Mapoly0068s0004



Description

CYCLIC NUCLEOTIDE PHOSPHODIESTERASE

Reference DB

Database ID Description
GO GO:0004114 3',5'-cyclic-nucleotide phosphodiesterase activity
GO GO:0007165 Signal transduction
GO GO:0009190 Cyclic nucleotide biosynthetic process
GO GO:0016849 Phosphorus-oxygen lyase activity
GO GO:0035556 Intracellular signal transduction
OrthoMCL OG5_240185
PFAM PF00211 Adenylate and Guanylate cyclase catalytic domain
PFAM PF00233 3'5'-cyclic nucleotide phosphodiesterase
PANTHER PTHR11347 CYCLIC NUCLEOTIDE PHOSPHODIESTERASE

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpCAPE adenylyl cyclase with a phosphodiestrase domain Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0068s0004.1 scaffold_68:19072..31436  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0068s0004.1  

Gene structure:

mRNA scaffold_68:19072..31436  ( - strand )
three_prime_UTR scaffold_68:19072..19343  ( - strand )
CDS scaffold_68:19344..19855  ( - strand )
CDS scaffold_68:19972..20095  ( - strand )
CDS scaffold_68:20187..20410  ( - strand )
CDS scaffold_68:20961..21081  ( - strand )
CDS scaffold_68:21851..21949  ( - strand )
CDS scaffold_68:22338..22421  ( - strand )
CDS scaffold_68:22614..23159  ( - strand )
CDS scaffold_68:23362..23542  ( - strand )
CDS scaffold_68:23719..25250  ( - strand )
CDS scaffold_68:25882..26038  ( - strand )
CDS scaffold_68:26766..27295  ( - strand )
CDS scaffold_68:27915..28125  ( - strand )
CDS scaffold_68:28328..28395  ( - strand )
CDS scaffold_68:28821..28904  ( - strand )
CDS scaffold_68:29151..29270  ( - strand )
CDS scaffold_68:29931..30164  ( - strand )
CDS scaffold_68:30430..30435  ( - strand )
five_prime_UTR scaffold_68:30436..31436  ( - strand )

Sequences:

