Mapoly0068s0079



Description

TRANSCRIPTIONAL REPRESSOR PROTEIN YY

Reference DB

Database ID Description
OrthoMCL OG5_132824
PFAM PF13465 Zinc-finger double domain
PANTHER PTHR14003 TRANSCRIPTIONAL REPRESSOR PROTEIN YY
PANTHER PTHR14003:SF1 YY1-RELATED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC2H2-9 transcription factor, C2H2-ZnF Mapoly0068s0079.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0068s0079.1 scaffold_68:684594..691654  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0068s0079.2 scaffold_68:684594..691654  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0068s0079.1  

Gene structure:

mRNA scaffold_68:684594..691654  ( - strand )
three_prime_UTR scaffold_68:684594..684993  ( - strand )
CDS scaffold_68:684994..685947  ( - strand )
CDS scaffold_68:686283..686372  ( - strand )
CDS scaffold_68:686699..686823  ( - strand )
CDS scaffold_68:687452..687514  ( - strand )
CDS scaffold_68:687874..687999  ( - strand )
CDS scaffold_68:688210..688711  ( - strand )
five_prime_UTR scaffold_68:688712..689018  ( - strand )
five_prime_UTR scaffold_68:690985..691654  ( - strand )

Sequences:

Gene

>Mapoly0068s0079.1
CTGTTAACTTTACTCACCGAACGGCGCTGGCATGAGTAAGAACGAAAATCTGGATTGTAAGCCAGTTGGAGAGAGAGAACCCAGAGATGAGACGATAGAGCTCAATGAGCTGTTCGGTTGGGTCGGATGGACGACGAGACGAGGGTGAACCCGGTGAAGACATACAAAACACAGATTAATTATGAAGGTGAAGGGGTCACGTGAGCAAGGAAAGTGGGTAGAAAGCACGTGAGGTGGATTGTATGAGCGCTGTGTGTGATGGAGAAGAGTTTCATACACTTATCTCCTCGTCTATCCTGTCCAACGAAGGAAACTAATGGGAGAATACACTTTGGGATATCTGGGTAGAATCACCGAAGAGTGTAAGACAACACACGACATCGCATTCGTCTGGGGTTTATGAAATAGTGAAGTGAAGGACGATGTCCTTTCCGATCCGCATCAGCTGACGCCTCCCAAAGCTGAAAGGAACTTCTGTGTCTATTTCCTGTCTGTCCTGCCGTCGAACGAGAACTGATACAGATTCTGCTTCTGTGTACTATGGGTTTGCCTACACCAAATCCTCCAGGTTCGAAATAAGCTTCAGTCGCAGGCAGCCCTGCTGGAAGAGGCTGATTCTCCGTGGAGGTATCAGCCAACTTGGATGCAGTCTGTGCAAGCCTATCTCACGGTAAGATTTATGAAAAAATTGTGCACGAGTGAGCCAGTATCTCTCAAAAGTAGCAAGGAGATGACAAACTCACACTATCTCTGTTTCTTCTACCGATCTCTTATTTCTCCACTATTTACTAAACCAGAATCTAGCGGACATAGTGTGTGGGTCGTCATCCCTGCTTGTGTTTGTACAACATTCCAGCACTTCACTTCAATGCCGGTAGATTGTCGAAGCACGCCAATATAAGATGTCGCACTGTCATCGGACGAGTGCATCCGAAACTTTCAAAATAGGGCGGTAATAACTTATTGCATCTCTGAAATCTGCATACTACAGTCCGTTCATTTGCTGTGTTCGTGAGAAATTTTAATGTGGAAAACATTCACCTTCTGATTGGGCACAGCTAACATGCCACCGGTTTGCAGATTCGAGCATGTTCTGTGTATGTGGTCAAACGTCTAGGTGTACAAGTGCTCTGGGAGGAAGTAGGTAGTTCTCTCTGTGTGGGCTGCACCACGTACAATATGGATTTCAATAACTGTAGGTTCAGCTCAGCTTGAAGACGATTTAGACCAAGATCACGTATTTTGGAAGGGGACGCTTGTTTCTGCAAGCTACTGTGTTACCTACAACCTTGTGAAATGTCTTGTTTAGCGCACAGCCTACACCATGAAACGATTTTTTAGTATACATCTGGGTATTATTTATGCCTCTGGTCGATCGTTCAGACTTCTATCTGTTCATGAATTTCATGTTCATGACAGAATATTTACGTTGAAATTGAGGTACGAGATTGTGTCTCTCAACTGACTATGCCGGCATCAGAAGGGAATCTGGGTTGAACTAGCAGAAAAGTGTAAATTCCAACATCAGTTTCCGCATGTTTTCTTTTACTTAGATTATAATGAGCTCTTGATACTAGAGCAAGATGCGCTGTTCAATCGAGAGATTTGAGTCATTGAGTTTTGAAGACTGAAGACTGCCTGCCCTCTACATACAGAATTAAAATTTCTGGTTCATTGGGAATGATTTTTCGGTCTTGGACGTGACGTCGAAGGTAGTATAGCTTATCTCGCCTTCCCTCGACTACGGCATAGCATGTCAGATTTGGGGTTTGGTTTTGGTTTCGAAGAGGACTTTCTTGTCACCTTGAAACATGATGAATATCAAATTCGCAAAAGCGATTGGGTGACATGGTAGTCCTCAAATCGCTAGCAGAATCTGCGGGCCTCTTTTGCCGTTTGAGAGTACGTTACAGAGGAAATAGCACGGAATTGCGCACCAATACTCTGTTGTCGCGAACAAGCAATTTTTCGAATTTTCGGTAATATGGTTATTGGCTACGATAATATAATTGGTGTCTGACACCTAGACGTGAAGATGGAGTTTCTTACGAGATCAACTTTTACAATTCCTTGGGTTTAGCTGAAGTTAGTGAGAGATACATCCGGACGTGTCACTAGATTCGTTCATACGAGTCGTCAGTTTGTCTAAGGTTCGGTTCATTTTATTCCTAATGCGATTAGCCATTTTCATATTCCTGTTATCTGAACAGTATGATCTTTGTTCACGTGCAGTCAGCATGCATCACTGTTAATAATTAAGATATCGTTACTTTGACGACGTAAGGATAGCATTATGGCCGTTTTCGAGGGAGATCTCGCTCGAAGGACTATGATGGAAGCTCAGTTCTCTCCGAGAATAGTCGAAGGAGACTTACTAATTCTGAGAGATGTATGTTTAGGCTGTCGATAGGATCCAAGTTGGAGGTTTGAAACAAGTAGTGCAGACATTGGGTTCTGTCATTTAGTTTTATCTAAAAAGTGCCGAATAATGCTAATGAAATGTCACAAGCCTTGTCATTGTCCAGAGCTAGATAGAGAATGTCGTGGGTTGTTCCGATGGGAAGTACCCGGGCCGCTGAATTTTGAGAAACTCTTGAACGAGACAATCTCTCTAACGAACTACATGTGATGTGCAGGAGTAGGAATCTTGTCGATAGAAGGGCACTCTGGTATTGGAGCTGCCGGGAGTTATCGCGAAGACCAACTACCAGAATTGGTATTCCATCAGGAGAGTTCGTAGTCAGATGCTTGACATAATCCTGCGAAGTACTTCAGTGCTTGAGACTTCCAGAAACAGAAGATTTATGGACTATCACAAAACCTGCCCCGGAACTAGATAATCTGTATTATCTGACCACACCAGGATTTTAGTCTTCATCTATTGAGAGGAGCACCATTGCCCTTCACTCTGTGTTTACGGCTAAGTAAACGCTTGAACGTATAATGTCTCTCGCCGGACTAGGCGGGATGCCAAACTATGCGAAAACTGAACCAGTTGTATCAATGGATGATGAACCAAAAACTGTAGAAAAGAACTTAGCAACCTGCAAGGTTGAGGATATCAGTGTTTTGGAGAGTAAAGTAGGACATTCATCCTTCGGGAATGAAATAGATAGAACAGTGGAAGAAAAGAGGACAAGAATCTGCGTCGAGTCTAGAGGAGAAAGGAGGTTGCAAGTGAAGGTTGATGAAGGTGCAGCTTCTGGTGAGAGTGGACCAAGGAGCACTGGAGGAGGCCGAGAAAGATGTAGAGGTTGTGGAGTGAGAGAGGAACCGAGAAAGAATGAGCTCTGCGAGAGTTGTAAACAAGAGGGTTCCGGGAATTTCGAGGGGAAAGTCACAAGGTCAAGCACTCGAAGGCGACTGGGCGTCCAACCTGTCACACCACGTCTTGAAGAACCTCGTGCAGTGCGAGCCAATCGAGGAATGAAACGTCGTTTTCCTGGTATAATTCCCACCTCGAATGCTATTCACTCTCGTTCACTAGATTTGAGAATTATGATTAGTGAACGTTGCACGTCGAAAAGAATACGACTGTATTCTTGACCCCCTTGCATGCTCCATTTGTTCATTGTACACCTTTGACTAGTTTCTGCTATTCCTTTGACGAGCTCTATTGCCGCGGTTTAACTCATAGGAGGGACTGATCGTGAAGGTGCTGTTTCAGGGGACGAATCAGACGACAACTGCGACAAGCGGAAGCGAACTCGAGTTCGAAGCATATCCAAAGTTTGTGGACCCAACGCCCAGCAGCAGTCAGGCTCCGAAACATCTGGAAAAGGTATGTGAATCTTGCCACTAGCACTTGAAATTGATTTGTGCCAGTCGTTTGACGAACATGTGCACTTGTTGGTCAAACGTATCACATGGCTTGCAAGAGTAACTTCATCCAGTACCATGTGTAATTTCGGACCACGAAAAATCTCCTTCGAATGCTAGTATAACTGGCTGATCCACGACCCTACTTGGTGTAACCAGGTTCTGATTTTGCTCTTGAGCAACCAGAACCACCAATGGCCAACTTAGCCTCGTCAGCTCCTTTACAAGGCTTTAGAATCTGAAATGGATGAAGTTCACGGCATCCAGTAAATTTCATCCTCTTTGTCCAAAACGCTGAACATGTTCAGGTCTTTGTGGCAGGTAAGGAAGCTATTGATAAGGATTGGAAGCCGAGCGTGCGAGGAAAGCGACGGGGCCGACAGAGTAAGCCTCTTCCTGCGCACCCTTTCTGAATCTACGTTATGAAACCTCACAAAGCAAATCCTATCTCTCTTAGAGACACAAATGAGTTCTTCATACGCAGTTAGGGTACGATGTGTTTGATGTACACATAGCCGCCTACAGTTTGAGTTTTATCTTTACAGCAGCCTCAAGACGCAAGACTCTTGAAACTCAAAGTCAAGCCTTTCTAGTCGGGATCACTCTATTGGATGTTTCCAGATCGTGTTGAAGAGCTACACATGGTTTATAAGTAGTACACGAGTACAACAGAGCACCTAGAATTTACCAACATAACCCCGGGGTCCCAAAATTTGGTTTACTGGCCACGTTTCTCCAGACTGTTTTCAATGCGTCGTAGCCATTCGCATTACGGCATGTGTTAAAGTGGGCCTACTCCATTTGGGCCGTCATAAACGTTAAGAGGGGATTCATTTTTAGGCCTCACTCGAGCAAAGCTGGTTGGAAGACTTCAGTAGCTTGGGGACATTAGAGGTCACAGCTGAGCTGGTCATTTGGTTTTTTTGCGTGTTCTAAATGTACAGCTCTCTATAAGTAAGCTGATTGTCTAGCTCGCCCTTATAAACAATTATCATTTGTTGTTATTTTCCAGGTGAAGTCTTCCTATGCAACGTTGAAGGTTGCGAAAAGAGCTTTGTCGATGCTGTTGCGCTTTACAATCACGGTCGTGTGCACGGAGACAGGCCTTACGTATGCCATTGGGAAGGATGCACAAAGGTGTGCTTCATATCCCGAACAGTAGGAGAGTCTGGTAGCTTCATAGTTGAAGCATTTGATGGTTGCAGTAGTCCTCGATATGTGCAGCTGTGGCTACACATTCGTGAATTTACGTACGCAGTAGACAAGACTATGCTCAGTAAATGATTGATATTTTTTTCAGCATCATGATTGTAGACATCAATATTCTCAAGGGCGAGGTTATCAGGTCTCGTTTGTGCAAGGAAGAAGAAGAAAGGCCAATACTTCATTCTTTTTTATGCTATGTAGTGTGGTTTCTACAGCTCCTGGTCACTAAATCGGTCATTACTAAACGCACTCTGCAGAGGTTTTCGGAGAGATCAAAGCTAAAACGACACTTCCTCATTCACACAGGAGAAAAGCCCTTCATCTGCGTCTACGAAGGTTGTGGAAAGGTGAGTTCTTTTGTGGCCCTGCAACAGGCAAGTATTTGGACAGTCCACACACAAGGCTTGAAGAAGCGAACAAAGATATAATAAATCGTCAGCTTGCCAGCGCTCACTCAGGCGGTTTCTATGTTGTGGTCTATGTCGTGTTCTATGATAACAGTCTACGCAGGACGCGTATTCAGCTCTCTGCTGAAAAGGCGTTACCTTCCTTGTTTGTTATCCGAGATTCATCTGCCTCGACCGATATGTGCCGTTTGTAGCCTGCCTTACTTATGACGCTATGGTGTATACAATTGTTTCTGGTACTCTAACTTCTGACCTCGTCGTCTGATGATCGACAGGCTTTCTCTTTGGACTTTAACTTGCGGTCTCACATGAAGACACACACAGGAGAATACCATGAGTGTCCTCATCCCGGTTGCGAGAAAAGATACTGTCAGGAGTACAAACTGAGGGCGCATATCTGCAAGGAGCACAAGGGAGCAGGAAAATCAAGTGATAATGGAGGTCGCTTGGCGAAAGAGGACTCAGTGATCTCCTCCAATGATAAAGCCGCGAAGAAGAAAGAGAGAGCCGAACAGCTGGAATTACGGAGGGCCAAGCTGGAAAAGTGCAAAGAGGGAAAAAGGAAACGTATTCAGGAGCTTGAAGCAGAACTAGAAGGCGAGATGAAAGAGCTGACCAAACTGGATAAAGCACTTAGAAAAGTTACCCGAGAACAAGAAGAGGAGGAATTCGAAGGCTGTGTGGAGCAGGATTTATTATCAGATAATGCCGGGGAAGCTGAGCTGGGTGAGGTTTACGGGGAGGAGAAAGAAGTGGTAATGTTTGCTCATAAACTCCCTACAGCCGACCAAGGAGCCAGACTCATGAATCAGGTTGTGTTAATTCAGGGTCCTACTCCCCCACTGTCACCATCGATTTCATCGTCTCAACCTTTCTTAATGTCCCGCGTGTCTACTTTAGACAGCACTTCACCCACAGAAAGTGGCCTCCACTCTCATCATAGCACTCATCTACTCCCTTACAGCGTGACTCCCATTTGCCAGTTAAGTATGGACAGCTTGTTTGGAGATAGACGAAATTCACAAAATTTAGTATCGTTTGTGGGCTCCCAGGGTCTTTCAATGAGCAAAGATAGATTAGGTGATCCCCATGGAGGAGGGGTTTCACAAGCCTTTTCAGCCAACTGTCAATCTTCAATATCCTTCATTCATGGTGAACAAAGTTCGCAGTGCGAGCCACCTGTCTCGCAGCTTTTCACATATCAAGAGCAGCCATGTTTGCAAGATTAGGATCTAGAGGCCTTACCTATTTCGTGACTTTGTCACTGAACTTAGAATTTAGAAGTTAGAGTATTACTGTTGGAAAGGGGTAGGAAAGAGAGGCCTAAGAAATGTTCTCACAATCACCAGCGTGCCACTGAAGGATGGTGTCTCACGAAAGATTGTCTTTACTCCTCAGTTTGGAAGCGAAGGCGTCGCGGCCTACTACCTCACAATTATACGGGATACTGCTTGCCGAAGGCACGAGCATTTTCCTCGGGAACTGCGAGAAGCACCGTCCGGGTTCAAATGCCTATTATTGGCTCATAGTTGTGGTGTTTCACCACGTGTGTTGGGAATACATCAACTCCAGTTGGAGGTGTTGATAGAAATTCAATCTAGTAAAGATTTGAGTGACCACTCGCATCGG

