAGACCACCAATTGGGAGAAAATTGCTCAAGAACTGGGGACAAATAGAACTCCAGCAGAATGTCTAACACGGTATCAGAGGAGTCTAAATGCCAGCATCATGCGTAGTGTTTGGACTCCTGAAGAGGACGCCAAGTTACGTGCGGCAGTGGAGGAACTAGGTGAATCAGACTGGAGTCTTGTGGCTGCTTGCCTGGAGGGTCGAAATAACAGTCAGTGCCTGATGAGGTGATTGATCATACAAATCTATGCAGGTTCCACACTATGAATTCTTCTTGTGGACTCTTTTGGAGGGTATCTAGAGGTGTCTACAGTTGGTGACCTAACACTCAAAGTAGTTTGGTTACCGTAAGTAAACTCCAATTGTGTTTGCTTTTTGTCATACCGGTGGTCCAGGTGGTACAAAGTTCTGCACCCGAGAAAACAGAAGAAAGGAAGGTGGTCAGTCGAAGAGGATAAGCGGCTCAACTGGGCTGTGTCCTTACACGGAGCTAGAAAATGGAAGCAAATTGCAAATCATGTCCCCGGGCGCACTGATATCCAGTGTCGGGAGAGGTAAGTCAGGCCAGGGCGTAATCATCTATAAAATTGAAGTTGCAGATATGTCGAGTCAAAACTGGCTGATCGCGGTATATCACAAGCTGGCTGGTTTTGGACTGCAAAATACAGTGATTGTACTTTCAGTAATTCGACTCGCTTCACATGTCTTTTACAGGTGGTGTAACGTTTTGAACCCGGATATCAAACTTGATACTTGGACTGAAGAAGAGGACCAGACTTTGCGGGAGTCAGTTGCTCTTCACGGGCCTCATCGTTGGTCTGCGATTGCTACTGATCTGAAAGTCAGAACGGATAAACAATGTTGGCGGTGAGTATTCTCCGTCAGCTCTTACAGAGATTCATCTGGGATAAACTTGTCGTAGATAAACTGTATCAATTGGACATCTTTCCTGGCTAGTAATAACAAACTGAGAAGAACGAGTAGAGTGGTATGAATCGGGATGAAGAGTGAAAAGAGTCTTGTATGTAATAAAAGTCTCCTTGATTGATTTTGGTTTGACTCTTCTGATTGTAATCAAGAAACTCTTTACCACCTAAGGACTGTAATATATAAACAATATAATCGGTCGTGCTAATAGTCTTGACTAGTTAGCTAGAAATCTTCTCCTGAAATGTGTACCATTATATGATACAGGAGGTGGAAGATTCTTTTCCCAGAGGAACAACCTGACTATAAGAGAACTGTCTTCATTCAACGCAATGCTTTGATAGGAAACTTTCAAGGCAGAAAGAAGGAGCGTCCTAAACTGGGTCCTCAAGATTTTGTATCGAAAGCCGATACTTTTGGAGTACCCAGTAACATCGTCCGCGAGACTAAATCTAAAAGGAGAACCAGTTCGCGATCAGCTGAAGAGAGAACGACTTCGCGTTCAGCAAAGAAGAGAACCAATTCGCGGTCAGCTAAAAAGAGCTCGGTGTCAGTCCCAGCCGATGAGTGCGGACGCAACAGTTCTACTCCGACCACAGCTGCCTCCATCCAAAGGTTTTACACTATCCACTTTCTGTGATGCATTCCTTTGACTCCTTGAATGGGTTTGCAATATCGGTCACATTTTTCTTGTCAGTGATCCTCTCACGTGGGAAAATGTCTTATCTCTCAGAGGACTCTCTTTTTGCTTCATATCACCTGCTTTCAATTTTCTCCCTCATCTACCTCAGTCAGCAGAACCGTCTACAAGAATTCACGTGCTTCTTGTTTGAAAGTACAATCTATCCTACTTATATTCACTTCTGTCTTATTTATGCAGAGATTCTGCCCATAGCAGTCAAGATCAACAAGACTCGACAAACCATGAAGGACAAGACTTGACAATTTATGGGGAACGAGGCACGATAACCTCTGAGAGTACAGTAATAGGAGCTCTGGAAGAAGTTTCTGTAAATGGAAATGATACACTTGCCGATTCCAAACTACGCCGTCTGGCCCGTATTCACAAACTGAAACTTTCCAGAGCAAATAAACTTGCCAATTCTGCCAATTTAGTACTCCCTAGAAGTGCCCAGTCCACGAGATCGACTCCTGATAATCAAAGTGAATATGGGCAGAATGAAGTTACAGATCCCTCGTCGAGTGCCCAAGTTCAGATTGAAAAGAAGAAGGGCAGGAAGCGTTCAAGGACGGAAGGATCTGATGGTCTAGGTAACCCTTCGAAGCGACCAAGGAAAATATCAAGCAAGAGGACAAGTGACGTCCTCGAGTGTGACATTCAGTCCTCTTCACAGCTTAGTGAAGTTTCGCCCCATCTTTCGTCTGAGGAAACTGAACCATCATCTTCTGGAGGCCTTTTAGCTGTGACCGACGGGGCTGAGCAGGGAGTGACAAATGGAGGAACAGCAGAGGTCATATGCAAGAGCAAGAAACGTTCAAGAGTATCAGCATGTCCGCAACCACGCCGGGTTTCGAAACGAAGAAGACCTGACAACATGTGCTTACCTTCTAGAGATAGTGACATCCAAACTGCGGCCGAAGAACCACCGGTGGTCAGACCCGAACCCGGACCTGCTATTCTTTCTTTGGTGGACCTTGTCCATTCAATAAATGAATTTTGTAAGTACACTTTTCTTCTCAACGAGGAGCAGCACGTTCAAGCTCTTCCGGACCCTGACGTAAGTGATACTGCGGTGAGAGTAGGTGTTGAAGATATAACATCTGGATCGAGTGCCCTTGGCCCACAACTCTGCCCTGACCCCGTACAGGAGAGGTATCTTAGATTAGTACACGATCATGATACACCTTTTGTGGATACAGAATCCATTCCAGCCAACGGGCATGGTTGTAGGACAGAGAGAAGGATGGTAGCGAGTAAGCCAACCGCAGGGGGTGCATGTGATGCTCTCTGGTGCCCGAACTCTGGTGTTAACCGAATAGCTGTGCGGTCGGACGGAGAGGGCGAAACCAGGCTGATAACTCACGCGAACACCGAATCTAATATGGGAGGAGTTCAAGATGGTCCGAGCCGGTTGTCCCCTGAGGATGAAGAAGTTGCTGCCGCCACGAAGGCTATCCTGTCTTGGCCATTTTTCTATGGAGTACAGCAGCTCACACTTCGGGCTGATGAGTATCTGAATTCAAAGGCTCCTCGGAAATCCTCAACTGCCAGACCCCCAAAATCCACGAAGAAAGGAAAGTCTCTGGGCACGTCGGAGACAATCGTTGAGACTCAGCCGGTGGCAGTTCCAACCCCGGTGACGGCAGTCGATAACCCTGTCTCCAAAAGACCGAGGAGTGCACGATGTGCAGCTAGAATGAGAGGAACTTCACGTGAGAGAACTTCTGAGCAGGACAGGTTTGTATAGCACCATTTGAAAGTTTTGGAGTCAGAGAAAAGTGTGGGTTGCAGATTATGTCTTGATTCCGTGGCCCTTTTTGTTACTCGTCCAATCGTTCACTCACAGCTCTTCACCTGTTGGTTCACCAGTTAACTGGAATGCTCAGAGTCGGTGCGCTCCTCCGCTGCTGATACATAAGCTGATAAGTAGTGTCATTATAATGTCGAGGACCTTCCAAGCGTGCCTATCGTCTAGGTGAAAGACTGCTCGCAGAAGAAATTTACTTTTTTTTCAGCGTGAAGACAGTCGGGGGCAGTTTTGGCGGATAGCCTGTAATGGAACGGCATTATTGAACTTCTATTACATGAGAGAAATTTTGGGTGAGTATTGTTGTTTAGAAGTGACGATAGTTATTGTTGTTGCCGCTGGACTAAGTTCTCATTTATCTTTCAGCTTTTTCAGATGGGCCACGCTGATGCCGTGTCTAAAGGTGTGATCATTTTGATTCGATCTATGTAGCCAAGATCTTGAATGTTCTTTGGTTGTTGTCATCAGAAGAAGCGGATCTTATATGAAATTACCAGGGACGGTCACCTCTGAGATGGGTCATCTCTGAGTCTGGTATATGCCCCTTCTATCCTGATCTTACTGCAGTCAGCTTCGATGTACTTCAATTATTGTTTTGCATTCCATCTATAACAAGTACCTTGATACTAAGACTTTGTTGTGACCGCAAGATTGAATTTCCTGCGGTTGTGATGAAATTTTTCGATGATTTCTAACAACTTCAAGCTAAAAGGATGTCTCGCTGTTCTTGGCAATTGCTCCAGATGGCCGTTACTTGCCACACCGATGCAAAGCACCTCAACGTCGGCGATGGAGTTATGATGCGACAAGGCCGTGTTGAAAACGTAACGACATGGACATCATCTTTCGTCGGAGTTTTTTTGAGCCCAGAATGTAGCAAAAGGAACCAGGTTGACTAGTTGGTACTTTAAAGAGACAAAGTCAGCGTAAGGTCCAGAGGCCCTAGTATTTTTGTGACTCTCCTACTTCCTGATTGTTGATCAATCGACCATCGGGTCTAGTCGGCGACGGTTGCTTCTTCACAAGCAAAGCAAAGATGTGTTTCAGTTGTCAATATCCTGAGTTCCTCCTGATGAATGTCGTTTAGAG

mRNA

>Mapoly0061s0069.1
GGAACTAGCGATGCTACGGAGGACGGCGAGCGAAGGTTGGCGAAGTTACGAACCCTGCAGCGTTCTCGAAGGCGCAGCTGGAGGCCAGGTCAGTCTTGCGGCTGCCTCTAAACCCTTGGGGTTGTACTGAGCTCCTGCGAAGTAGTAGTAGTAGTACAGGATGCGGCAAGGAACTTTTCGCTGAAGGAGTTGCGCTGCGCTGCTCTTCCTGTGCGCTCGATCGCTCGTGGAAGCCTTGAAATGAGAGAACGACTCGCGTCAGGTTCCGGACGCGTGAGTGTGTGTGTCGTAGAGTTGTTTGGTTCCGTGGTTGCGTTCAAGCTGCGGTCGCTGTATGGCGAAGGTCCGATTCTGCACGGCGAATTGCGTGGAGATGGTCGATGGAGTGATTTGATGCTAGTTTAGCCCCTGGCTCCTGAGTCGGTCGAGGGCTGCCGAAGATGGTAATTCACGCAGGAGATGATTCGGAGGAGGAGGAGGATGATGAAGATATCGCAATGGAAGAGGGATTCCAGGGTCATCTCGATGCTTTGAAGCGAGCATGCCTGCTAAACATTGGGCAGGATAGTTTTCTGACCACCGGAGCTGGGTCTCTTCCTGATACCGCTTCTACTCTAGAAGAAGATGATGAGGAGCTGTTCGAATCCATCCAGAAGAAATATTTTTTGGGCTCCCTGGACAAGGTTTCGATTCCGCAAGGGAGACCCTCAAGCAACAGTGATGACGAGGACGAGGAGCAGGACGATGAAGAAATCTTGCGGTCTGTGGAAAAGCTTTACAGTGTAACTGAACTTTCGAGACAAATAAGTAATGAAGTTGATGAGAATGCAGTTTTTTTGGAGGTTCGAATTGATTCTCCAGTCCATGCAGGGAGTGAAGCACCAGATGAGAGCAGCAGCCGACCCGAAGACTCTGATAAGGATGTCACTCATCCCGTCAAGGATTTGGGGAGAGCAGTTTCGACGTTGCTGCCGTCGAACTGGAACGAGGAAGAAGATCCGGAGTTCAATCCCCCCAGTCCCAACTCGGCTGTTGTTGCCTATGATCCATACAAACACCATACAGATGAGCTTCTATGTGAAGATTATGGGAATTATGGCTCTGAAGATAAAGAGAAAATGATCGGGGAGGCATTGCAAAAAAATCTATCTTATCAGCAAAACTTGAGAAACATTCTAAATCGAATAGAGTCGAAACAGAAGCACAATGCCGAAATGCAGAGACGTGTGAGGACCCTGCTCGATTTCGAGAAGTACTGTAAGCGTAAATATGCGGTTTTCTTCACCGATCAGGCTAATCCTTCCCTGAAGCTATTTTCTGTCGGTAGAGGCGGATACCAAAGCAGGAATGATGACAAGAGTGATTACCACCCTGGCGGACCTCCAGATAATGCAGACGTCGAAGTTTACAAAATGTTAAAGCAGAAAGCAACATTTGCCTCGATGAGCAGAAGATGGCGAGCAGAAGAGCTGAGAGAGTTAGCCAAGGGCGTAAAACAACAAATCTATGAAGTCTTGGTTTGTGAAGCCATGGACGCAATAAGCAATGGAGATATAATAGGAGACAATGCACTAGAGAACTCTCTGAGTGCAATAAGGAATAAGGAACTGACTCCTGAAGAGATGAGAAACGCCATTGCGGATGTCAACTGGAATGAGGTAGCAAGGGTGTATGTAGTAAATCGCACCCCAGAGGAATGTCGCACACGATGGCTGAATCATGAAGATCCTCTTATAAATAAGTCTTCTTGGACCAAGACAGAAGACAAGAAGCTTCTCAGTATCGCGCAACGAAATAAGACCACCAATTGGGAGAAAATTGCTCAAGAACTGGGGACAAATAGAACTCCAGCAGAATGTCTAACACGGTATCAGAGGAGTCTAAATGCCAGCATCATGCGTAGTGTTTGGACTCCTGAAGAGGACGCCAAGTTACGTGCGGCAGTGGAGGAACTAGGTGAATCAGACTGGAGTCTTGTGGCTGCTTGCCTGGAGGGTCGAAATAACAGTCAGTGCCTGATGAGGTGGTACAAAGTTCTGCACCCGAGAAAACAGAAGAAAGGAAGGTGGTCAGTCGAAGAGGATAAGCGGCTCAACTGGGCTGTGTCCTTACACGGAGCTAGAAAATGGAAGCAAATTGCAAATCATGTCCCCGGGCGCACTGATATCCAGTGTCGGGAGAGGTGGTGTAACGTTTTGAACCCGGATATCAAACTTGATACTTGGACTGAAGAAGAGGACCAGACTTTGCGGGAGTCAGTTGCTCTTCACGGGCCTCATCGTTGGTCTGCGATTGCTACTGATCTGAAAGTCAGAACGGATAAACAATGTTGGCGGAGGTGGAAGATTCTTTTCCCAGAGGAACAACCTGACTATAAGAGAACTGTCTTCATTCAACGCAATGCTTTGATAGGAAACTTTCAAGGCAGAAAGAAGGAGCGTCCTAAACTGGGTCCTCAAGATTTTGTATCGAAAGCCGATACTTTTGGAGTACCCAGTAACATCGTCCGCGAGACTAAATCTAAAAGGAGAACCAGTTCGCGATCAGCTGAAGAGAGAACGACTTCGCGTTCAGCAAAGAAGAGAACCAATTCGCGGTCAGCTAAAAAGAGCTCGGTGTCAGTCCCAGCCGATGAGTGCGGACGCAACAGTTCTACTCCGACCACAGCTGCCTCCATCCAAAGAGATTCTGCCCATAGCAGTCAAGATCAACAAGACTCGACAAACCATGAAGGACAAGACTTGACAATTTATGGGGAACGAGGCACGATAACCTCTGAGAGTACAGTAATAGGAGCTCTGGAAGAAGTTTCTGTAAATGGAAATGATACACTTGCCGATTCCAAACTACGCCGTCTGGCCCGTATTCACAAACTGAAACTTTCCAGAGCAAATAAACTTGCCAATTCTGCCAATTTAGTACTCCCTAGAAGTGCCCAGTCCACGAGATCGACTCCTGATAATCAAAGTGAATATGGGCAGAATGAAGTTACAGATCCCTCGTCGAGTGCCCAAGTTCAGATTGAAAAGAAGAAGGGCAGGAAGCGTTCAAGGACGGAAGGATCTGATGGTCTAGGTAACCCTTCGAAGCGACCAAGGAAAATATCAAGCAAGAGGACAAGTGACGTCCTCGAGTGTGACATTCAGTCCTCTTCACAGCTTAGTGAAGTTTCGCCCCATCTTTCGTCTGAGGAAACTGAACCATCATCTTCTGGAGGCCTTTTAGCTGTGACCGACGGGGCTGAGCAGGGAGTGACAAATGGAGGAACAGCAGAGGTCATATGCAAGAGCAAGAAACGTTCAAGAGTATCAGCATGTCCGCAACCACGCCGGGTTTCGAAACGAAGAAGACCTGACAACATGTGCTTACCTTCTAGAGATAGTGACATCCAAACTGCGGCCGAAGAACCACCGGTGGTCAGACCCGAACCCGGACCTGCTATTCTTTCTTTGGTGGACCTTGTCCATTCAATAAATGAATTTTGTAAGTACACTTTTCTTCTCAACGAGGAGCAGCACGTTCAAGCTCTTCCGGACCCTGACGTAAGTGATACTGCGGTGAGAGTAGGTGTTGAAGATATAACATCTGGATCGAGTGCCCTTGGCCCACAACTCTGCCCTGACCCCGTACAGGAGAGGTATCTTAGATTAGTACACGATCATGATACACCTTTTGTGGATACAGAATCCATTCCAGCCAACGGGCATGGTTGTAGGACAGAGAGAAGGATGGTAGCGAGTAAGCCAACCGCAGGGGGTGCATGTGATGCTCTCTGGTGCCCGAACTCTGGTGTTAACCGAATAGCTGTGCGGTCGGACGGAGAGGGCGAAACCAGGCTGATAACTCACGCGAACACCGAATCTAATATGGGAGGAGTTCAAGATGGTCCGAGCCGGTTGTCCCCTGAGGATGAAGAAGTTGCTGCCGCCACGAAGGCTATCCTGTCTTGGCCATTTTTCTATGGAGTACAGCAGCTCACACTTCGGGCTGATGAGTATCTGAATTCAAAGGCTCCTCGGAAATCCTCAACTGCCAGACCCCCAAAATCCACGAAGAAAGGAAAGTCTCTGGGCACGTCGGAGACAATCGTTGAGACTCAGCCGGTGGCAGTTCCAACCCCGGTGACGGCAGTCGATAACCCTGTCTCCAAAAGACCGAGGAGTGCACGATGTGCAGCTAGAATGAGAGGAACTTCACGTGAGAGAACTTCTGAGCAGGACAGTTAACTGGAATGCTCAGAGTCGGTGCGCTCCTCCGCTGCTGATACATAAGCTGATAAGTAGTGTCATTATAATGTCGAGGACCTTCCAAGCGTGCCTATCGTCTAGGTGAAAGACTGCTCGCAGAAGAAATTTACTTTTTTTTCAGCGTGAAGACAGTCGGGGGCAGTTTTGGCGGATAGCCTGTAATGGAACGGCATTATTGAACTTCTATTACATGAGAGAAATTTTGGAAGAAGCGGATCTTATATGAAATTACCAGGGACGGTCACCTCTGAGATGGGTCATCTCTGAGTCTGATGGCCGTTACTTGCCACACCGATGCAAAGCACCTCAACGTCGGCGATGGAGTTATGATGCGACAAGGCCGTGTTGAAAACGTAACGACATGGACATCATCTTTCGTCGGAGTTTTTTTGAGCCCAGAATGTAGCAAAAGGAACCAGGTTGACTAGTTGGTACTTTAAAGAGACAAAGTCAGCGTAAGGTCCAGAGGCCCTAGTATTTTTGTGACTCTCCTACTTCCTGATTGTTGATCAATCGACCATCGGGTCTAGTCGGCGACGGTTGCTTCTTCACAAGCAAAGCAAAGATGTGTTTCAGTTGTCAATATCCTGAGTTCCTCCTGATGAATGTCGTTTAGAG

CDS

>Mapoly0061s0069.1
ATGGTAATTCACGCAGGAGATGATTCGGAGGAGGAGGAGGATGATGAAGATATCGCAATGGAAGAGGGATTCCAGGGTCATCTCGATGCTTTGAAGCGAGCATGCCTGCTAAACATTGGGCAGGATAGTTTTCTGACCACCGGAGCTGGGTCTCTTCCTGATACCGCTTCTACTCTAGAAGAAGATGATGAGGAGCTGTTCGAATCCATCCAGAAGAAATATTTTTTGGGCTCCCTGGACAAGGTTTCGATTCCGCAAGGGAGACCCTCAAGCAACAGTGATGACGAGGACGAGGAGCAGGACGATGAAGAAATCTTGCGGTCTGTGGAAAAGCTTTACAGTGTAACTGAACTTTCGAGACAAATAAGTAATGAAGTTGATGAGAATGCAGTTTTTTTGGAGGTTCGAATTGATTCTCCAGTCCATGCAGGGAGTGAAGCACCAGATGAGAGCAGCAGCCGACCCGAAGACTCTGATAAGGATGTCACTCATCCCGTCAAGGATTTGGGGAGAGCAGTTTCGACGTTGCTGCCGTCGAACTGGAACGAGGAAGAAGATCCGGAGTTCAATCCCCCCAGTCCCAACTCGGCTGTTGTTGCCTATGATCCATACAAACACCATACAGATGAGCTTCTATGTGAAGATTATGGGAATTATGGCTCTGAAGATAAAGAGAAAATGATCGGGGAGGCATTGCAAAAAAATCTATCTTATCAGCAAAACTTGAGAAACATTCTAAATCGAATAGAGTCGAAACAGAAGCACAATGCCGAAATGCAGAGACGTGTGAGGACCCTGCTCGATTTCGAGAAGTACTGTAAGCGTAAATATGCGGTTTTCTTCACCGATCAGGCTAATCCTTCCCTGAAGCTATTTTCTGTCGGTAGAGGCGGATACCAAAGCAGGAATGATGACAAGAGTGATTACCACCCTGGCGGACCTCCAGATAATGCAGACGTCGAAGTTTACAAAATGTTAAAGCAGAAAGCAACATTTGCCTCGATGAGCAGAAGATGGCGAGCAGAAGAGCTGAGAGAGTTAGCCAAGGGCGTAAAACAACAAATCTATGAAGTCTTGGTTTGTGAAGCCATGGACGCAATAAGCAATGGAGATATAATAGGAGACAATGCACTAGAGAACTCTCTGAGTGCAATAAGGAATAAGGAACTGACTCCTGAAGAGATGAGAAACGCCATTGCGGATGTCAACTGGAATGAGGTAGCAAGGGTGTATGTAGTAAATCGCACCCCAGAGGAATGTCGCACACGATGGCTGAATCATGAAGATCCTCTTATAAATAAGTCTTCTTGGACCAAGACAGAAGACAAGAAGCTTCTCAGTATCGCGCAACGAAATAAGACCACCAATTGGGAGAAAATTGCTCAAGAACTGGGGACAAATAGAACTCCAGCAGAATGTCTAACACGGTATCAGAGGAGTCTAAATGCCAGCATCATGCGTAGTGTTTGGACTCCTGAAGAGGACGCCAAGTTACGTGCGGCAGTGGAGGAACTAGGTGAATCAGACTGGAGTCTTGTGGCTGCTTGCCTGGAGGGTCGAAATAACAGTCAGTGCCTGATGAGGTGGTACAAAGTTCTGCACCCGAGAAAACAGAAGAAAGGAAGGTGGTCAGTCGAAGAGGATAAGCGGCTCAACTGGGCTGTGTCCTTACACGGAGCTAGAAAATGGAAGCAAATTGCAAATCATGTCCCCGGGCGCACTGATATCCAGTGTCGGGAGAGGTGGTGTAACGTTTTGAACCCGGATATCAAACTTGATACTTGGACTGAAGAAGAGGACCAGACTTTGCGGGAGTCAGTTGCTCTTCACGGGCCTCATCGTTGGTCTGCGATTGCTACTGATCTGAAAGTCAGAACGGATAAACAATGTTGGCGGAGGTGGAAGATTCTTTTCCCAGAGGAACAACCTGACTATAAGAGAACTGTCTTCATTCAACGCAATGCTTTGATAGGAAACTTTCAAGGCAGAAAGAAGGAGCGTCCTAAACTGGGTCCTCAAGATTTTGTATCGAAAGCCGATACTTTTGGAGTACCCAGTAACATCGTCCGCGAGACTAAATCTAAAAGGAGAACCAGTTCGCGATCAGCTGAAGAGAGAACGACTTCGCGTTCAGCAAAGAAGAGAACCAATTCGCGGTCAGCTAAAAAGAGCTCGGTGTCAGTCCCAGCCGATGAGTGCGGACGCAACAGTTCTACTCCGACCACAGCTGCCTCCATCCAAAGAGATTCTGCCCATAGCAGTCAAGATCAACAAGACTCGACAAACCATGAAGGACAAGACTTGACAATTTATGGGGAACGAGGCACGATAACCTCTGAGAGTACAGTAATAGGAGCTCTGGAAGAAGTTTCTGTAAATGGAAATGATACACTTGCCGATTCCAAACTACGCCGTCTGGCCCGTATTCACAAACTGAAACTTTCCAGAGCAAATAAACTTGCCAATTCTGCCAATTTAGTACTCCCTAGAAGTGCCCAGTCCACGAGATCGACTCCTGATAATCAAAGTGAATATGGGCAGAATGAAGTTACAGATCCCTCGTCGAGTGCCCAAGTTCAGATTGAAAAGAAGAAGGGCAGGAAGCGTTCAAGGACGGAAGGATCTGATGGTCTAGGTAACCCTTCGAAGCGACCAAGGAAAATATCAAGCAAGAGGACAAGTGACGTCCTCGAGTGTGACATTCAGTCCTCTTCACAGCTTAGTGAAGTTTCGCCCCATCTTTCGTCTGAGGAAACTGAACCATCATCTTCTGGAGGCCTTTTAGCTGTGACCGACGGGGCTGAGCAGGGAGTGACAAATGGAGGAACAGCAGAGGTCATATGCAAGAGCAAGAAACGTTCAAGAGTATCAGCATGTCCGCAACCACGCCGGGTTTCGAAACGAAGAAGACCTGACAACATGTGCTTACCTTCTAGAGATAGTGACATCCAAACTGCGGCCGAAGAACCACCGGTGGTCAGACCCGAACCCGGACCTGCTATTCTTTCTTTGGTGGACCTTGTCCATTCAATAAATGAATTTTGTAAGTACACTTTTCTTCTCAACGAGGAGCAGCACGTTCAAGCTCTTCCGGACCCTGACGTAAGTGATACTGCGGTGAGAGTAGGTGTTGAAGATATAACATCTGGATCGAGTGCCCTTGGCCCACAACTCTGCCCTGACCCCGTACAGGAGAGGTATCTTAGATTAGTACACGATCATGATACACCTTTTGTGGATACAGAATCCATTCCAGCCAACGGGCATGGTTGTAGGACAGAGAGAAGGATGGTAGCGAGTAAGCCAACCGCAGGGGGTGCATGTGATGCTCTCTGGTGCCCGAACTCTGGTGTTAACCGAATAGCTGTGCGGTCGGACGGAGAGGGCGAAACCAGGCTGATAACTCACGCGAACACCGAATCTAATATGGGAGGAGTTCAAGATGGTCCGAGCCGGTTGTCCCCTGAGGATGAAGAAGTTGCTGCCGCCACGAAGGCTATCCTGTCTTGGCCATTTTTCTATGGAGTACAGCAGCTCACACTTCGGGCTGATGAGTATCTGAATTCAAAGGCTCCTCGGAAATCCTCAACTGCCAGACCCCCAAAATCCACGAAGAAAGGAAAGTCTCTGGGCACGTCGGAGACAATCGTTGAGACTCAGCCGGTGGCAGTTCCAACCCCGGTGACGGCAGTCGATAACCCTGTCTCCAAAAGACCGAGGAGTGCACGATGTGCAGCTAGAATGAGAGGAACTTCACGTGAGAGAACTTCTGAGCAGGACAGTTAA

Protein

>Mapoly0061s0069.1
MVIHAGDDSEEEEDDEDIAMEEGFQGHLDALKRACLLNIGQDSFLTTGAGSLPDTASTLEEDDEELFESIQKKYFLGSLDKVSIPQGRPSSNSDDEDEEQDDEEILRSVEKLYSVTELSRQISNEVDENAVFLEVRIDSPVHAGSEAPDESSSRPEDSDKDVTHPVKDLGRAVSTLLPSNWNEEEDPEFNPPSPNSAVVAYDPYKHHTDELLCEDYGNYGSEDKEKMIGEALQKNLSYQQNLRNILNRIESKQKHNAEMQRRVRTLLDFEKYCKRKYAVFFTDQANPSLKLFSVGRGGYQSRNDDKSDYHPGGPPDNADVEVYKMLKQKATFASMSRRWRAEELRELAKGVKQQIYEVLVCEAMDAISNGDIIGDNALENSLSAIRNKELTPEEMRNAIADVNWNEVARVYVVNRTPEECRTRWLNHEDPLINKSSWTKTEDKKLLSIAQRNKTTNWEKIAQELGTNRTPAECLTRYQRSLNASIMRSVWTPEEDAKLRAAVEELGESDWSLVAACLEGRNNSQCLMRWYKVLHPRKQKKGRWSVEEDKRLNWAVSLHGARKWKQIANHVPGRTDIQCRERWCNVLNPDIKLDTWTEEEDQTLRESVALHGPHRWSAIATDLKVRTDKQCWRRWKILFPEEQPDYKRTVFIQRNALIGNFQGRKKERPKLGPQDFVSKADTFGVPSNIVRETKSKRRTSSRSAEERTTSRSAKKRTNSRSAKKSSVSVPADECGRNSSTPTTAASIQRDSAHSSQDQQDSTNHEGQDLTIYGERGTITSESTVIGALEEVSVNGNDTLADSKLRRLARIHKLKLSRANKLANSANLVLPRSAQSTRSTPDNQSEYGQNEVTDPSSSAQVQIEKKKGRKRSRTEGSDGLGNPSKRPRKISSKRTSDVLECDIQSSSQLSEVSPHLSSEETEPSSSGGLLAVTDGAEQGVTNGGTAEVICKSKKRSRVSACPQPRRVSKRRRPDNMCLPSRDSDIQTAAEEPPVVRPEPGPAILSLVDLVHSINEFCKYTFLLNEEQHVQALPDPDVSDTAVRVGVEDITSGSSALGPQLCPDPVQERYLRLVHDHDTPFVDTESIPANGHGCRTERRMVASKPTAGGACDALWCPNSGVNRIAVRSDGEGETRLITHANTESNMGGVQDGPSRLSPEDEEVAAATKAILSWPFFYGVQQLTLRADEYLNSKAPRKSSTARPPKSTKKGKSLGTSETIVETQPVAVPTPVTAVDNPVSKRPRSARCAARMRGTSRERTSEQDS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>