Gene

>Mapoly0068s0004.1
GTAAATCTGTTGTGCACCATATGGTTACAGCAGTTGTAGAACTTTCCTCATTGGTTTTTCCCCACCGCTGATGGTTAGGTCAATCTCAGCGCCAATGATACTTGCACCATGTGCAGGTATATTCACTCGGTTAATACAACAATATTTGTGTGGGGTTCCAGCTATACTTTTTGAGGACAATGGGTATGTTTTCAACAAGTACTAGGTCTGTGAAATAGTTCTGGGACCACAGGAATTCTGGTTTGAACTAAATCGGAACAATTGCTGTTTTTGCTGGAAGGATCAGCTTGACAATGAATGTTGCCGTTAGTTAGCTGCAGGTACTAACAGCACTAACAGAGAACTAGATATTTACCCTGGGGGTTTACATTGAGGGCGGGCGCTCCACCCACACTCATCCAGGAGGCAGTCAAAAGGAGTCAAAACAATGATCGGGACATTTGCTGATGCAAGTAACCGAACCGGTCTGCCATCGGAATCTTTGATCTGCACGTAGGAGGTAGTAAAAATTCGATCGTTTGCTCTTACTTCGGACGTTCATGTTCGTAGGAGATAGTCACAATCTTCGTCCAAGGCAACCATGGCACGTTCTCCTCACAATGGAAGCCGCGCTCACGATTCCCTCTTCTCATCTGCTTCTCCTCTTTCGCCTTGTGCAGCGATATCAAATGGCCCTTGTACCCTACTGTGCATCAGCAATGCACGACGTTACGGACAGATGCATTTATGCATGCTTGCTTTGAGGGAGGGGTGAGGCTTAGCAGCATCTCGAGCTTACTGTATTCTGGCTTCGTCCAGTTATTTTCAACTGAATCTCGACACTCTGGTTGTAAATGGACAATACTGAGGCAACTGGGATGCAATTGATTGAAGTATGGGCGTGACGTAATTTGTCCGATTTTCGTTCCACTAATCGTCTCCGGACGTACGTGTTATGAGAGCAAAGGTTTCATCGAGCAACTGACTATAGGGATCGTACAAAGTGCTTTGGAAGTCTTAAGATGGAGGTGCGTTGAGCCGACATTACACTTAAGTTGTTGTCTGAAATCCTCGTTGATTCTGCCCTCAAACTGTTCAGTCTCTAGCGGAGACAAGCTTCTTTGGTTACGAAACTGTTCAATTACGACAATGTCTGTGGAAGTATGAAGATCTGTTTTCTGTCTGAGCGATCATCAGAGTCGTGAAATTTCAGAGAGATGGTCTCGCTTCCTTCTCATTTTCGTCGATCAGAAGCGCTCGTAAGATCGATAACAGCTTGGATTTCATGTGCAGAAACCTGAGCTAAAAGACGATAAAGGTAAAGATCAAGAAGAGAATGATGAAGCCAAGAACAAAAGACCCAGGGATTTAAGGATTCCTCTGTTGAATCTAGAACGTGCAAGAGAATATGTCCCTCCCGCGAGTCCCACTGAAAAGACTGCATCCGACAGTGAGATGCTTATCATCAGCGAGCTTCCAAATATTGGGCAGCCAGATTTCTCATTTAGCCCCGTTCTAGAGAGAGAGGTGAGAGATCCATCATGACATTGAACACGAAATCTGCAGTATTTTCTTATGAATGAAAGAATGTATCAATGCCCAAGTTTTCCTACACCTTTAAAGATCATGGGATAAACAACTTACACGAAGCTCAGTGAGTTGCTTCGTGGAGATGCTCAATTGGGAGAAGTACGGTAGCAAGAAATAACATGAATGAGTTGTTATATCGCACGTCCGAACCTTGGCGTAACACACTTGTAGACTCCCGAAATTACGAGTTTTCGCAAATCTGAACGCGACCTTGCCCCAACGTTATGTTGTCAATCTTCAGTGACACTGACGGTAAACATCGGGCTATGGTGTTTGATGCTGAGCCGGTCGTGGATAGGACTTTTAGAGACCCCGGCACTGTTGATAGTCCTCAATTAGTTGCAGAAATCATTCGCATGCAGAGAGAAAGCTCTATCTGGAAACGTAGCGACTTTCCTCTTCTACTAGGTAGAGGAAAATTGCGACAATGTCGATCTTGGATGAATGCAACTGTTCTTTAAAGCTGAGACTTACAGTCAGCTATTTGGTTGGGAAGGATCAGCGAGTGCTGCCAATTAACTGTTAGGTTTATTGCCTGGCCATCTGCATCCAAAGATTCTCATTTGTGGCTGATGAAGAGACTTCCATTGACTTCAGGACTCACCGAAACTCAAGGCACCGTCTGCCTTGAGTGATGAAGCTGTGCAGCAAGTTCTGCAGGGAATTAACTCGTGGACTTTCGATATTTTTCAACTCGATGATGACAGTCTGCCTAAGGCAAATCTCTTCTTTCTGAAACTGGAATCAATTTCACTCGGATTACGGCCCTAATTGTCAATAGGAGTTTGCAAAAACAGATGCATGGAATCTTCTTCAGAAGCAAGTGTCATTTCTAATGCTAGCTTGATATGAAAGCTAATCGGTTCTCTTAATGACGCGACAATATTGCTACTAATTGACGAGCCTGACCTTCAGGACTTACTCTTCCAATACTTCTGACTTTTCGTATCAAATTGCATGCAGATGGTGGAAAAAATCTTCCGCGAGCTTGGTCTCTTTGATAACTTCCCGTTAGATGTTAAAAAAGTTCGAGCATTCACGAATGCGGTGAGTAGAAAAACTTTCACATTTTTTAAGCTAAATCAGACACATAACATGACAGATAAGAAGCGGCCGTAAGTGGCCCATAGACTTGTTGGCCAGCAAAGAGCACATCTTCTCGCTTCTTTACTTCGTAGGACCAGAGTACACTATAAAGATGTCAATCCTTGATATGCAGTACTGAGCCACACTCGACCTCGTGTTCTGATAATTCTAGTGTCACCCAAAAGTCCGAGAAAAAGCCTTATTCACAGAAATGTACGGTTCTATATGGAGCATCTTGAGAAAAATCGAAGGATTTAGGGTGGTAGCATATCTACTTTTGCATCAATTGCTGTGGTATGCTAACCATAACTGACGATAGGAAGAAGCTACTCTGCAAAGTTGAAACTTCCAGACAATTTTTTCAACATGAAGTCACGTCTATGCAGATGGTAATGCGGTATCAGCCTAATCCGTATCACAATTTTCGACATGCTTGTGACGTGTTGCATGCTGTGTAAGTACGAGAACTCTGTAGACTTGAGAAATTGCAGTGCTGCCATTGTTTTAGTTTTTCGGGAAAATCGTGCTCTGGCTGAATGAACTTTCAGATTCACTGTAGAGGAGGTTTTCCTTCAGAAACAAATATCTATTATCATGATGAGAAATCAAGTGAAACGTCGTGCGAGCGTTGCTAAATTTTTCGCAACTGAACGCAGGTATCTTATACTGACTTTGGTAGATGGAAGGAAAAAACTTTCACATTTGGAAGTATTTGCCTTGGCTCTTGCTGCTCTTTGCCACGATGTAGATCATCCCGGTCTTACAAATGCATTCCTTGTGGCAACATACGACCCCTTGGCCCTTCGCTACAATGACAGAGCCGTCTTAGAGAGCCATCATGCTGCTACATGTTTTATAACCATGCGGGTTTGTGTCCATGACCTCAAGCTCACCGAATTGCAACGTTCTAAGAAATATTTGCATTACCTACGTAGCTGTAGATAATAGAGAGCTCCATTGTGTCCTTCCTTGCTGTAAGTACCAAGCATATCTGGTTCCTGTTGACGTTTTTAGAGGTTCTATTTCGTATAGTATCTACTCCAACGCGCTCGTTGGTTCAATCATAAACTGCCTTAGCCTCTGATTATGTGTTGTATACTGCCTTCCAAACAAGACCTTGGCAATCATCTTCTGAGAACAATCCACCAATACATAAAGAAATTAACTTATCTTCTCTGACGCTTCAGAGGTTTTTCATTTCCGAGGTGGAAGTTTTAGAGTAGCTGTCGAAACTCTGAACCTAGTGACGTAATACTCTAAAGCTTCCGACTTGGAAAAGAAAAACTTTGCTCAGGTTGCTCACTAATGAGCAACCACTCTTTCCCAGATTCTTCGGCGCGTTGATGTTTCTGTATTTTCACAACTGTGTTGCTTTTGTAGGCAGGTCCCTTGAGGTTCAGAAGCTGTACTGGTCAGGAAGTCTAGATTTCAAGGTCATTGATTTTACTTGGCATCTACTGTTGTGGACTCAAGTGATCCATTGCAGGGTAATGACTCGTTGAATCTACTTGCTGGACTTAGTGAAGAGGAGCAGAGACACATGCGGAAGCTTATGATCGTCTTAATTCTTGCAACTGATATGGGAGAACATGCTCGAATTTTGCGCGAAGTGGGTGAAAGAGTTCAAGACCTTCGCCCTTTTGAACAATCTCCATTTTATACCCCTCCAGGATGTTTATCTCCAATCTTAAGAGATGCTGAAAGCTCCTCTTCAGGGAATACTACTGCAGGAGCGAAATCGTCTGACGCACCTCCATCGCCGAAACGGCTCCCAGACAAAGTGTATAAGAATCCGCTATCACCTTCACCACCTATCCAAAGCACAAGCGACGTCATGCTACTCATACAGCTAATTATCAAATGTGCGGATATTAGCAATGTCGTGAAGCCATTCTTTTTGTCAAAAAGGTGGGCCGCGTTGCTTTTGCTCGAATGGTTCAGACAGGGAGAGATTGAAAAGCAACTGGGTCTGCCTATCTCCAAGTTTATGGATAGAGAAGATCCCTCAACTCTCATGTGAGTAATGTTTACATCTCATGCCAAGTTTCACATACAGCACTTTTATCATCACTAACAGAGAACTATGATCTGCCAGTATAAGTAGAAACATAACACTCCCGTTTTGACTTTAATGATCGCAAAACATTTTATCGGAACCCGGAACTCGGGAACCCTGAAATTCACCATATAGAAGCGGTGCATAGATATCACTTCAAGATGATTTTTCTCCAACCATGGCAGGTCTTGTGGACTCTCTTGCATTTACCTTTTTCTGGAATAATACTCTTGATGTTGTGCTTCAATGTAGCACTCCCCACGTCGAGCCAATGTCCAACTCGAATCTACCAAGATTGCTATCATCACCTCCACATCTGACAGCTCGCAAGTGTGATTAGAAATAAGATGTGTTCTTTGACCCCGTCATTTTCTTCATTGAACATTAAAATATACAGTTTCCAGGATGTAATTCCAGGCTCAGCTTTGAGTCTCACACACAAGTCCGAAACCCTTACCAATTGGGCCGGTGACTGATCAGCCACAAAATAAAATGACTAGTTACCTCTCATAAATAATAGTCACTTTACACTTCACTGAGTCGCTCTGCTGTGGTGGAGCTCTCAGGTTGATTCGCAAATCAAATCTCTGAAGGTCTCTGCCACTTCATACTCTTGTCTAAATTTTTAAGCTTAGTCTATGTTCTCTTGACCCTAACCTTTTCTCAGTTGCGCACATGTGATTGAAGGGCTATGACTTGTGGATGCATCGACTATATTGCGAAGCCCATGTATGAAGTGATGACAAAACTTTTGCCACGAATGCACGAAAACGTTCTAGTCAATTTAAACCTCAACCGGCAGATGTGGAGTACATTCAGTACCAATGGCCGCCGAGCCTCCGAAGTAGGTTTCCAATACTCTTGCTTCAATGACGAAGCTTCTTCATTCACTTTTATAATTCGTTGGAACAGGATAACATCGCTGGCTGGTTGGTACAAATAAACTTGTGCACTTGCCAAGCGGATACCAAGTATTCCTCAGGGTCATGAAGTTCTTTAGAACTGTCTAGGCTGCCTTAAGGTGTTTGTTCTTTGGATCGATCGATGTTCCTTAGATTCGGAATTTATAGTTTTCTCTGCGTGTAGAAATAATCTTGCACGCCTGTGAGCAAAGAGTCTGCTACATTACAAACACTTCGTTTCATCTCAAAAATTCTACTCTGTTCATCGTTTTATTAGGGAATTTGGATAGACTTCAATCTGTGACACATTCCCTTTTATCTATATAGTACATAGATAGTAGATCCAAGAATTTCATAGCCACTTCACAGTTTTCACTAAGAATATATCTTTGGGCCCTGAAACTTCAAAGTTCTTATCAGTTTCTCTATAGCATGTTTCCTGCTTGTGTGAGCGTGTGAGATCCTCATCGTCCTTGGAAGAATTTCCAATACACTGATTCGAAAAAAGCTATAGATATTTTGAAACTCCCAGTCATCAAAAGCCATTAACAGTGGAACCTGTGGTTCGAGCAGACAGCACAGCAGATTCTTGGTCCCTTTGCACCTCCACCTATTCCTAAGGGAGAAGCGGTTCAAGAAGGATATCAACAAGATCATTCTAAGTTGGAGGGAAAGTTGGTCGCAACATTTAGCGGACAATATGTATCTTCAGATGTACCATCCAGGAAGCTAGAGAGTTCACCTTCTGCTAAGTCCTTGGGAAGTGTGTCGGAGGACTCAGAGGAAACTGTGGAGAACGTGGAGGATAGCCCGATACTTTCTGTCACTGATCGAAGCTCGGAGTTCTCTAGATTAGGGAGTGAAGCAGGATCGTCAGTGAAAACTAGCCCGCAGTTTTTAAGTAGAGCTGGTACAGAAGCTCCAAGTAGTCCACAGTCCCCTCTACAGGCATCACAGGAGCAAAGAGGCTCACCATCGCCTGGCGTTCAGTATAGGCTCTCTCCAAGAGGGCCAGGATCTCCTAGTGTGCCGGTGACTCAAATATCAGGAAATCCAGAGTCTCCCGGTTATAGAGAAACTTATGGGCCTGGCGGTTCACAACCTGCTGCTATGGAAGTGCCTTTCGTACAGAAAAGCCCACACGAGCCCGTTGCGGTAGACGTAGATGTGGCTGCCAGCCAACAATCCGCTGATGTTATTGCGCCTCTGAGTAAACCACAAGCTCTTCAGGTGAAACAGCCAGTAGTCCCAACTGTTTCTCGCGGTGTACATTTTGACGACTCAGAGTTGACAGCGTCAGAGCGCTCTGAACTGAGTTCGTCGATACAGTCTGGCAGCTCACCAGACTTGGCTTTGAGAGTGTCATTTGTGGCGATCAACCCAGACTCTGATTCTGTAAAGGTATTGATAGAACAAAGTGATCCACTATCCACTGCTACCATCGAACAAAGAGATCCAGACAGTCCAAGAATGACCGGTTTAGAACCATTCCTGGAAGAGGTGGCAGCGTCATCATCTGAATCTAAGGCTGAACCCGAGACGGAGGACGAATATAATCAACGCTATGAAGCACCCCTGAGCCTCCTATTTGGAGCGCCAACTAGAGAAGAGTTGATGCTTCCTGCAAAGATTGGAAAAGATAAAAATGCTTCATTGGTATCCGCTCTCCTTCCAGGTGCCAACAACCTTGTCAATGATCGGAAACAAAATGCATGGGAACAGATGGCGTTCAGATCTCCTTCAGAACAGGCAGCGTCCCGGGGATCTATCTTAACAACCGTACCGTCCTTCGCCAATTCTGATGGAGATCTAGAGAAGTCATCGTCACTTCGGAAAGGACCTCCTCCGGGCTTCTGGGAGGCCCTAAGGACACATCCCAGAGTAAATCGGCTGAATCGAGCCTTGGAGAGTAAAACCTGGAACGCGCTGCTTATTGTGGCAACATTAGTAGCTCTATTCGCTGATGATGTTGTGAAAGGGTTTTTGCCCAAACACGCGGACGTCTATGAGTCACACATCCTAACGGCTTGTTTGAGTCTCTTCTTGGCTGAGTCGGCACTCTTGTGTATCTTCCGCGATCGATACTTCTTCAGCTTCTTCTTCTGGTAGGTATGTACACAACCTGCGCTAACAGGTCAAAGATAGACAAGATGAAAAAGAACTCGATGAAAGTGAGATGAATTTTATTAGGCTCTCTTTTTCTCCAGAGATTCTGATATGTGAAGTCTTGTCATACTCTTCTATACTATCACAACCTGCAGCACCATTTTGATGCACGCAGGTTAGATATGTTGGGGAGTGTGTCGCTCGTTCCCCTTGTTATCGGGATCACTGCACAGAATCTTGTGATAGCGAGGACTGGACGCGCAGCCAAAACGGTGACAAGGTTTAGCAAGACGTTGCAAGCTTCACACATTCAGCAACAAATAGTACACCATATTCCTGTGCTTCGTGTATTTAAGGTGATTACGGCCATAGCTGAGCTCTTCCTTTATCACAGCTATGCTATAATGAGAGAGGTCCCCTTTTCGATGTGAAAGTGTATATGTTGTCAGGTAAAGGTTGTGACTACGTATCAATATATGGAAATTTTACTCAACACTTCTTTATAATGTAATATGAAGACTTATCTCAAGGGTTGTGATGTTTTATTTGTGTGTTCAGTTCTTTGGCTTTAAGAGAGATTCCACACTCGAGAGTCCCGATTACGAGGAGGAAGAAAAGTTTTTGTCGAAACCCAGTCAATTGTGGTCGAGGCTAGCAGAATTGACCAGTCAGAAGCTCATCCTTGGAGTACTGATTATAATGATTCTCACTCCATATTTCAACAACAGCGAGAAGGATCTTGCACCTCTTGTGTCACTCGACCCTCTTGATGACTATCTAATAGGATCACCAAATTTCAATTTGACTGTAGAGCGCGTGATAAACATGACGAAAAGACATGGATACAATCTGCTGTACTTAGGTGTGAAAGCAAGTTGCCGCTCTATTAAAGAGGGTGGTTACAGTTACTGTCTTGGGATAGACGTAGCGGGAGTGGAAAAATACCAGCAGATCCTCCCCAATGTAGATGAGGAACCAGATGGGAGACAAGCGGCTCAGGAGGAGTTCAGACCTACGGAATTAATCTCCGTCACTAGCGATAGCTCTCGTGCGCAGGCTTATTACTCCATAAAGAAGAAAAGCAGGTTTAAATATGGTATGAACGTAAGTTCTGACTGTTGCTTGCTGGCCTTTCATTGTGCTCGTTGTAAGCACTCAAGGTCATGTATAACTGCCCGTCATTAAGCAGAATCTTGAGAAAATTAGAGTTTGGCTACCAGTGTTACATAACTTTTCGTTCAAAACAGGATCGATTCCTCCGATGAGCTCTGATCCGTTGGTCTTCCGTTTGTCCAGATTGCCATGACTGTACTTATTCTTCTCTTGCTTGCGGCCTGGTGCTTCTTTTTAAGTCGAGACTCAAACAGGTTACTGATTCAGGTAAATGATCAACCTCCGTCTCGTCATGGTCAACAGTACTCCGATGGTTCAATTGAAAGACTCGCATCAAACATGACGGAAAATGAGTCATGTTCCAGACAATAGACGAGAATAGTCCTCATAAAAATTTCTATGAACGGTTCACGCATATATTCGGTGTTTACGATTCACTTGAGTACTACAAGCTTTCTCTCTTATCAAGACTGGTTGTCGCAACTAATTCAATAAGAGACCTCGAACGAATTGAAGTACATTAAATTGTTGTGAACTTAAGCTATATCAGGAATTCTTCAGATGTTTCATTCGACTAGCCTTCCCGCTACTTCATCATCTCTGCAAGGTGAGTAACCTTCAGTTAATAACTCGATGTGAAATCTGTTGACTTTAGCCTATTGAGCGCATGGTCCAATTTGTGAAAGAGCTCGCAGAAGACCCAGTATCTTTCGCAGGAAAGACTGTAGTGAAGCCAACAGGGGACTCAAGCAAGGTATCATCCATCATCATATTGACCTCTTTCATAGCTCTGTTGGCACTTCTCCACCATTTTGTCCCTATGTTTCTTCTACATCACTAAAATCCAGATTTCAAATATTGATCGAGTATTCTGAGCTTTTGATAAACCTCTGACTCAAAGTTTTCAATGTTTTATCCACTGGATTTTCTTCGGTATCTTCGGATTCTTCTCGTCGTGTCCATGATAACGAAATATTTGACGCTTTGCCGCTGTACTCGTACAAGTGATCACCAGAGCTCCCATAGTTGATCATATTATCGACTCCTTCGAAGTGAATATAAGTCGCTTCTCTGAAGTGATTTGGAGCCCAGCTTCTGACAATTTGGGATGATGACAGTTTGACATCATTTTACCTTTGTCCAGTTGTGATATACATGTTCTGATATAAGAGGAACAGATACTCATTCTAACCATGCATTATACAGAGTTTTAATTTCGAATATTCGAGATCGACGGTCACTTGAGGTTTTGTTAGGCATTGTTAGATTCGATCAGTGGATATTTACATGAATGGTAGCGCCTAATAATGAGCCTTCCCGTTCATTGGTAGATTGCCCTGTTTCTATTTAGCTGTTGACGCGTGATAACATTCTTTGTTTCTGTACTTGTTATATATGATGGTTATATGATAGGGTTGTGTCAATGGAAACAAAACGCGTCTTCGTGGTAAGTTTTAAAGTAGCTCTTCAAAGAGTTTCCACGGATGAAAACGTGACCATTGATTGTGCCTGTTATTGTGCAGATTATGGAAACATTCTATGTTGAGGCTGCTCTTGTTAAAATTGCTAGTTTGACAAAAGTGGCCCTTGGCGATGCCGGAATGGACATACTTTCTGTAAATCTGAAAGGGTCTGAGTTCAACCGTAAGTTTGGAGTGAGCTTCGGAGTCGAAACAGAATACAATATGTTTGACTTCGTGTTTGTGAATGATTTCGTACTTTTACAAAGTGATTTCAAAGTCGAAAGGAACAAGGATACATTCTTTCTTAGTACTTATCAAGGCTGTTCCGGATCATGGTGACCTTAACCAATAAGCTCAAATATCGATCAGAATTTGCTTGTATTGAGTTCACTCAGTGTTCTCTACGCCTCACTGCACTAGTGTCCACTCCCACGTTCTTTTTGCAACTAACGTCACGGTCATTTCAATTCTACCTTTACCCTGGTTAGAATTTGGGTTGGTTTTCGCTATACTAGCTTTCTACAGGTCAAAACTCTACATGCATATTCGCCCCGAGGAAGATGTGCAGCTATTAGAATGCACCTACATTTGATTCACTCATCTATGCAGCTCTACTGACCTTCATACATAGCTGCCTCATTGGTTTATTTTCTCGTCTTTCGACACAAGTGCCGCCTATATTCCGCTGGATCCAATAATTAGATTTTCTTTTCATTGTACTTCTGTCACAGCAATGCTTCCTGGGAAGAAGATTCGTGCATGTTTTGGATTCTGTGACATACGAAACTTCACAGATGCAACGGAGTGCCTTCAGGAGGACGTGATGATGTTTGTTAACCGTATTGCTGATGTGGTCCACAATAAGGTGGTCTTGCACTCGGGTTTTCCGAACAAAAACATCGGGGACGCATTTTTGATTGTGTGGAAGAAAACAGTTTCCGACAACACTAACAAGGTACGCAAGTACATTCTCAGCTGGTCAGATGTCATGAGTCACTTCGTAGAATGCTGGAGCGTGGAACTTGACTCATACATGTAACTTGCAGTCCAGGGCCACATCCTTTGCTGATCGTGCTCTTCGAGCTTTCCTTGACATCATACAATCGATCGAGACTTCTCAATCGTTGGCTGAATTTGCGAAGCACCCTGCTATTCAAAAGCGCATGCCAGGCAAGCTCCAAACCTTTGTATTCAAACGATTTTCTTGTGTAAGCTTAGACTATGTAGGTCCACCTATGGAAGGCATTTGGGTGGTGAGTACGTAACAGGCGGCAATTCATCTGCAGGATATCGAATTCACATGGGCTTTGGGCTACATGTTGGTTGGGCTATTGAAGGGGCAATCGGCTCTGCCCACAAGGTGGACCCATCTTACCTTTCTCCACACGTGAATATGGCATCTCGATTGGAGGCAGCGACAAAACAGTACGGGGTTATGCTGTTGATATCGGAAACCGTAATTGCTCACTTGACCAAGAGCACTCTACGTGACAGCTGCAGAAAATTAGACCGAGTGACTGTGAAGGGTAGTCAGGATCCTATGGTACTTTACACATTCGACATTCCGCTGTTTCAGCAAGATTTGAGAGGCAATCCCCAAGAGTATAGGGACATCTTCGAAGAAGCAGTGGACAGCTACATTGATGGAGATTGGGACATCGCGTTGGAGAGGCTTCAGGAGTGTCAAACCTTATGGCCTACAGATAAACCTGCAACCGTTCTGCTGACCTTCATGGCCAGTCACAACAATATAGCTCCTGAGAATTGGGCTGGTTTTCGAGAACTCACCGAGAAGTAGTAAGTTCAATGAGCTGTCATATCAGGCCATGATTTCTCAAGTAGTATACAAACACTTCAGATGTAATTTTGTTCAAGTGTTTCGTATTGTGCATTCCCTGCGTCATACTGATATCTACTCTTATGTGACTGTACGACTGACGAGTCCCAAAATTCCCTACGTTCTATGCACTGCGAACAGCTTCAGAATATATTTTGTTTCTTCCGTGGTAGATAAGAAATTTCCGAGTGAGGGGCTCCCGTACACACCATAACAAACCGCATGTGAAGGTC

