Mapoly0064s0079



Description

B-box zinc finger

Reference DB

Database ID Description
GO GO:0005622 Intracellular
GO GO:0008270 Zinc ion binding
OrthoMCL OG5_138082
PFAM PF00643 B-box zinc finger
PANTHER PTHR31832 FAMILY NOT NAMED
PANTHER PTHR31832:SF4

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBBX4 transcription factor, BBX Mapoly0064s0079.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0064s0079.1 scaffold_64:800830..803635  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0064s0079.1  

Gene structure:

mRNA scaffold_64:800830..803635  ( - strand )
three_prime_UTR scaffold_64:800830..801818  ( - strand )
CDS scaffold_64:801819..802103  ( - strand )
CDS scaffold_64:802253..802774  ( - strand )
CDS scaffold_64:803048..803227  ( - strand )
five_prime_UTR scaffold_64:803228..803635  ( - strand )

Sequences:

Gene

>Mapoly0064s0079.1
TGTGGTGACAGAAGTGCAAGGGTGAACTAGAAGAGGACGAGAATCGAGGAGCAGAATTTGGGGTAGAGGGGAAGTCGAGTAAGGCCCGCAGCGAGAGGCGGAGGAGAGGAGAGGAAGGGAAGGCCTGAGGGGAGGGGAGGGGAGCTGAGGTGAAATTGAAAGGAAGGGCCGCGAAAGGGCTTGTTGTCCTGGAAGAAGTTTGAGGAAGCGAGAGACGAAACGAGACGAGACGAGACGAAACGAGACCACAGATTTTCGTAGAGGAGGGACGCGAGAGGAGGTTAGATAGGCAGACACTGAGCCGAGGTCGTGTCGACGAAGACTGGTACAAGACGAAGACGACGGGCGGCGAGAGAGCGGGGGAACTCTTTCCGACGGATTTTAGATAGCGGAAGGAGACTGGTCAAGATGAGGGTTCAGTGTGATGGATGTGAGAGGGCCGTGGCGTCGATTATGTGTTGCGCGGATGAAGCTGCCTTGTGTAACGAGTGTGACACCCGCATTCATGCCGCGAACAAGTTGGCGAACAAGCACCAGCGAGTTTCTCTGATGGGTCAAACCGAGTCTCCTCGGTGTGATATTTGTCAGGTAAATTTGCCCAGCCGCGACCCCGAGACGTATTAGGTCGTGTCCTGAAATCATGCGCCGCATGCAGCAACTGTATTTTCTGTGGAGGTTCGGACAGGAAAAAGTTTTGAGCGGCTCGTAACGAGGATGTGTTGGGCTTGCTTCTCTTCTCATGCTGTCGCCGGTCTGTTCTAATGGCCGTGGTAAACCTGACGGTGAAGTCCCGAGGAGTGCATGCTAGGACGAGGATGTACTCTCTATTATCTTTTCACCGTATGTGGTTGGATCTTGCAGGAGAAGTCAGCATTTTTTTTCTGCCTGGAGGATCGAGCCCTTCTCTGTAGGGATTGTGATGTTTCGATACACTCCGCCACCGCTCTGTCTTCTGCCCACCAGCGGTTCCTGGTGCCTGGAACGAGAGTGGCTCTGGAGGCTCTTAGCAATTCAAGCCCCGCACCGCAAGAAACGGCTACAAGTGAAGAGCTGGCTCGGCATCCTCTATCTTCTATCATCAACGGCACTGCCACTAACTCGTCCAAGTCTCCATCCGTTTCTTACAAACAATCTTCGTATTACACACCCACTCCTTCATTCACATCGCCGTCCTCAGGGAAGACTTCTGTCATCACTTCGAACAAGTCTGTGGGGATGAGCAATACCTCTGCAAATCATCAAAGCGTGTCTAGCACTCAAGCGAAGAGGACAAGCATTACGGAGTTCCTTTCTGACGCCATTCCCAACTGGCGCGTGGATGAGTTACTGAACATCCCCGAGTTGGGAGAAGGATACAGTCTCGGCGATATAGCGTCCTCCAAGGTAGTTGACATTGATAACGGATCTGTTTGCATGTCGGCCGTGATTGAAGTTTTACCTAGCCTTGGAGAAAACTGTTTTGCCCGTGCTGCTTTGGTCTGTGTTGTCTCACTTGCGTTGTGCTCATTCTATTTGCCTTGTTTTTGGACCAGGCCGATCAAGCGAACCTCGGAGATTACGATTGGACTGCAGATTTGAGTCTATTTGACGAGCAAGTATACGCCGAGTCTTTCCACGAGGTTCCACAGATGTTTTCGAATCCTGCTGCGTCAGGGATGTGCCGCACGGGTAGAGCTACAGGAGCCATGAAAGGCAAAGCGAAACAGGATTCCCTCGTGCCTGAGTACGACGATGCGTTTGTTGTTCCTGACCTTGGCCTTCACTCTGCTCCAGCCTCACCACCGGTGGCTAAGAGGCGGAGACTACTAGAAGTATAATAGTTATAGTATTACCGCGCCAGTCCGTTTTACACATGGATTTGTTCAGTCTTCTTGCGCAGTCACCAGAGTTGGCCGTGGGGTTACACTGACTCTGATTGGAACTGACCGAAGAAGCTCGAAGACGACTTGGTGTTCATACTAGCTTCATCAGTTCAGGCAGATGTCGAGTAGAAAATGCTTTCGACGGAGCTTGAGATCCGACAACTGGAGAAACTATATCCTGGAATACAGGAGCTCAGACAGCAGCTGTTTTTTCATGTATAGAAACAGAGTCTATACGTGTTACCACGTGGAAGCATAACGCCAGTTTGGTGAGTACTTGAGGGTACTGGCCAAGTCATCTTTCTCCACATTGAGGTTCGCCCACGGTGAAGCTAGCCTCCCTGGTCCCGTATTTCTTATACAATCGCTCTATGCGGTAATGGTAAATTTTTGCCCATATTGATCTTGGGTTTGCTCCTATAGATTCTGTCTTGTACAGATAGCGTCCACTATAGGAGTCTCAGCATGAGTCCAGCAAAGTACGAGAAGTTAAGAATCATCGTTGTAGATTTTCATGCAGAGAATGTGGACGCACATCGAACTGCTGGAGCCGCAGATAATACATCACCCCAATAGAACATCGTCGACGTTAGCGACTGGTACAGGTGGCAATTTTAGTGACAGGAAATTCGACGCTCTAAAACCTTTAGAATCCTCTCAGTAGAGGCGGGTGACCTTAGAGTTTTTTTCATCTTGTCAAAAACCTCAGTGTACAGCAGCAGGATGTTGTTTCTTCTTGTAGATTAGGCTCAGGTGAACCCTGGTTATAGAGCGAGAGACATCTTGGCTTCTGCAGTGTTGGAGCTAATTACTTGATATCCGTTCTCATTTCTGTCTCGGCTTCATATCTTGAAGTATTGAGTTGTATTATGAGGCCCGCATTTTCAGCGTTGCCGATTCTATTGGTGGTTACGGAACGGTGATTTCACTGTCTTCATATTATC

