Mapoly0062s0083



Description

DNA-binding proteins Bright/BRCAA1/RBP1 and related proteins containing BRIGHT domain

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0005622 Intracellular
KOG KOG2744 DNA-binding proteins Bright/BRCAA1/RBP1 and related proteins containing BRIGHT domain
OrthoMCL OG5_169779
PFAM PF01388 ARID/BRIGHT DNA binding domain
PANTHER PTHR15348 AT-RICH INTERACTIVE DOMAIN-CONTAINING PROTEIN (ARID DOMAIN- CONTAINING PROTEIN) (DEAD RINGER PROTEIN) (B-CELL REGULATOR OF IGH TRANSCRIPTION) (BRIGHT)
PANTHER PTHR15348:SF0 SUBFAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpARID3 transcription factor, ARID Mapoly0062s0083.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0062s0083.1 scaffold_62:816100..818786  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0062s0083.1  

Gene structure:

mRNA scaffold_62:816100..818786  ( + strand )
five_prime_UTR scaffold_62:816100..817169  ( + strand )
CDS scaffold_62:817170..818555  ( + strand )
three_prime_UTR scaffold_62:818556..818786  ( + strand )

Sequences:

Gene

>Mapoly0062s0083.1
CGATGGCAGACCATTCGATTCCTCGACTTGAACATCTCTCGAGTCAAGAAGTGTCCCTCACTTCTCAAAGAGCTCTCGAGCAAGAGGAAGAAACGAATGGCTAGACTTGGAGATGGAGGGAGGGGCGCAATGTTGGACTGGCTCGGCATTCAATTTGCAAGAGTGGTGGACTGTGCAGATAGATAGCATCTCGGATACTCGTGAATGATGCAAGTCGAAACTGGGAGTGATCGTGTGAAGTCCATGTGCGTCAATTGGACTCTTCCTAGCTTTCTTGATTTGAGAATCTCGACTGCCCTGGCCAGGAAGAATGGCATTCTCTACTCCGACGAAAATCAGGATGTTGCATCGAAGGTGCTCTTAGTCAGAAATATTAATTCTGATGGTCTCGTGCTTTGAAGATTGTTCGGCTCATCTCTTTCACCATAGAAATTTTTTAAGCTCTTCCTAAGCCTGCCATTAGTCATAAGTCGTATGCAGTTTTGATGTCTGACGTCAAAAGATTTCAGTTCCTTTCTGCACCCTAAATATCTCCCAAAGTTCAGACGATCAGTTTGTTTTATCCTTCAAGGTCAAATGACATGGTGGAGTCAAATCCGACCATGTTTATTCGGTCATCTGCGTTCGGACTCCCTCATCTTCCTCCCGTGATAAATCCTCGCATCTAAAGATGTCGAGGATGTCATGACCTTCACCATTGCAACTGGCACATTTGACAACTATTTGCGGAGGAGGTGCCTTGCTAGCTCTTCTCGCAGTGTCAAAGGCCCTATAGGTTATCAGTAATCTCCTTCCATTGGAGTCCATGCACGATTCTAGTGCCTTATCTTTCACTTCATACGATCGGGGGATTTCCCGTGATCTGTCCCACATCTCACATCTGAAGACGTGAGACCCGCATATGTGAGCGATGTCAGAGTTGTTGTGGCAATTGGCATGTTGGCCACTAGATGAAGAAGGGATGCCATGCTAGCACCTCACGGGATTAAGGGCGAAGGCCATGATAGGTCGTCATCTTCCAAGTGTGACTCGAGCACCCTAGAGTCCTGAGACTGGACAGGACGTGGGCTATGATATATGCTTCGGAGCTCTTCCACAATTTCATTGATCCTCTGAATTTGATGATCCTCAAGTTGGGAAGGTCAAGCACCGGTAACATGGACCCGGAGGTGGATTCCCAAGACGCGGTGATGGAGGTGAACGAGGATGAACAAATCGATCAAGAAAGGGGTGGAAACAAGAATCACGATGGATCTCACTGTGCGGTTGTTCAAACGGAAGTGGCTGTGACGAAAGAACAGGAGAATGACGCTTTTGTCGAAACGGTGGGTAACTTTTTCCGCGAGAAAAATTTGGAGTTCAGAATGCCCAAGTTTTACGGAGAGAATGTGGATTTGTTGAAACTTTGGCGAGAAGTGACGACATTGGGAGGATACCAAGCGGTCTGTTCGAAGAAATTGTGGAAACGCGTCGGGCAAAGTTTTGATCCTCCCAAAACTTGTACCAGTCTCTCCTTCACATTCCGCCAATTCTATGCCAAGGCACTGTTGGAGTACGAGCGATGTCAGTCTGGTGCATTTCAGACTGAAATGCACCAGACTCCGGAATCCGATCATTCATTTCCTTTTCCGGAGCGAAGAAAACGAAGTGCATTGATTCCGAAGAAGAGAGCTCGAGACGATACCGAACCAAAGGAGGAGGACAAGACTCAAGCTCCATGTGCAAGTGACTTGAACCAAGATACGAATTCCAACCGCCTCTTGCAGTGCAGAAGTGACCACCGTTACACAGAAACATCTCCTTCAGATACCTCAGGAGATACATGGAAGAATGATACACAACACGCTCATGATCATGCTGCTCCGACCACGGACTCCGAAGAAAAAGAGATTCAAGCGAATGAGCATGCACGGGAGGAGGACGGTACAAATCTGAAGGAGCGAGATTACAAATTTTACAGCGAGGACACTGGCGAGGCTCGCCAAATTGAGGAAAAGGGAGGGAAGGACCGTGAGACCCGGACCTACAGCCGGACCCGGAGAAGAAAAGCACTACCATCTCCGGGGAAAGCATGGATGGCAAAGGGAGGCCAAGAGCACCTGGAGGATTGCGAGTTCTTGCTCGGATCGAAGCCAATCAAGAAGCTCAAAGCAGCCGTGGCAGATGATGATAATTCGGTTTTCTGGGTGAAGATCTCGGCGTACATGACAAGAGATGATTATCAGATTTACGCTCTTGTTCCAGGTCTTCAAGCGGACGAGCTACGAATTGAATGTGAGATTGCCGGCAAGGTGGTGATCGCTGGATGCCCGAAGAAGCCAGACAACTTGTGGGGAATTACGGCGTTCAGGAAAGTGATCCATCTCCCTTCCAGAATTGATACCCGCAACTTTCAAGCCATTGTTTCCCACTTTGGTCAGCTGCTGTTGAGAGCTCCATTTCTTCAGGAAACCTAGTTCTTGTCCTGGTATCCTTGTATCAATACAAATAAGTGATCATGTGCAGCTCTACGTGAGCTCCATGTTGTAGTTTAAATATTAAGAAGTTGACATCGCCTTCAGTGGTGTTCTGGAAGAGTACAATTGGAAAAATACGTGTCAAATCCAATTTATTTCTTTCTTTAGTTTTAAAAATTTATAGAGCTTTGTTTTAGATGGGAATTCCACTGTAATATCCATCCACAATGA