mRNA

>Mapoly0068s0004.1
GTAAATCTGTTGTGCACCATATGGTTACAGCAGTTGTAGAACTTTCCTCATTGGTTTTTCCCCACCGCTGATGGTTAGGTCAATCTCAGCGCCAATGATACTTGCACCATGTGCAGGTATATTCACTCGGTTAATACAACAATATTTGTGTGGGGTTCCAGCTATACTTTTTGAGGACAATGGGTATGTTTTCAACAAGTACTAGGTCTGTGAAATAGTTCTGGGACCACAGGAATTCTGGTTTGAACTAAATCGGAACAATTGCTGTTTTTGCTGGAAGGATCAGCTTGACAATGAATGTTGCCGTTAGTTAGCTGCAGGTACTAACAGCACTAACAGAGAACTAGATATTTACCCTGGGGGTTTACATTGAGGGCGGGCGCTCCACCCACACTCATCCAGGAGGCAGTCAAAAGGAGTCAAAACAATGATCGGGACATTTGCTGATGCAAGTAACCGAACCGGTCTGCCATCGGAATCTTTGATCTGCACGTAGGAGGTAGTAAAAATTCGATCGTTTGCTCTTACTTCGGACGTTCATGTTCGTAGGAGATAGTCACAATCTTCGTCCAAGGCAACCATGGCACGTTCTCCTCACAATGGAAGCCGCGCTCACGATTCCCTCTTCTCATCTGCTTCTCCTCTTTCGCCTTGTGCAGCGATATCAAATGGCCCTTGTACCCTACTGTGCATCAGCAATGCACGACGTTACGGACAGATGCATTTATGCATGCTTGCTTTGAGGGAGGGGTGAGGCTTAGCAGCATCTCGAGCTTACTGTATTCTGGCTTCGTCCAGTTATTTTCAACTGAATCTCGACACTCTGGTTGTAAATGGACAATACTGAGGCAACTGGGATGCAATTGATTGAAGTATGGGCGTGACGTAATTTGTCCGATTTTCGTTCCACTAATCGTCTCCGGACGTACGTGTTATGAGAGCAAAGGTTTCATCGAGCAACTGACTATAGGGATCGTACAAAGTGCTTTGGAAGTCTTAAGATGGAGAAACCTGAGCTAAAAGACGATAAAGGTAAAGATCAAGAAGAGAATGATGAAGCCAAGAACAAAAGACCCAGGGATTTAAGGATTCCTCTGTTGAATCTAGAACGTGCAAGAGAATATGTCCCTCCCGCGAGTCCCACTGAAAAGACTGCATCCGACAGTGAGATGCTTATCATCAGCGAGCTTCCAAATATTGGGCAGCCAGATTTCTCATTTAGCCCCGTTCTAGAGAGAGAGGACTCACCGAAACTCAAGGCACCGTCTGCCTTGAGTGATGAAGCTGTGCAGCAAGTTCTGCAGGGAATTAACTCGTGGACTTTCGATATTTTTCAACTCGATGATGACAGTCTGCCTAAGATGGTGGAAAAAATCTTCCGCGAGCTTGGTCTCTTTGATAACTTCCCGTTAGATGTTAAAAAAGTTCGAGCATTCACGAATGCGATGGTAATGCGGTATCAGCCTAATCCGTATCACAATTTTCGACATGCTTGTGACGTGTTGCATGCTGTGTATCTTATACTGACTTTGGTAGATGGAAGGAAAAAACTTTCACATTTGGAAGTATTTGCCTTGGCTCTTGCTGCTCTTTGCCACGATGTAGATCATCCCGGTCTTACAAATGCATTCCTTGTGGCAACATACGACCCCTTGGCCCTTCGCTACAATGACAGAGCCGTCTTAGAGAGCCATCATGCTGCTACATGTTTTATAACCATGCGGGGTAATGACTCGTTGAATCTACTTGCTGGACTTAGTGAAGAGGAGCAGAGACACATGCGGAAGCTTATGATCGTCTTAATTCTTGCAACTGATATGGGAGAACATGCTCGAATTTTGCGCGAAGTGGGTGAAAGAGTTCAAGACCTTCGCCCTTTTGAACAATCTCCATTTTATACCCCTCCAGGATGTTTATCTCCAATCTTAAGAGATGCTGAAAGCTCCTCTTCAGGGAATACTACTGCAGGAGCGAAATCGTCTGACGCACCTCCATCGCCGAAACGGCTCCCAGACAAAGTGTATAAGAATCCGCTATCACCTTCACCACCTATCCAAAGCACAAGCGACGTCATGCTACTCATACAGCTAATTATCAAATGTGCGGATATTAGCAATGTCGTGAAGCCATTCTTTTTGTCAAAAAGGTGGGCCGCGTTGCTTTTGCTCGAATGGTTCAGACAGGGAGAGATTGAAAAGCAACTGGGTCTGCCTATCTCCAAGTTTATGGATAGAGAAGATCCCTCAACTCTCATGGCTATGACTTGTGGATGCATCGACTATATTGCGAAGCCCATGTATGAAGTGATGACAAAACTTTTGCCACGAATGCACGAAAACGTTCTAGTCAATTTAAACCTCAACCGGCAGATGTGGAGTACATTCAGTACCAATGGCCGCCGAGCCTCCGAAACAGCACAGCAGATTCTTGGTCCCTTTGCACCTCCACCTATTCCTAAGGGAGAAGCGGTTCAAGAAGGATATCAACAAGATCATTCTAAGTTGGAGGGAAAGTTGGTCGCAACATTTAGCGGACAATATGTATCTTCAGATGTACCATCCAGGAAGCTAGAGAGTTCACCTTCTGCTAAGTCCTTGGGAAGTGTGTCGGAGGACTCAGAGGAAACTGTGGAGAACGTGGAGGATAGCCCGATACTTTCTGTCACTGATCGAAGCTCGGAGTTCTCTAGATTAGGGAGTGAAGCAGGATCGTCAGTGAAAACTAGCCCGCAGTTTTTAAGTAGAGCTGGTACAGAAGCTCCAAGTAGTCCACAGTCCCCTCTACAGGCATCACAGGAGCAAAGAGGCTCACCATCGCCTGGCGTTCAGTATAGGCTCTCTCCAAGAGGGCCAGGATCTCCTAGTGTGCCGGTGACTCAAATATCAGGAAATCCAGAGTCTCCCGGTTATAGAGAAACTTATGGGCCTGGCGGTTCACAACCTGCTGCTATGGAAGTGCCTTTCGTACAGAAAAGCCCACACGAGCCCGTTGCGGTAGACGTAGATGTGGCTGCCAGCCAACAATCCGCTGATGTTATTGCGCCTCTGAGTAAACCACAAGCTCTTCAGGTGAAACAGCCAGTAGTCCCAACTGTTTCTCGCGGTGTACATTTTGACGACTCAGAGTTGACAGCGTCAGAGCGCTCTGAACTGAGTTCGTCGATACAGTCTGGCAGCTCACCAGACTTGGCTTTGAGAGTGTCATTTGTGGCGATCAACCCAGACTCTGATTCTGTAAAGGTATTGATAGAACAAAGTGATCCACTATCCACTGCTACCATCGAACAAAGAGATCCAGACAGTCCAAGAATGACCGGTTTAGAACCATTCCTGGAAGAGGTGGCAGCGTCATCATCTGAATCTAAGGCTGAACCCGAGACGGAGGACGAATATAATCAACGCTATGAAGCACCCCTGAGCCTCCTATTTGGAGCGCCAACTAGAGAAGAGTTGATGCTTCCTGCAAAGATTGGAAAAGATAAAAATGCTTCATTGGTATCCGCTCTCCTTCCAGGTGCCAACAACCTTGTCAATGATCGGAAACAAAATGCATGGGAACAGATGGCGTTCAGATCTCCTTCAGAACAGGCAGCGTCCCGGGGATCTATCTTAACAACCGTACCGTCCTTCGCCAATTCTGATGGAGATCTAGAGAAGTCATCGTCACTTCGGAAAGGACCTCCTCCGGGCTTCTGGGAGGCCCTAAGGACACATCCCAGAGTAAATCGGCTGAATCGAGCCTTGGAGAGTAAAACCTGGAACGCGCTGCTTATTGTGGCAACATTAGTAGCTCTATTCGCTGATGATGTTGTGAAAGGGTTTTTGCCCAAACACGCGGACGTCTATGAGTCACACATCCTAACGGCTTGTTTGAGTCTCTTCTTGGCTGAGTCGGCACTCTTGTGTATCTTCCGCGATCGATACTTCTTCAGCTTCTTCTTCTGGTTAGATATGTTGGGGAGTGTGTCGCTCGTTCCCCTTGTTATCGGGATCACTGCACAGAATCTTGTGATAGCGAGGACTGGACGCGCAGCCAAAACGGTGACAAGGTTTAGCAAGACGTTGCAAGCTTCACACATTCAGCAACAAATAGTACACCATATTCCTGTGCTTCGTGTATTTAAGTTCTTTGGCTTTAAGAGAGATTCCACACTCGAGAGTCCCGATTACGAGGAGGAAGAAAAGTTTTTGTCGAAACCCAGTCAATTGTGGTCGAGGCTAGCAGAATTGACCAGTCAGAAGCTCATCCTTGGAGTACTGATTATAATGATTCTCACTCCATATTTCAACAACAGCGAGAAGGATCTTGCACCTCTTGTGTCACTCGACCCTCTTGATGACTATCTAATAGGATCACCAAATTTCAATTTGACTGTAGAGCGCGTGATAAACATGACGAAAAGACATGGATACAATCTGCTGTACTTAGGTGTGAAAGCAAGTTGCCGCTCTATTAAAGAGGGTGGTTACAGTTACTGTCTTGGGATAGACGTAGCGGGAGTGGAAAAATACCAGCAGATCCTCCCCAATGTAGATGAGGAACCAGATGGGAGACAAGCGGCTCAGGAGGAGTTCAGACCTACGGAATTAATCTCCGTCACTAGCGATAGCTCTCGTGCGCAGGCTTATTACTCCATAAAGAAGAAAAGCAGGTTTAAATATGGTATGAACATTGCCATGACTGTACTTATTCTTCTCTTGCTTGCGGCCTGGTGCTTCTTTTTAAGTCGAGACTCAAACAGGTTACTGATTCAGCCTATTGAGCGCATGGTCCAATTTGTGAAAGAGCTCGCAGAAGACCCAGTATCTTTCGCAGGAAAGACTGTAGTGAAGCCAACAGGGGACTCAAGCAAGATTATGGAAACATTCTATGTTGAGGCTGCTCTTGTTAAAATTGCTAGTTTGACAAAAGTGGCCCTTGGCGATGCCGGAATGGACATACTTTCTGTAAATCTGAAAGGGTCTGAGTTCAACCCAATGCTTCCTGGGAAGAAGATTCGTGCATGTTTTGGATTCTGTGACATACGAAACTTCACAGATGCAACGGAGTGCCTTCAGGAGGACGTGATGATGTTTGTTAACCGTATTGCTGATGTGGTCCACAATAAGGTGGTCTTGCACTCGGGTTTTCCGAACAAAAACATCGGGGACGCATTTTTGATTGTGTGGAAGAAAACAGTTTCCGACAACACTAACAAGTCCAGGGCCACATCCTTTGCTGATCGTGCTCTTCGAGCTTTCCTTGACATCATACAATCGATCGAGACTTCTCAATCGTTGGCTGAATTTGCGAAGCACCCTGCTATTCAAAAGCGCATGCCAGGATATCGAATTCACATGGGCTTTGGGCTACATGTTGGTTGGGCTATTGAAGGGGCAATCGGCTCTGCCCACAAGGTGGACCCATCTTACCTTTCTCCACACGTGAATATGGCATCTCGATTGGAGGCAGCGACAAAACAGTACGGGGTTATGCTGTTGATATCGGAAACCGTAATTGCTCACTTGACCAAGAGCACTCTACGTGACAGCTGCAGAAAATTAGACCGAGTGACTGTGAAGGGTAGTCAGGATCCTATGGTACTTTACACATTCGACATTCCGCTGTTTCAGCAAGATTTGAGAGGCAATCCCCAAGAGTATAGGGACATCTTCGAAGAAGCAGTGGACAGCTACATTGATGGAGATTGGGACATCGCGTTGGAGAGGCTTCAGGAGTGTCAAACCTTATGGCCTACAGATAAACCTGCAACCGTTCTGCTGACCTTCATGGCCAGTCACAACAATATAGCTCCTGAGAATTGGGCTGGTTTTCGAGAACTCACCGAGAAGTAGTAAGTTCAATGAGCTGTCATATCAGGCCATGATTTCTCAAGTAGTATACAAACACTTCAGATGTAATTTTGTTCAAGTGTTTCGTATTGTGCATTCCCTGCGTCATACTGATATCTACTCTTATGTGACTGTACGACTGACGAGTCCCAAAATTCCCTACGTTCTATGCACTGCGAACAGCTTCAGAATATATTTTGTTTCTTCCGTGGTAGATAAGAAATTTCCGAGTGAGGGGCTCCCGTACACACCATAACAAACCGCATGTGAAGGTC