mRNA

>Mapoly0064s0079.1
TGTGGTGACAGAAGTGCAAGGGTGAACTAGAAGAGGACGAGAATCGAGGAGCAGAATTTGGGGTAGAGGGGAAGTCGAGTAAGGCCCGCAGCGAGAGGCGGAGGAGAGGAGAGGAAGGGAAGGCCTGAGGGGAGGGGAGGGGAGCTGAGGTGAAATTGAAAGGAAGGGCCGCGAAAGGGCTTGTTGTCCTGGAAGAAGTTTGAGGAAGCGAGAGACGAAACGAGACGAGACGAGACGAAACGAGACCACAGATTTTCGTAGAGGAGGGACGCGAGAGGAGGTTAGATAGGCAGACACTGAGCCGAGGTCGTGTCGACGAAGACTGGTACAAGACGAAGACGACGGGCGGCGAGAGAGCGGGGGAACTCTTTCCGACGGATTTTAGATAGCGGAAGGAGACTGGTCAAGATGAGGGTTCAGTGTGATGGATGTGAGAGGGCCGTGGCGTCGATTATGTGTTGCGCGGATGAAGCTGCCTTGTGTAACGAGTGTGACACCCGCATTCATGCCGCGAACAAGTTGGCGAACAAGCACCAGCGAGTTTCTCTGATGGGTCAAACCGAGTCTCCTCGGTGTGATATTTGTCAGGAGAAGTCAGCATTTTTTTTCTGCCTGGAGGATCGAGCCCTTCTCTGTAGGGATTGTGATGTTTCGATACACTCCGCCACCGCTCTGTCTTCTGCCCACCAGCGGTTCCTGGTGCCTGGAACGAGAGTGGCTCTGGAGGCTCTTAGCAATTCAAGCCCCGCACCGCAAGAAACGGCTACAAGTGAAGAGCTGGCTCGGCATCCTCTATCTTCTATCATCAACGGCACTGCCACTAACTCGTCCAAGTCTCCATCCGTTTCTTACAAACAATCTTCGTATTACACACCCACTCCTTCATTCACATCGCCGTCCTCAGGGAAGACTTCTGTCATCACTTCGAACAAGTCTGTGGGGATGAGCAATACCTCTGCAAATCATCAAAGCGTGTCTAGCACTCAAGCGAAGAGGACAAGCATTACGGAGTTCCTTTCTGACGCCATTCCCAACTGGCGCGTGGATGAGTTACTGAACATCCCCGAGTTGGGAGAAGGATACAGTCTCGGCGATATAGCGTCCTCCAAGGCCGATCAAGCGAACCTCGGAGATTACGATTGGACTGCAGATTTGAGTCTATTTGACGAGCAAGTATACGCCGAGTCTTTCCACGAGGTTCCACAGATGTTTTCGAATCCTGCTGCGTCAGGGATGTGCCGCACGGGTAGAGCTACAGGAGCCATGAAAGGCAAAGCGAAACAGGATTCCCTCGTGCCTGAGTACGACGATGCGTTTGTTGTTCCTGACCTTGGCCTTCACTCTGCTCCAGCCTCACCACCGGTGGCTAAGAGGCGGAGACTACTAGAAGTATAATAGTTATAGTATTACCGCGCCAGTCCGTTTTACACATGGATTTGTTCAGTCTTCTTGCGCAGTCACCAGAGTTGGCCGTGGGGTTACACTGACTCTGATTGGAACTGACCGAAGAAGCTCGAAGACGACTTGGTGTTCATACTAGCTTCATCAGTTCAGGCAGATGTCGAGTAGAAAATGCTTTCGACGGAGCTTGAGATCCGACAACTGGAGAAACTATATCCTGGAATACAGGAGCTCAGACAGCAGCTGTTTTTTCATGTATAGAAACAGAGTCTATACGTGTTACCACGTGGAAGCATAACGCCAGTTTGGTGAGTACTTGAGGGTACTGGCCAAGTCATCTTTCTCCACATTGAGGTTCGCCCACGGTGAAGCTAGCCTCCCTGGTCCCGTATTTCTTATACAATCGCTCTATGCGGTAATGGTAAATTTTTGCCCATATTGATCTTGGGTTTGCTCCTATAGATTCTGTCTTGTACAGATAGCGTCCACTATAGGAGTCTCAGCATGAGTCCAGCAAAGTACGAGAAGTTAAGAATCATCGTTGTAGATTTTCATGCAGAGAATGTGGACGCACATCGAACTGCTGGAGCCGCAGATAATACATCACCCCAATAGAACATCGTCGACGTTAGCGACTGGTACAGGTGGCAATTTTAGTGACAGGAAATTCGACGCTCTAAAACCTTTAGAATCCTCTCAGTAGAGGCGGGTGACCTTAGAGTTTTTTTCATCTTGTCAAAAACCTCAGTGTACAGCAGCAGGATGTTGTTTCTTCTTGTAGATTAGGCTCAGGTGAACCCTGGTTATAGAGCGAGAGACATCTTGGCTTCTGCAGTGTTGGAGCTAATTACTTGATATCCGTTCTCATTTCTGTCTCGGCTTCATATCTTGAAGTATTGAGTTGTATTATGAGGCCCGCATTTTCAGCGTTGCCGATTCTATTGGTGGTTACGGAACGGTGATTTCACTGTCTTCATATTATC