mRNA

>Mapoly0062s0083.1
CGATGGCAGACCATTCGATTCCTCGACTTGAACATCTCTCGAGTCAAGAAGTGTCCCTCACTTCTCAAAGAGCTCTCGAGCAAGAGGAAGAAACGAATGGCTAGACTTGGAGATGGAGGGAGGGGCGCAATGTTGGACTGGCTCGGCATTCAATTTGCAAGAGTGGTGGACTGTGCAGATAGATAGCATCTCGGATACTCGTGAATGATGCAAGTCGAAACTGGGAGTGATCGTGTGAAGTCCATGTGCGTCAATTGGACTCTTCCTAGCTTTCTTGATTTGAGAATCTCGACTGCCCTGGCCAGGAAGAATGGCATTCTCTACTCCGACGAAAATCAGGATGTTGCATCGAAGGTGCTCTTAGTCAGAAATATTAATTCTGATGGTCTCGTGCTTTGAAGATTGTTCGGCTCATCTCTTTCACCATAGAAATTTTTTAAGCTCTTCCTAAGCCTGCCATTAGTCATAAGTCGTATGCAGTTTTGATGTCTGACGTCAAAAGATTTCAGTTCCTTTCTGCACCCTAAATATCTCCCAAAGTTCAGACGATCAGTTTGTTTTATCCTTCAAGGTCAAATGACATGGTGGAGTCAAATCCGACCATGTTTATTCGGTCATCTGCGTTCGGACTCCCTCATCTTCCTCCCGTGATAAATCCTCGCATCTAAAGATGTCGAGGATGTCATGACCTTCACCATTGCAACTGGCACATTTGACAACTATTTGCGGAGGAGGTGCCTTGCTAGCTCTTCTCGCAGTGTCAAAGGCCCTATAGGTTATCAGTAATCTCCTTCCATTGGAGTCCATGCACGATTCTAGTGCCTTATCTTTCACTTCATACGATCGGGGGATTTCCCGTGATCTGTCCCACATCTCACATCTGAAGACGTGAGACCCGCATATGTGAGCGATGTCAGAGTTGTTGTGGCAATTGGCATGTTGGCCACTAGATGAAGAAGGGATGCCATGCTAGCACCTCACGGGATTAAGGGCGAAGGCCATGATAGGTCGTCATCTTCCAAGTGTGACTCGAGCACCCTAGAGTCCTGAGACTGGACAGGACGTGGGCTATGATATATGCTTCGGAGCTCTTCCACAATTTCATTGATCCTCTGAATTTGATGATCCTCAAGTTGGGAAGGTCAAGCACCGGTAACATGGACCCGGAGGTGGATTCCCAAGACGCGGTGATGGAGGTGAACGAGGATGAACAAATCGATCAAGAAAGGGGTGGAAACAAGAATCACGATGGATCTCACTGTGCGGTTGTTCAAACGGAAGTGGCTGTGACGAAAGAACAGGAGAATGACGCTTTTGTCGAAACGGTGGGTAACTTTTTCCGCGAGAAAAATTTGGAGTTCAGAATGCCCAAGTTTTACGGAGAGAATGTGGATTTGTTGAAACTTTGGCGAGAAGTGACGACATTGGGAGGATACCAAGCGGTCTGTTCGAAGAAATTGTGGAAACGCGTCGGGCAAAGTTTTGATCCTCCCAAAACTTGTACCAGTCTCTCCTTCACATTCCGCCAATTCTATGCCAAGGCACTGTTGGAGTACGAGCGATGTCAGTCTGGTGCATTTCAGACTGAAATGCACCAGACTCCGGAATCCGATCATTCATTTCCTTTTCCGGAGCGAAGAAAACGAAGTGCATTGATTCCGAAGAAGAGAGCTCGAGACGATACCGAACCAAAGGAGGAGGACAAGACTCAAGCTCCATGTGCAAGTGACTTGAACCAAGATACGAATTCCAACCGCCTCTTGCAGTGCAGAAGTGACCACCGTTACACAGAAACATCTCCTTCAGATACCTCAGGAGATACATGGAAGAATGATACACAACACGCTCATGATCATGCTGCTCCGACCACGGACTCCGAAGAAAAAGAGATTCAAGCGAATGAGCATGCACGGGAGGAGGACGGTACAAATCTGAAGGAGCGAGATTACAAATTTTACAGCGAGGACACTGGCGAGGCTCGCCAAATTGAGGAAAAGGGAGGGAAGGACCGTGAGACCCGGACCTACAGCCGGACCCGGAGAAGAAAAGCACTACCATCTCCGGGGAAAGCATGGATGGCAAAGGGAGGCCAAGAGCACCTGGAGGATTGCGAGTTCTTGCTCGGATCGAAGCCAATCAAGAAGCTCAAAGCAGCCGTGGCAGATGATGATAATTCGGTTTTCTGGGTGAAGATCTCGGCGTACATGACAAGAGATGATTATCAGATTTACGCTCTTGTTCCAGGTCTTCAAGCGGACGAGCTACGAATTGAATGTGAGATTGCCGGCAAGGTGGTGATCGCTGGATGCCCGAAGAAGCCAGACAACTTGTGGGGAATTACGGCGTTCAGGAAAGTGATCCATCTCCCTTCCAGAATTGATACCCGCAACTTTCAAGCCATTGTTTCCCACTTTGGTCAGCTGCTGTTGAGAGCTCCATTTCTTCAGGAAACCTAGTTCTTGTCCTGGTATCCTTGTATCAATACAAATAAGTGATCATGTGCAGCTCTACGTGAGCTCCATGTTGTAGTTTAAATATTAAGAAGTTGACATCGCCTTCAGTGGTGTTCTGGAAGAGTACAATTGGAAAAATACGTGTCAAATCCAATTTATTTCTTTCTTTAGTTTTAAAAATTTATAGAGCTTTGTTTTAGATGGGAATTCCACTGTAATATCCATCCACAATGA