CDS

>Mapoly0068s0004.1
ATGGAGAAACCTGAGCTAAAAGACGATAAAGGTAAAGATCAAGAAGAGAATGATGAAGCCAAGAACAAAAGACCCAGGGATTTAAGGATTCCTCTGTTGAATCTAGAACGTGCAAGAGAATATGTCCCTCCCGCGAGTCCCACTGAAAAGACTGCATCCGACAGTGAGATGCTTATCATCAGCGAGCTTCCAAATATTGGGCAGCCAGATTTCTCATTTAGCCCCGTTCTAGAGAGAGAGGACTCACCGAAACTCAAGGCACCGTCTGCCTTGAGTGATGAAGCTGTGCAGCAAGTTCTGCAGGGAATTAACTCGTGGACTTTCGATATTTTTCAACTCGATGATGACAGTCTGCCTAAGATGGTGGAAAAAATCTTCCGCGAGCTTGGTCTCTTTGATAACTTCCCGTTAGATGTTAAAAAAGTTCGAGCATTCACGAATGCGATGGTAATGCGGTATCAGCCTAATCCGTATCACAATTTTCGACATGCTTGTGACGTGTTGCATGCTGTGTATCTTATACTGACTTTGGTAGATGGAAGGAAAAAACTTTCACATTTGGAAGTATTTGCCTTGGCTCTTGCTGCTCTTTGCCACGATGTAGATCATCCCGGTCTTACAAATGCATTCCTTGTGGCAACATACGACCCCTTGGCCCTTCGCTACAATGACAGAGCCGTCTTAGAGAGCCATCATGCTGCTACATGTTTTATAACCATGCGGGGTAATGACTCGTTGAATCTACTTGCTGGACTTAGTGAAGAGGAGCAGAGACACATGCGGAAGCTTATGATCGTCTTAATTCTTGCAACTGATATGGGAGAACATGCTCGAATTTTGCGCGAAGTGGGTGAAAGAGTTCAAGACCTTCGCCCTTTTGAACAATCTCCATTTTATACCCCTCCAGGATGTTTATCTCCAATCTTAAGAGATGCTGAAAGCTCCTCTTCAGGGAATACTACTGCAGGAGCGAAATCGTCTGACGCACCTCCATCGCCGAAACGGCTCCCAGACAAAGTGTATAAGAATCCGCTATCACCTTCACCACCTATCCAAAGCACAAGCGACGTCATGCTACTCATACAGCTAATTATCAAATGTGCGGATATTAGCAATGTCGTGAAGCCATTCTTTTTGTCAAAAAGGTGGGCCGCGTTGCTTTTGCTCGAATGGTTCAGACAGGGAGAGATTGAAAAGCAACTGGGTCTGCCTATCTCCAAGTTTATGGATAGAGAAGATCCCTCAACTCTCATGGCTATGACTTGTGGATGCATCGACTATATTGCGAAGCCCATGTATGAAGTGATGACAAAACTTTTGCCACGAATGCACGAAAACGTTCTAGTCAATTTAAACCTCAACCGGCAGATGTGGAGTACATTCAGTACCAATGGCCGCCGAGCCTCCGAAACAGCACAGCAGATTCTTGGTCCCTTTGCACCTCCACCTATTCCTAAGGGAGAAGCGGTTCAAGAAGGATATCAACAAGATCATTCTAAGTTGGAGGGAAAGTTGGTCGCAACATTTAGCGGACAATATGTATCTTCAGATGTACCATCCAGGAAGCTAGAGAGTTCACCTTCTGCTAAGTCCTTGGGAAGTGTGTCGGAGGACTCAGAGGAAACTGTGGAGAACGTGGAGGATAGCCCGATACTTTCTGTCACTGATCGAAGCTCGGAGTTCTCTAGATTAGGGAGTGAAGCAGGATCGTCAGTGAAAACTAGCCCGCAGTTTTTAAGTAGAGCTGGTACAGAAGCTCCAAGTAGTCCACAGTCCCCTCTACAGGCATCACAGGAGCAAAGAGGCTCACCATCGCCTGGCGTTCAGTATAGGCTCTCTCCAAGAGGGCCAGGATCTCCTAGTGTGCCGGTGACTCAAATATCAGGAAATCCAGAGTCTCCCGGTTATAGAGAAACTTATGGGCCTGGCGGTTCACAACCTGCTGCTATGGAAGTGCCTTTCGTACAGAAAAGCCCACACGAGCCCGTTGCGGTAGACGTAGATGTGGCTGCCAGCCAACAATCCGCTGATGTTATTGCGCCTCTGAGTAAACCACAAGCTCTTCAGGTGAAACAGCCAGTAGTCCCAACTGTTTCTCGCGGTGTACATTTTGACGACTCAGAGTTGACAGCGTCAGAGCGCTCTGAACTGAGTTCGTCGATACAGTCTGGCAGCTCACCAGACTTGGCTTTGAGAGTGTCATTTGTGGCGATCAACCCAGACTCTGATTCTGTAAAGGTATTGATAGAACAAAGTGATCCACTATCCACTGCTACCATCGAACAAAGAGATCCAGACAGTCCAAGAATGACCGGTTTAGAACCATTCCTGGAAGAGGTGGCAGCGTCATCATCTGAATCTAAGGCTGAACCCGAGACGGAGGACGAATATAATCAACGCTATGAAGCACCCCTGAGCCTCCTATTTGGAGCGCCAACTAGAGAAGAGTTGATGCTTCCTGCAAAGATTGGAAAAGATAAAAATGCTTCATTGGTATCCGCTCTCCTTCCAGGTGCCAACAACCTTGTCAATGATCGGAAACAAAATGCATGGGAACAGATGGCGTTCAGATCTCCTTCAGAACAGGCAGCGTCCCGGGGATCTATCTTAACAACCGTACCGTCCTTCGCCAATTCTGATGGAGATCTAGAGAAGTCATCGTCACTTCGGAAAGGACCTCCTCCGGGCTTCTGGGAGGCCCTAAGGACACATCCCAGAGTAAATCGGCTGAATCGAGCCTTGGAGAGTAAAACCTGGAACGCGCTGCTTATTGTGGCAACATTAGTAGCTCTATTCGCTGATGATGTTGTGAAAGGGTTTTTGCCCAAACACGCGGACGTCTATGAGTCACACATCCTAACGGCTTGTTTGAGTCTCTTCTTGGCTGAGTCGGCACTCTTGTGTATCTTCCGCGATCGATACTTCTTCAGCTTCTTCTTCTGGTTAGATATGTTGGGGAGTGTGTCGCTCGTTCCCCTTGTTATCGGGATCACTGCACAGAATCTTGTGATAGCGAGGACTGGACGCGCAGCCAAAACGGTGACAAGGTTTAGCAAGACGTTGCAAGCTTCACACATTCAGCAACAAATAGTACACCATATTCCTGTGCTTCGTGTATTTAAGTTCTTTGGCTTTAAGAGAGATTCCACACTCGAGAGTCCCGATTACGAGGAGGAAGAAAAGTTTTTGTCGAAACCCAGTCAATTGTGGTCGAGGCTAGCAGAATTGACCAGTCAGAAGCTCATCCTTGGAGTACTGATTATAATGATTCTCACTCCATATTTCAACAACAGCGAGAAGGATCTTGCACCTCTTGTGTCACTCGACCCTCTTGATGACTATCTAATAGGATCACCAAATTTCAATTTGACTGTAGAGCGCGTGATAAACATGACGAAAAGACATGGATACAATCTGCTGTACTTAGGTGTGAAAGCAAGTTGCCGCTCTATTAAAGAGGGTGGTTACAGTTACTGTCTTGGGATAGACGTAGCGGGAGTGGAAAAATACCAGCAGATCCTCCCCAATGTAGATGAGGAACCAGATGGGAGACAAGCGGCTCAGGAGGAGTTCAGACCTACGGAATTAATCTCCGTCACTAGCGATAGCTCTCGTGCGCAGGCTTATTACTCCATAAAGAAGAAAAGCAGGTTTAAATATGGTATGAACATTGCCATGACTGTACTTATTCTTCTCTTGCTTGCGGCCTGGTGCTTCTTTTTAAGTCGAGACTCAAACAGGTTACTGATTCAGCCTATTGAGCGCATGGTCCAATTTGTGAAAGAGCTCGCAGAAGACCCAGTATCTTTCGCAGGAAAGACTGTAGTGAAGCCAACAGGGGACTCAAGCAAGATTATGGAAACATTCTATGTTGAGGCTGCTCTTGTTAAAATTGCTAGTTTGACAAAAGTGGCCCTTGGCGATGCCGGAATGGACATACTTTCTGTAAATCTGAAAGGGTCTGAGTTCAACCCAATGCTTCCTGGGAAGAAGATTCGTGCATGTTTTGGATTCTGTGACATACGAAACTTCACAGATGCAACGGAGTGCCTTCAGGAGGACGTGATGATGTTTGTTAACCGTATTGCTGATGTGGTCCACAATAAGGTGGTCTTGCACTCGGGTTTTCCGAACAAAAACATCGGGGACGCATTTTTGATTGTGTGGAAGAAAACAGTTTCCGACAACACTAACAAGTCCAGGGCCACATCCTTTGCTGATCGTGCTCTTCGAGCTTTCCTTGACATCATACAATCGATCGAGACTTCTCAATCGTTGGCTGAATTTGCGAAGCACCCTGCTATTCAAAAGCGCATGCCAGGATATCGAATTCACATGGGCTTTGGGCTACATGTTGGTTGGGCTATTGAAGGGGCAATCGGCTCTGCCCACAAGGTGGACCCATCTTACCTTTCTCCACACGTGAATATGGCATCTCGATTGGAGGCAGCGACAAAACAGTACGGGGTTATGCTGTTGATATCGGAAACCGTAATTGCTCACTTGACCAAGAGCACTCTACGTGACAGCTGCAGAAAATTAGACCGAGTGACTGTGAAGGGTAGTCAGGATCCTATGGTACTTTACACATTCGACATTCCGCTGTTTCAGCAAGATTTGAGAGGCAATCCCCAAGAGTATAGGGACATCTTCGAAGAAGCAGTGGACAGCTACATTGATGGAGATTGGGACATCGCGTTGGAGAGGCTTCAGGAGTGTCAAACCTTATGGCCTACAGATAAACCTGCAACCGTTCTGCTGACCTTCATGGCCAGTCACAACAATATAGCTCCTGAGAATTGGGCTGGTTTTCGAGAACTCACCGAGAAGTAG

