Mapoly0065s0031



Description

CPG BINDING PROTEIN

Reference DB

Database ID Description
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0042393 Histone binding
OrthoMCL OG5_132765
PFAM PF12165 Domain of unknown function (DUF3594)
PANTHER PTHR12321 CPG BINDING PROTEIN

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpALFIN2 transcription factor, Alfin1-like Mapoly0065s0031.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0065s0031.1 scaffold_65:329218..333429  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0065s0031.1  

Gene structure:

mRNA scaffold_65:329218..333429  ( + strand )
five_prime_UTR scaffold_65:329218..329694  ( + strand )
five_prime_UTR scaffold_65:331248..331300  ( + strand )
CDS scaffold_65:331301..332452  ( + strand )
three_prime_UTR scaffold_65:332453..333429  ( + strand )

Sequences:

Gene

>Mapoly0065s0031.1
CCGTAGTCCGATGTGGTCTGATGTAGAATGCTCGAGGTACCGTATGGTTCTGTTGTGTCACTTGTGCCAAATCAAGGGCGTAGTTATTCAGCAGTCTGAGGTCGTTCACTGATGTGTAATTTAAAGACCAACCTGTTTCTTAGCAGATAACCAGAGAACATGGAAATTAGAGGTATTGAAATTGCGGGTTCGCAGGCCGTGGACAGTTTCGGAGTGGGTGGGTTTCTCTTCTTCGTTCGAGACTATCATTCATTGCAAGCATATATCGGGAACGAATCCTGCCGTTGTGGTCTTGTTGCGTAGCCTGACTACAGGTGCCCCGCCCAACCACGATATCACGACGCATCTCTGCCTGCCTGGGTGGGGTGCCTGGGAAAGTTGAATCAACTATGCTGAGAGATTTTCAGTGGAGGGCAATCCAGGACTTCGAGCGAGCAGGGATGCCGAAGGAAACTGTGCTGCGAGTCTGCAGATACTGTAAGTTCTGTCAACTGCAATGCACGGTTGTTTCTATGTTGATGAATGGGAGAGGACCTCACTCGTGGAGTCTGTCTGTCTGTCTGCTGACAAACCCAAGAATTACCGCCCTGCGAAAGTCGCTTCTCCGATTGAGTTCCTGCCGGTTTTCCAATGGCGAACAGATACATCATCAGACGGAACTGAAGGGTCAGGTCTTACGGTACCAGCAGCAGAGAATAACCACCCACACAATTTTGGTGTTTCCATCTGCTACATAAAGAAGTGACAGAAGCGAGGGGGACACCGCTACAAAACTAGCTCGATGTGCGATATCTCACACAGGGCCAGAAGAGCAGAGTATCAGTTACCGCAGTGTAAGAGCGGGAGAGTTCAAAACGCCGCACGATTCTCGCTGAATCTGAATATTGACCACTTTGGTGAATCACCCGACGTGAGCGAGAACGAAGATCGATGTAGGAACACTGTGGACGGACTGGTTCAGATTTGCTCTGCGCGTCCGGGGTTTCAGCAGTTTCTTTACTGAGAGTTTGTGTCGTTTTGTTGTGTGCAGGACGAGGCTCGGATGACGGGTTGAAGCTTCGGCGAATCAGTGGTTCAAAGACCATGAACCAGAAGATTCAGGATGTTCTCGACCCTAAGTTTGAAAACGTCGAAGTAATCTATGCTGCCGTCAAGAGGAGGCAGGCAGGAATCATCAAGGCATTGACGATGGAGTCGGACGAACTCTTTCGACAATGTGACCCAGAGACGGACAACTTGTGCTTGTACGGGCTACCGGATGGAGGATGGAAAGTTGCACTTCCAGCACAAGATGTTCCTACAGAACTTCCAGAACCTGCCCTAGGGATAAATTTTGCCAGGGACGGAATGTCACGCCAAGATTGGTTGACTCTAATTGCCCTACACAGTGATGCTTGGCTCCTCGCGATAGCGTCCTTTTACGGCGCTGAGCTCACCAGAAACGAAAGAAAACGGCTTCTCGTCATGCTTGGCGACTCACCCACGTCCTACGATATAGTCACTGGCAAGAACGTCGACGATTCTCTTGACTACAGCAGAGTTCATCACATCAAGGCCATCGACGCTTGCAGTCTTCCCATGATCACGGGCGGGTCCAAGGACGAAATTCGAGTAAAGCAAGTGATCACGGACGAGAATGACAGAGGCAGAATGATCTCGAATCATACGTTCTTGGCGCCAAAAGCGGTGACCAACCCCGCAACTCCACACAAACAATGGGAGCAAGTGCTGCCGGCAATTCCTCGATCTGTCGAAAATTGTAGGAATCAATTCGCGGAGCCAGCAAAAGTAGTGTCTGAAGCTCCCTGCGTGCCGGAGATGGCTCAGTCCATTCACATGAACGCAACTGCTGCAGTCGATGATTTGTCAGTGCCCCAGGCAGATCCCGAGGTGCCGGAGGCCAGCGGCTCTGCACCTCGCGAGAGAGAGAGGCCCCCTGCCCGCTGGACGGACTGGTTCAGATTTGCTCTGCGCGTCCGGGGTTTCAGCAGTTTCTTTACTGAGAGTTTGTGTCGTTTTGTTGTGTGCAGGACGAGGCTCGGATGACGGGTTGAAGCTTCGGCGAATCAGTGGTTCAAAGACCATGAACCAGAAGATTCAGGATGTTCTCGACCCTAAGTTTGAAAACGTCGAAGTAATCTATGCTGCCGTCAAGAGGAGGCAGGCAGGAATCATCAAGGCATTGACGATGGAGTCGGACGAACTCTTTCGACAATGTGACCCAGAGACGGACAACTTGTGCTTGTACGGGCTACCGGATGGAGGATGGAAAGTTGCACTTCCAGCACAAGATGTTCCTACAGAACTTCCAGAACCTGCCCTAGGGATAAATTTTGCCAGGGACGGAATGTCACGCCAAGATTGGTTGACTCTAATTGCCCTACACAGTGATGCTTGGCTCCTCGCGATAGCGTCCTTTTACGGCGCTGAGCTCACCAGAAACGAAAGAAAACGGCTTCTCGTCATGCTTGGCGACTCACCCACGTCCTACGATATAGTCACTGGCAAGAACGTCGACGATTCTCTTGACTACAGCAGAGTTCATCACATCAAGGCCATCGACGCTTGCAGTCTTCCCATGATCACGGGCGGGTCCAAGGACGAAATTCGAGTAAAGCAAGTGATCACGGACGAGAATGACAGAGGCAGAATGATCTCGAATCATACGTTCTTGGCGCCAAAAGCGGTGACCAACCCCGCAACTCCACACAAACAATGGGAGCAAGTGCTGCCGGCAATTCCTCGATCTGTCGAAAATTGTAGGAATCAATTCGCGGAGCCAGCAAAAGTAGTGTCTGAAGCTCCCTGCGTGCCGGAGATGGCTCAGTCCATTCACATGAACGCAACTGCTGCAGTCGATGATTTGTCAGTGCCCCAGGCAGATCCCGAGGTGCCGGAGGCCAGCGGCTCTGCACCTCGCGAGAGAGAGAGGCCCCCTGCCCGCCTCCGGACCAAGAGGCAAACGAAGCCAAGAAACACGTTCGCTTTGGATTTCCTCGACACCGTGGACTTCTCGTCAGACGACGACGACGGCGACGACCGTGACGGCACCGTCTGCGAAATCTGTCGAGCCGGGAACGTTGGCGACAGCGTGACCCACTGGGTGGCATGCGATTGCTGCGAGAAGTGGTTCCACTGCAAGTGCGTCAAAATCACGCCGGCCAAAGCGCAGCATCTGAAGCTCTACAAGTGCCCGACGTGCGCCAGCAAGAAGGCTCCCTTTCAGCTGTTTTGAATCTGAGTCCGGGACCACACCGGTCACACCGGTCGGACCGAATCACGCACGGTACGGTACAGACGAGGACGGGTGACAACGCCTGCTCCGCCCGCGCGTACCTTTCTCTTTGTCGATGCGACAAGCACGTCTGCGACTGCAATCACGGTAGACGTACAGACGGAGCCCTCTGTCAGAAGCGGTCGAGGCGAACGAGAATCGTAGATTCTGAAGAAACCTCAGAATGAAGACGCAAGCTTGTACACGTCAGCGCATCTGATGCCTTCCTTGGATTCTTCCCGTGTCGCTGCGCTTACTGCAGTTGGAGGACAAGCGCGCGCTTGATCTTCGTAGACCATGTGTATCGTCTTACTGCGCAAGGTATCGTAGACGTAGAAGACGTGGGGTCGGAATACTGTACATGGACGAAAGGCAAGGTTGTCTCGTTTGGTCGTGGTCGACTTTCCTGAAGCTAGGATGAAACGCCGGCGGATGCTGAACATAGTGGACGATTTTATTGCACAGTTCATGTTGGAATGTGACACGACGTTCGTATTATGTCTATACGTAGTTAGAAACGTGGATTGTTCTTGAGTAACCTACTTAGTAGATTCGAACGAGATATTGACCGGTCCTCGACTATGCAGCGAAGTCTCGCAACACCCTCTTTTATGGAGATGTGTGTTCCTTCTCTAAAATCGCTGACTGTGGTATGTTCATACGAATTGCTTTTACCTAGAAATTATACCTCAAAAACTGAGGGGTAGCAAATACAACAAAGATGGGAGTCATACATTTGGAGTTGATGGCTGTTCGGAATTGATCTGCAAAACTTCAAAGCTAATTGATCTACCGATCTACTTGAGCGTATGATATAATTGTGTATACACAGATGGATTCAAATCCAAAATATCCTGATTGAGTTTGTTCAGGGAATGATTTTCAGGAAAGTGCAACTCATGAACAGAATTTTTATAATTATTGCAAAACACAAGTAC

mRNA

>Mapoly0065s0031.1
CCGTAGTCCGATGTGGTCTGATGTAGAATGCTCGAGGTACCGTATGGTTCTGTTGTGTCACTTGTGCCAAATCAAGGGCGTAGTTATTCAGCAGTCTGAGGTCGTTCACTGATGTGTAATTTAAAGACCAACCTGTTTCTTAGCAGATAACCAGAGAACATGGAAATTAGAGGTATTGAAATTGCGGGTTCGCAGGCCGTGGACAGTTTCGGAGTGGGTGGGTTTCTCTTCTTCGTTCGAGACTATCATTCATTGCAAGCATATATCGGGAACGAATCCTGCCGTTGTGGTCTTGTTGCGTAGCCTGACTACAGGTGCCCCGCCCAACCACGATATCACGACGCATCTCTGCCTGCCTGGGTGGGGTGCCTGGGAAAGTTGAATCAACTATGCTGAGAGATTTTCAGTGGAGGGCAATCCAGGACTTCGAGCGAGCAGGGATGCCGAAGGAAACTGTGCTGCGAGTCTGCAGATACTGACGAGGCTCGGATGACGGGTTGAAGCTTCGGCGAATCAGTGGTTCAAAGACCATGAACCAGAAGATTCAGGATGTTCTCGACCCTAAGTTTGAAAACGTCGAAGTAATCTATGCTGCCGTCAAGAGGAGGCAGGCAGGAATCATCAAGGCATTGACGATGGAGTCGGACGAACTCTTTCGACAATGTGACCCAGAGACGGACAACTTGTGCTTGTACGGGCTACCGGATGGAGGATGGAAAGTTGCACTTCCAGCACAAGATGTTCCTACAGAACTTCCAGAACCTGCCCTAGGGATAAATTTTGCCAGGGACGGAATGTCACGCCAAGATTGGTTGACTCTAATTGCCCTACACAGTGATGCTTGGCTCCTCGCGATAGCGTCCTTTTACGGCGCTGAGCTCACCAGAAACGAAAGAAAACGGCTTCTCGTCATGCTTGGCGACTCACCCACGTCCTACGATATAGTCACTGGCAAGAACGTCGACGATTCTCTTGACTACAGCAGAGTTCATCACATCAAGGCCATCGACGCTTGCAGTCTTCCCATGATCACGGGCGGGTCCAAGGACGAAATTCGAGTAAAGCAAGTGATCACGGACGAGAATGACAGAGGCAGAATGATCTCGAATCATACGTTCTTGGCGCCAAAAGCGGTGACCAACCCCGCAACTCCACACAAACAATGGGAGCAAGTGCTGCCGGCAATTCCTCGATCTGTCGAAAATTGTAGGAATCAATTCGCGGAGCCAGCAAAAGTAGTGTCTGAAGCTCCCTGCGTGCCGGAGATGGCTCAGTCCATTCACATGAACGCAACTGCTGCAGTCGATGATTTGTCAGTGCCCCAGGCAGATCCCGAGGTGCCGGAGGCCAGCGGCTCTGCACCTCGCGAGAGAGAGAGGCCCCCTGCCCGCCTCCGGACCAAGAGGCAAACGAAGCCAAGAAACACGTTCGCTTTGGATTTCCTCGACACCGTGGACTTCTCGTCAGACGACGACGACGGCGACGACCGTGACGGCACCGTCTGCGAAATCTGTCGAGCCGGGAACGTTGGCGACAGCGTGACCCACTGGGTGGCATGCGATTGCTGCGAGAAGTGGTTCCACTGCAAGTGCGTCAAAATCACGCCGGCCAAAGCGCAGCATCTGAAGCTCTACAAGTGCCCGACGTGCGCCAGCAAGAAGGCTCCCTTTCAGCTGTTTTGAATCTGAGTCCGGGACCACACCGGTCACACCGGTCGGACCGAATCACGCACGGTACGGTACAGACGAGGACGGGTGACAACGCCTGCTCCGCCCGCGCGTACCTTTCTCTTTGTCGATGCGACAAGCACGTCTGCGACTGCAATCACGGTAGACGTACAGACGGAGCCCTCTGTCAGAAGCGGTCGAGGCGAACGAGAATCGTAGATTCTGAAGAAACCTCAGAATGAAGACGCAAGCTTGTACACGTCAGCGCATCTGATGCCTTCCTTGGATTCTTCCCGTGTCGCTGCGCTTACTGCAGTTGGAGGACAAGCGCGCGCTTGATCTTCGTAGACCATGTGTATCGTCTTACTGCGCAAGGTATCGTAGACGTAGAAGACGTGGGGTCGGAATACTGTACATGGACGAAAGGCAAGGTTGTCTCGTTTGGTCGTGGTCGACTTTCCTGAAGCTAGGATGAAACGCCGGCGGATGCTGAACATAGTGGACGATTTTATTGCACAGTTCATGTTGGAATGTGACACGACGTTCGTATTATGTCTATACGTAGTTAGAAACGTGGATTGTTCTTGAGTAACCTACTTAGTAGATTCGAACGAGATATTGACCGGTCCTCGACTATGCAGCGAAGTCTCGCAACACCCTCTTTTATGGAGATGTGTGTTCCTTCTCTAAAATCGCTGACTGTGGTATGTTCATACGAATTGCTTTTACCTAGAAATTATACCTCAAAAACTGAGGGGTAGCAAATACAACAAAGATGGGAGTCATACATTTGGAGTTGATGGCTGTTCGGAATTGATCTGCAAAACTTCAAAGCTAATTGATCTACCGATCTACTTGAGCGTATGATATAATTGTGTATACACAGATGGATTCAAATCCAAAATATCCTGATTGAGTTTGTTCAGGGAATGATTTTCAGGAAAGTGCAACTCATGAACAGAATTTTTATAATTATTGCAAAACACAAGTAC

CDS

>Mapoly0065s0031.1
ATGAACCAGAAGATTCAGGATGTTCTCGACCCTAAGTTTGAAAACGTCGAAGTAATCTATGCTGCCGTCAAGAGGAGGCAGGCAGGAATCATCAAGGCATTGACGATGGAGTCGGACGAACTCTTTCGACAATGTGACCCAGAGACGGACAACTTGTGCTTGTACGGGCTACCGGATGGAGGATGGAAAGTTGCACTTCCAGCACAAGATGTTCCTACAGAACTTCCAGAACCTGCCCTAGGGATAAATTTTGCCAGGGACGGAATGTCACGCCAAGATTGGTTGACTCTAATTGCCCTACACAGTGATGCTTGGCTCCTCGCGATAGCGTCCTTTTACGGCGCTGAGCTCACCAGAAACGAAAGAAAACGGCTTCTCGTCATGCTTGGCGACTCACCCACGTCCTACGATATAGTCACTGGCAAGAACGTCGACGATTCTCTTGACTACAGCAGAGTTCATCACATCAAGGCCATCGACGCTTGCAGTCTTCCCATGATCACGGGCGGGTCCAAGGACGAAATTCGAGTAAAGCAAGTGATCACGGACGAGAATGACAGAGGCAGAATGATCTCGAATCATACGTTCTTGGCGCCAAAAGCGGTGACCAACCCCGCAACTCCACACAAACAATGGGAGCAAGTGCTGCCGGCAATTCCTCGATCTGTCGAAAATTGTAGGAATCAATTCGCGGAGCCAGCAAAAGTAGTGTCTGAAGCTCCCTGCGTGCCGGAGATGGCTCAGTCCATTCACATGAACGCAACTGCTGCAGTCGATGATTTGTCAGTGCCCCAGGCAGATCCCGAGGTGCCGGAGGCCAGCGGCTCTGCACCTCGCGAGAGAGAGAGGCCCCCTGCCCGCCTCCGGACCAAGAGGCAAACGAAGCCAAGAAACACGTTCGCTTTGGATTTCCTCGACACCGTGGACTTCTCGTCAGACGACGACGACGGCGACGACCGTGACGGCACCGTCTGCGAAATCTGTCGAGCCGGGAACGTTGGCGACAGCGTGACCCACTGGGTGGCATGCGATTGCTGCGAGAAGTGGTTCCACTGCAAGTGCGTCAAAATCACGCCGGCCAAAGCGCAGCATCTGAAGCTCTACAAGTGCCCGACGTGCGCCAGCAAGAAGGCTCCCTTTCAGCTGTTTTGA

Protein

>Mapoly0065s0031.1
MNQKIQDVLDPKFENVEVIYAAVKRRQAGIIKALTMESDELFRQCDPETDNLCLYGLPDGGWKVALPAQDVPTELPEPALGINFARDGMSRQDWLTLIALHSDAWLLAIASFYGAELTRNERKRLLVMLGDSPTSYDIVTGKNVDDSLDYSRVHHIKAIDACSLPMITGGSKDEIRVKQVITDENDRGRMISNHTFLAPKAVTNPATPHKQWEQVLPAIPRSVENCRNQFAEPAKVVSEAPCVPEMAQSIHMNATAAVDDLSVPQADPEVPEASGSAPRERERPPARLRTKRQTKPRNTFALDFLDTVDFSSDDDDGDDRDGTVCEICRAGNVGDSVTHWVACDCCEKWFHCKCVKITPAKAQHLKLYKCPTCASKKAPFQLF

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>