CDS

>Mapoly0064s0079.1
ATGAGGGTTCAGTGTGATGGATGTGAGAGGGCCGTGGCGTCGATTATGTGTTGCGCGGATGAAGCTGCCTTGTGTAACGAGTGTGACACCCGCATTCATGCCGCGAACAAGTTGGCGAACAAGCACCAGCGAGTTTCTCTGATGGGTCAAACCGAGTCTCCTCGGTGTGATATTTGTCAGGAGAAGTCAGCATTTTTTTTCTGCCTGGAGGATCGAGCCCTTCTCTGTAGGGATTGTGATGTTTCGATACACTCCGCCACCGCTCTGTCTTCTGCCCACCAGCGGTTCCTGGTGCCTGGAACGAGAGTGGCTCTGGAGGCTCTTAGCAATTCAAGCCCCGCACCGCAAGAAACGGCTACAAGTGAAGAGCTGGCTCGGCATCCTCTATCTTCTATCATCAACGGCACTGCCACTAACTCGTCCAAGTCTCCATCCGTTTCTTACAAACAATCTTCGTATTACACACCCACTCCTTCATTCACATCGCCGTCCTCAGGGAAGACTTCTGTCATCACTTCGAACAAGTCTGTGGGGATGAGCAATACCTCTGCAAATCATCAAAGCGTGTCTAGCACTCAAGCGAAGAGGACAAGCATTACGGAGTTCCTTTCTGACGCCATTCCCAACTGGCGCGTGGATGAGTTACTGAACATCCCCGAGTTGGGAGAAGGATACAGTCTCGGCGATATAGCGTCCTCCAAGGCCGATCAAGCGAACCTCGGAGATTACGATTGGACTGCAGATTTGAGTCTATTTGACGAGCAAGTATACGCCGAGTCTTTCCACGAGGTTCCACAGATGTTTTCGAATCCTGCTGCGTCAGGGATGTGCCGCACGGGTAGAGCTACAGGAGCCATGAAAGGCAAAGCGAAACAGGATTCCCTCGTGCCTGAGTACGACGATGCGTTTGTTGTTCCTGACCTTGGCCTTCACTCTGCTCCAGCCTCACCACCGGTGGCTAAGAGGCGGAGACTACTAGAAGTATAA

Protein

>Mapoly0064s0079.1
MRVQCDGCERAVASIMCCADEAALCNECDTRIHAANKLANKHQRVSLMGQTESPRCDICQEKSAFFFCLEDRALLCRDCDVSIHSATALSSAHQRFLVPGTRVALEALSNSSPAPQETATSEELARHPLSSIINGTATNSSKSPSVSYKQSSYYTPTPSFTSPSSGKTSVITSNKSVGMSNTSANHQSVSSTQAKRTSITEFLSDAIPNWRVDELLNIPELGEGYSLGDIASSKADQANLGDYDWTADLSLFDEQVYAESFHEVPQMFSNPAASGMCRTGRATGAMKGKAKQDSLVPEYDDAFVVPDLGLHSAPASPPVAKRRRLLEV

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>