Protein

>Mapoly0068s0004.1
MEKPELKDDKGKDQEENDEAKNKRPRDLRIPLLNLERAREYVPPASPTEKTASDSEMLIISELPNIGQPDFSFSPVLEREDSPKLKAPSALSDEAVQQVLQGINSWTFDIFQLDDDSLPKMVEKIFRELGLFDNFPLDVKKVRAFTNAMVMRYQPNPYHNFRHACDVLHAVYLILTLVDGRKKLSHLEVFALALAALCHDVDHPGLTNAFLVATYDPLALRYNDRAVLESHHAATCFITMRGNDSLNLLAGLSEEEQRHMRKLMIVLILATDMGEHARILREVGERVQDLRPFEQSPFYTPPGCLSPILRDAESSSSGNTTAGAKSSDAPPSPKRLPDKVYKNPLSPSPPIQSTSDVMLLIQLIIKCADISNVVKPFFLSKRWAALLLLEWFRQGEIEKQLGLPISKFMDREDPSTLMAMTCGCIDYIAKPMYEVMTKLLPRMHENVLVNLNLNRQMWSTFSTNGRRASETAQQILGPFAPPPIPKGEAVQEGYQQDHSKLEGKLVATFSGQYVSSDVPSRKLESSPSAKSLGSVSEDSEETVENVEDSPILSVTDRSSEFSRLGSEAGSSVKTSPQFLSRAGTEAPSSPQSPLQASQEQRGSPSPGVQYRLSPRGPGSPSVPVTQISGNPESPGYRETYGPGGSQPAAMEVPFVQKSPHEPVAVDVDVAASQQSADVIAPLSKPQALQVKQPVVPTVSRGVHFDDSELTASERSELSSSIQSGSSPDLALRVSFVAINPDSDSVKVLIEQSDPLSTATIEQRDPDSPRMTGLEPFLEEVAASSSESKAEPETEDEYNQRYEAPLSLLFGAPTREELMLPAKIGKDKNASLVSALLPGANNLVNDRKQNAWEQMAFRSPSEQAASRGSILTTVPSFANSDGDLEKSSSLRKGPPPGFWEALRTHPRVNRLNRALESKTWNALLIVATLVALFADDVVKGFLPKHADVYESHILTACLSLFLAESALLCIFRDRYFFSFFFWLDMLGSVSLVPLVIGITAQNLVIARTGRAAKTVTRFSKTLQASHIQQQIVHHIPVLRVFKFFGFKRDSTLESPDYEEEEKFLSKPSQLWSRLAELTSQKLILGVLIIMILTPYFNNSEKDLAPLVSLDPLDDYLIGSPNFNLTVERVINMTKRHGYNLLYLGVKASCRSIKEGGYSYCLGIDVAGVEKYQQILPNVDEEPDGRQAAQEEFRPTELISVTSDSSRAQAYYSIKKKSRFKYGMNIAMTVLILLLLAAWCFFLSRDSNRLLIQPIERMVQFVKELAEDPVSFAGKTVVKPTGDSSKIMETFYVEAALVKIASLTKVALGDAGMDILSVNLKGSEFNPMLPGKKIRACFGFCDIRNFTDATECLQEDVMMFVNRIADVVHNKVVLHSGFPNKNIGDAFLIVWKKTVSDNTNKSRATSFADRALRAFLDIIQSIETSQSLAEFAKHPAIQKRMPGYRIHMGFGLHVGWAIEGAIGSAHKVDPSYLSPHVNMASRLEAATKQYGVMLLISETVIAHLTKSTLRDSCRKLDRVTVKGSQDPMVLYTFDIPLFQQDLRGNPQEYRDIFEEAVDSYIDGDWDIALERLQECQTLWPTDKPATVLLTFMASHNNIAPENWAGFRELTEK

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>