CDS

>Mapoly0062s0083.1
ATGATATATGCTTCGGAGCTCTTCCACAATTTCATTGATCCTCTGAATTTGATGATCCTCAAGTTGGGAAGGTCAAGCACCGGTAACATGGACCCGGAGGTGGATTCCCAAGACGCGGTGATGGAGGTGAACGAGGATGAACAAATCGATCAAGAAAGGGGTGGAAACAAGAATCACGATGGATCTCACTGTGCGGTTGTTCAAACGGAAGTGGCTGTGACGAAAGAACAGGAGAATGACGCTTTTGTCGAAACGGTGGGTAACTTTTTCCGCGAGAAAAATTTGGAGTTCAGAATGCCCAAGTTTTACGGAGAGAATGTGGATTTGTTGAAACTTTGGCGAGAAGTGACGACATTGGGAGGATACCAAGCGGTCTGTTCGAAGAAATTGTGGAAACGCGTCGGGCAAAGTTTTGATCCTCCCAAAACTTGTACCAGTCTCTCCTTCACATTCCGCCAATTCTATGCCAAGGCACTGTTGGAGTACGAGCGATGTCAGTCTGGTGCATTTCAGACTGAAATGCACCAGACTCCGGAATCCGATCATTCATTTCCTTTTCCGGAGCGAAGAAAACGAAGTGCATTGATTCCGAAGAAGAGAGCTCGAGACGATACCGAACCAAAGGAGGAGGACAAGACTCAAGCTCCATGTGCAAGTGACTTGAACCAAGATACGAATTCCAACCGCCTCTTGCAGTGCAGAAGTGACCACCGTTACACAGAAACATCTCCTTCAGATACCTCAGGAGATACATGGAAGAATGATACACAACACGCTCATGATCATGCTGCTCCGACCACGGACTCCGAAGAAAAAGAGATTCAAGCGAATGAGCATGCACGGGAGGAGGACGGTACAAATCTGAAGGAGCGAGATTACAAATTTTACAGCGAGGACACTGGCGAGGCTCGCCAAATTGAGGAAAAGGGAGGGAAGGACCGTGAGACCCGGACCTACAGCCGGACCCGGAGAAGAAAAGCACTACCATCTCCGGGGAAAGCATGGATGGCAAAGGGAGGCCAAGAGCACCTGGAGGATTGCGAGTTCTTGCTCGGATCGAAGCCAATCAAGAAGCTCAAAGCAGCCGTGGCAGATGATGATAATTCGGTTTTCTGGGTGAAGATCTCGGCGTACATGACAAGAGATGATTATCAGATTTACGCTCTTGTTCCAGGTCTTCAAGCGGACGAGCTACGAATTGAATGTGAGATTGCCGGCAAGGTGGTGATCGCTGGATGCCCGAAGAAGCCAGACAACTTGTGGGGAATTACGGCGTTCAGGAAAGTGATCCATCTCCCTTCCAGAATTGATACCCGCAACTTTCAAGCCATTGTTTCCCACTTTGGTCAGCTGCTGTTGAGAGCTCCATTTCTTCAGGAAACCTAG

Protein

>Mapoly0062s0083.1
MIYASELFHNFIDPLNLMILKLGRSSTGNMDPEVDSQDAVMEVNEDEQIDQERGGNKNHDGSHCAVVQTEVAVTKEQENDAFVETVGNFFREKNLEFRMPKFYGENVDLLKLWREVTTLGGYQAVCSKKLWKRVGQSFDPPKTCTSLSFTFRQFYAKALLEYERCQSGAFQTEMHQTPESDHSFPFPERRKRSALIPKKRARDDTEPKEEDKTQAPCASDLNQDTNSNRLLQCRSDHRYTETSPSDTSGDTWKNDTQHAHDHAAPTTDSEEKEIQANEHAREEDGTNLKERDYKFYSEDTGEARQIEEKGGKDRETRTYSRTRRRKALPSPGKAWMAKGGQEHLEDCEFLLGSKPIKKLKAAVADDDNSVFWVKISAYMTRDDYQIYALVPGLQADELRIECEIAGKVVIAGCPKKPDNLWGITAFRKVIHLPSRIDTRNFQAIVSHFGQLLLRAPFLQET

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>