mRNA

>Mapoly0068s0079.1
CTGTTAACTTTACTCACCGAACGGCGCTGGCATGAGTAAGAACGAAAATCTGGATTGTAAGCCAGTTGGAGAGAGAGAACCCAGAGATGAGACGATAGAGCTCAATGAGCTGTTCGGTTGGGTCGGATGGACGACGAGACGAGGGTGAACCCGGTGAAGACATACAAAACACAGATTAATTATGAAGGTGAAGGGGTCACGTGAGCAAGGAAAGTGGGTAGAAAGCACGTGAGGTGGATTGTATGAGCGCTGTGTGTGATGGAGAAGAGTTTCATACACTTATCTCCTCGTCTATCCTGTCCAACGAAGGAAACTAATGGGAGAATACACTTTGGGATATCTGGGTAGAATCACCGAAGAGTGTAAGACAACACACGACATCGCATTCGTCTGGGGTTTATGAAATAGTGAAGTGAAGGACGATGTCCTTTCCGATCCGCATCAGCTGACGCCTCCCAAAGCTGAAAGGAACTTCTGTGTCTATTTCCTGTCTGTCCTGCCGTCGAACGAGAACTGATACAGATTCTGCTTCTGTGTACTATGGGTTTGCCTACACCAAATCCTCCAGGTTCGAAATAAGCTTCAGTCGCAGGCAGCCCTGCTGGAAGAGGCTGATTCTCCGTGGAGGTATCAGCCAACTTGGATGCAGTCTGTGCAAGCCTATCTCACGGAGTAGGAATCTTGTCGATAGAAGGGCACTCTGGTATTGGAGCTGCCGGGAGTTATCGCGAAGACCAACTACCAGAATTGGTATTCCATCAGGAGAGTTCGTAGTCAGATGCTTGACATAATCCTGCGAAGTACTTCAGTGCTTGAGACTTCCAGAAACAGAAGATTTATGGACTATCACAAAACCTGCCCCGGAACTAGATAATCTGTATTATCTGACCACACCAGGATTTTAGTCTTCATCTATTGAGAGGAGCACCATTGCCCTTCACTCTGTGTTTACGGCTAAGTAAACGCTTGAACGTATAATGTCTCTCGCCGGACTAGGCGGGATGCCAAACTATGCGAAAACTGAACCAGTTGTATCAATGGATGATGAACCAAAAACTGTAGAAAAGAACTTAGCAACCTGCAAGGTTGAGGATATCAGTGTTTTGGAGAGTAAAGTAGGACATTCATCCTTCGGGAATGAAATAGATAGAACAGTGGAAGAAAAGAGGACAAGAATCTGCGTCGAGTCTAGAGGAGAAAGGAGGTTGCAAGTGAAGGTTGATGAAGGTGCAGCTTCTGGTGAGAGTGGACCAAGGAGCACTGGAGGAGGCCGAGAAAGATGTAGAGGTTGTGGAGTGAGAGAGGAACCGAGAAAGAATGAGCTCTGCGAGAGTTGTAAACAAGAGGGTTCCGGGAATTTCGAGGGGAAAGTCACAAGGTCAAGCACTCGAAGGCGACTGGGCGTCCAACCTGTCACACCACGTCTTGAAGAACCTCGTGCAGTGCGAGCCAATCGAGGAATGAAACGTCGTTTTCCTGGTGCTGTTTCAGGGGACGAATCAGACGACAACTGCGACAAGCGGAAGCGAACTCGAGTTCGAAGCATATCCAAAGTTTGTGGACCCAACGCCCAGCAGCAGTCAGGCTCCGAAACATCTGGAAAAGGTAAGGAAGCTATTGATAAGGATTGGAAGCCGAGCGTGCGAGGAAAGCGACGGGGCCGACAGAGTGAAGTCTTCCTATGCAACGTTGAAGGTTGCGAAAAGAGCTTTGTCGATGCTGTTGCGCTTTACAATCACGGTCGTGTGCACGGAGACAGGCCTTACGTATGCCATTGGGAAGGATGCACAAAGAGGTTTTCGGAGAGATCAAAGCTAAAACGACACTTCCTCATTCACACAGGAGAAAAGCCCTTCATCTGCGTCTACGAAGGTTGTGGAAAGGCTTTCTCTTTGGACTTTAACTTGCGGTCTCACATGAAGACACACACAGGAGAATACCATGAGTGTCCTCATCCCGGTTGCGAGAAAAGATACTGTCAGGAGTACAAACTGAGGGCGCATATCTGCAAGGAGCACAAGGGAGCAGGAAAATCAAGTGATAATGGAGGTCGCTTGGCGAAAGAGGACTCAGTGATCTCCTCCAATGATAAAGCCGCGAAGAAGAAAGAGAGAGCCGAACAGCTGGAATTACGGAGGGCCAAGCTGGAAAAGTGCAAAGAGGGAAAAAGGAAACGTATTCAGGAGCTTGAAGCAGAACTAGAAGGCGAGATGAAAGAGCTGACCAAACTGGATAAAGCACTTAGAAAAGTTACCCGAGAACAAGAAGAGGAGGAATTCGAAGGCTGTGTGGAGCAGGATTTATTATCAGATAATGCCGGGGAAGCTGAGCTGGGTGAGGTTTACGGGGAGGAGAAAGAAGTGGTAATGTTTGCTCATAAACTCCCTACAGCCGACCAAGGAGCCAGACTCATGAATCAGGTTGTGTTAATTCAGGGTCCTACTCCCCCACTGTCACCATCGATTTCATCGTCTCAACCTTTCTTAATGTCCCGCGTGTCTACTTTAGACAGCACTTCACCCACAGAAAGTGGCCTCCACTCTCATCATAGCACTCATCTACTCCCTTACAGCGTGACTCCCATTTGCCAGTTAAGTATGGACAGCTTGTTTGGAGATAGACGAAATTCACAAAATTTAGTATCGTTTGTGGGCTCCCAGGGTCTTTCAATGAGCAAAGATAGATTAGGTGATCCCCATGGAGGAGGGGTTTCACAAGCCTTTTCAGCCAACTGTCAATCTTCAATATCCTTCATTCATGGTGAACAAAGTTCGCAGTGCGAGCCACCTGTCTCGCAGCTTTTCACATATCAAGAGCAGCCATGTTTGCAAGATTAGGATCTAGAGGCCTTACCTATTTCGTGACTTTGTCACTGAACTTAGAATTTAGAAGTTAGAGTATTACTGTTGGAAAGGGGTAGGAAAGAGAGGCCTAAGAAATGTTCTCACAATCACCAGCGTGCCACTGAAGGATGGTGTCTCACGAAAGATTGTCTTTACTCCTCAGTTTGGAAGCGAAGGCGTCGCGGCCTACTACCTCACAATTATACGGGATACTGCTTGCCGAAGGCACGAGCATTTTCCTCGGGAACTGCGAGAAGCACCGTCCGGGTTCAAATGCCTATTATTGGCTCATAGTTGTGGTGTTTCACCACGTGTGTTGGGAATACATCAACTCCAGTTGGAGGTGTTGATAGAAATTCAATCTAGTAAAGATTTGAGTGACCACTCGCATCGG

CDS

>Mapoly0068s0079.1
ATGTCTCTCGCCGGACTAGGCGGGATGCCAAACTATGCGAAAACTGAACCAGTTGTATCAATGGATGATGAACCAAAAACTGTAGAAAAGAACTTAGCAACCTGCAAGGTTGAGGATATCAGTGTTTTGGAGAGTAAAGTAGGACATTCATCCTTCGGGAATGAAATAGATAGAACAGTGGAAGAAAAGAGGACAAGAATCTGCGTCGAGTCTAGAGGAGAAAGGAGGTTGCAAGTGAAGGTTGATGAAGGTGCAGCTTCTGGTGAGAGTGGACCAAGGAGCACTGGAGGAGGCCGAGAAAGATGTAGAGGTTGTGGAGTGAGAGAGGAACCGAGAAAGAATGAGCTCTGCGAGAGTTGTAAACAAGAGGGTTCCGGGAATTTCGAGGGGAAAGTCACAAGGTCAAGCACTCGAAGGCGACTGGGCGTCCAACCTGTCACACCACGTCTTGAAGAACCTCGTGCAGTGCGAGCCAATCGAGGAATGAAACGTCGTTTTCCTGGTGCTGTTTCAGGGGACGAATCAGACGACAACTGCGACAAGCGGAAGCGAACTCGAGTTCGAAGCATATCCAAAGTTTGTGGACCCAACGCCCAGCAGCAGTCAGGCTCCGAAACATCTGGAAAAGGTAAGGAAGCTATTGATAAGGATTGGAAGCCGAGCGTGCGAGGAAAGCGACGGGGCCGACAGAGTGAAGTCTTCCTATGCAACGTTGAAGGTTGCGAAAAGAGCTTTGTCGATGCTGTTGCGCTTTACAATCACGGTCGTGTGCACGGAGACAGGCCTTACGTATGCCATTGGGAAGGATGCACAAAGAGGTTTTCGGAGAGATCAAAGCTAAAACGACACTTCCTCATTCACACAGGAGAAAAGCCCTTCATCTGCGTCTACGAAGGTTGTGGAAAGGCTTTCTCTTTGGACTTTAACTTGCGGTCTCACATGAAGACACACACAGGAGAATACCATGAGTGTCCTCATCCCGGTTGCGAGAAAAGATACTGTCAGGAGTACAAACTGAGGGCGCATATCTGCAAGGAGCACAAGGGAGCAGGAAAATCAAGTGATAATGGAGGTCGCTTGGCGAAAGAGGACTCAGTGATCTCCTCCAATGATAAAGCCGCGAAGAAGAAAGAGAGAGCCGAACAGCTGGAATTACGGAGGGCCAAGCTGGAAAAGTGCAAAGAGGGAAAAAGGAAACGTATTCAGGAGCTTGAAGCAGAACTAGAAGGCGAGATGAAAGAGCTGACCAAACTGGATAAAGCACTTAGAAAAGTTACCCGAGAACAAGAAGAGGAGGAATTCGAAGGCTGTGTGGAGCAGGATTTATTATCAGATAATGCCGGGGAAGCTGAGCTGGGTGAGGTTTACGGGGAGGAGAAAGAAGTGGTAATGTTTGCTCATAAACTCCCTACAGCCGACCAAGGAGCCAGACTCATGAATCAGGTTGTGTTAATTCAGGGTCCTACTCCCCCACTGTCACCATCGATTTCATCGTCTCAACCTTTCTTAATGTCCCGCGTGTCTACTTTAGACAGCACTTCACCCACAGAAAGTGGCCTCCACTCTCATCATAGCACTCATCTACTCCCTTACAGCGTGACTCCCATTTGCCAGTTAAGTATGGACAGCTTGTTTGGAGATAGACGAAATTCACAAAATTTAGTATCGTTTGTGGGCTCCCAGGGTCTTTCAATGAGCAAAGATAGATTAGGTGATCCCCATGGAGGAGGGGTTTCACAAGCCTTTTCAGCCAACTGTCAATCTTCAATATCCTTCATTCATGGTGAACAAAGTTCGCAGTGCGAGCCACCTGTCTCGCAGCTTTTCACATATCAAGAGCAGCCATGTTTGCAAGATTAG

Protein

>Mapoly0068s0079.1
MSLAGLGGMPNYAKTEPVVSMDDEPKTVEKNLATCKVEDISVLESKVGHSSFGNEIDRTVEEKRTRICVESRGERRLQVKVDEGAASGESGPRSTGGGRERCRGCGVREEPRKNELCESCKQEGSGNFEGKVTRSSTRRRLGVQPVTPRLEEPRAVRANRGMKRRFPGAVSGDESDDNCDKRKRTRVRSISKVCGPNAQQQSGSETSGKGKEAIDKDWKPSVRGKRRGRQSEVFLCNVEGCEKSFVDAVALYNHGRVHGDRPYVCHWEGCTKRFSERSKLKRHFLIHTGEKPFICVYEGCGKAFSLDFNLRSHMKTHTGEYHECPHPGCEKRYCQEYKLRAHICKEHKGAGKSSDNGGRLAKEDSVISSNDKAAKKKERAEQLELRRAKLEKCKEGKRKRIQELEAELEGEMKELTKLDKALRKVTREQEEEEFEGCVEQDLLSDNAGEAELGEVYGEEKEVVMFAHKLPTADQGARLMNQVVLIQGPTPPLSPSISSSQPFLMSRVSTLDSTSPTESGLHSHHSTHLLPYSVTPICQLSMDSLFGDRRNSQNLVSFVGSQGLSMSKDRLGDPHGGGVSQAFSANCQSSISFIHGEQSSQCEPPVSQLFTYQEQPCLQD

Mapoly0068s0079.2  

Gene structure:

mRNA scaffold_68:684594..691654  ( - strand )
three_prime_UTR scaffold_68:684594..684993  ( - strand )
CDS scaffold_68:684994..685947  ( - strand )
CDS scaffold_68:686283..686372  ( - strand )
CDS scaffold_68:686699..686823  ( - strand )
CDS scaffold_68:687452..687514  ( - strand )
CDS scaffold_68:687874..687987  ( - strand )
CDS scaffold_68:688210..688711  ( - strand )
five_prime_UTR scaffold_68:688712..689018  ( - strand )
five_prime_UTR scaffold_68:690985..691654  ( - strand )

Sequences:

Gene

>Mapoly0068s0079.2
CTGTTAACTTTACTCACCGAACGGCGCTGGCATGAGTAAGAACGAAAATCTGGATTGTAAGCCAGTTGGAGAGAGAGAACCCAGAGATGAGACGATAGAGCTCAATGAGCTGTTCGGTTGGGTCGGATGGACGACGAGACGAGGGTGAACCCGGTGAAGACATACAAAACACAGATTAATTATGAAGGTGAAGGGGTCACGTGAGCAAGGAAAGTGGGTAGAAAGCACGTGAGGTGGATTGTATGAGCGCTGTGTGTGATGGAGAAGAGTTTCATACACTTATCTCCTCGTCTATCCTGTCCAACGAAGGAAACTAATGGGAGAATACACTTTGGGATATCTGGGTAGAATCACCGAAGAGTGTAAGACAACACACGACATCGCATTCGTCTGGGGTTTATGAAATAGTGAAGTGAAGGACGATGTCCTTTCCGATCCGCATCAGCTGACGCCTCCCAAAGCTGAAAGGAACTTCTGTGTCTATTTCCTGTCTGTCCTGCCGTCGAACGAGAACTGATACAGATTCTGCTTCTGTGTACTATGGGTTTGCCTACACCAAATCCTCCAGGTTCGAAATAAGCTTCAGTCGCAGGCAGCCCTGCTGGAAGAGGCTGATTCTCCGTGGAGGTATCAGCCAACTTGGATGCAGTCTGTGCAAGCCTATCTCACGGTAAGATTTATGAAAAAATTGTGCACGAGTGAGCCAGTATCTCTCAAAAGTAGCAAGGAGATGACAAACTCACACTATCTCTGTTTCTTCTACCGATCTCTTATTTCTCCACTATTTACTAAACCAGAATCTAGCGGACATAGTGTGTGGGTCGTCATCCCTGCTTGTGTTTGTACAACATTCCAGCACTTCACTTCAATGCCGGTAGATTGTCGAAGCACGCCAATATAAGATGTCGCACTGTCATCGGACGAGTGCATCCGAAACTTTCAAAATAGGGCGGTAATAACTTATTGCATCTCTGAAATCTGCATACTACAGTCCGTTCATTTGCTGTGTTCGTGAGAAATTTTAATGTGGAAAACATTCACCTTCTGATTGGGCACAGCTAACATGCCACCGGTTTGCAGATTCGAGCATGTTCTGTGTATGTGGTCAAACGTCTAGGTGTACAAGTGCTCTGGGAGGAAGTAGGTAGTTCTCTCTGTGTGGGCTGCACCACGTACAATATGGATTTCAATAACTGTAGGTTCAGCTCAGCTTGAAGACGATTTAGACCAAGATCACGTATTTTGGAAGGGGACGCTTGTTTCTGCAAGCTACTGTGTTACCTACAACCTTGTGAAATGTCTTGTTTAGCGCACAGCCTACACCATGAAACGATTTTTTAGTATACATCTGGGTATTATTTATGCCTCTGGTCGATCGTTCAGACTTCTATCTGTTCATGAATTTCATGTTCATGACAGAATATTTACGTTGAAATTGAGGTACGAGATTGTGTCTCTCAACTGACTATGCCGGCATCAGAAGGGAATCTGGGTTGAACTAGCAGAAAAGTGTAAATTCCAACATCAGTTTCCGCATGTTTTCTTTTACTTAGATTATAATGAGCTCTTGATACTAGAGCAAGATGCGCTGTTCAATCGAGAGATTTGAGTCATTGAGTTTTGAAGACTGAAGACTGCCTGCCCTCTACATACAGAATTAAAATTTCTGGTTCATTGGGAATGATTTTTCGGTCTTGGACGTGACGTCGAAGGTAGTATAGCTTATCTCGCCTTCCCTCGACTACGGCATAGCATGTCAGATTTGGGGTTTGGTTTTGGTTTCGAAGAGGACTTTCTTGTCACCTTGAAACATGATGAATATCAAATTCGCAAAAGCGATTGGGTGACATGGTAGTCCTCAAATCGCTAGCAGAATCTGCGGGCCTCTTTTGCCGTTTGAGAGTACGTTACAGAGGAAATAGCACGGAATTGCGCACCAATACTCTGTTGTCGCGAACAAGCAATTTTTCGAATTTTCGGTAATATGGTTATTGGCTACGATAATATAATTGGTGTCTGACACCTAGACGTGAAGATGGAGTTTCTTACGAGATCAACTTTTACAATTCCTTGGGTTTAGCTGAAGTTAGTGAGAGATACATCCGGACGTGTCACTAGATTCGTTCATACGAGTCGTCAGTTTGTCTAAGGTTCGGTTCATTTTATTCCTAATGCGATTAGCCATTTTCATATTCCTGTTATCTGAACAGTATGATCTTTGTTCACGTGCAGTCAGCATGCATCACTGTTAATAATTAAGATATCGTTACTTTGACGACGTAAGGATAGCATTATGGCCGTTTTCGAGGGAGATCTCGCTCGAAGGACTATGATGGAAGCTCAGTTCTCTCCGAGAATAGTCGAAGGAGACTTACTAATTCTGAGAGATGTATGTTTAGGCTGTCGATAGGATCCAAGTTGGAGGTTTGAAACAAGTAGTGCAGACATTGGGTTCTGTCATTTAGTTTTATCTAAAAAGTGCCGAATAATGCTAATGAAATGTCACAAGCCTTGTCATTGTCCAGAGCTAGATAGAGAATGTCGTGGGTTGTTCCGATGGGAAGTACCCGGGCCGCTGAATTTTGAGAAACTCTTGAACGAGACAATCTCTCTAACGAACTACATGTGATGTGCAGGAGTAGGAATCTTGTCGATAGAAGGGCACTCTGGTATTGGAGCTGCCGGGAGTTATCGCGAAGACCAACTACCAGAATTGGTATTCCATCAGGAGAGTTCGTAGTCAGATGCTTGACATAATCCTGCGAAGTACTTCAGTGCTTGAGACTTCCAGAAACAGAAGATTTATGGACTATCACAAAACCTGCCCCGGAACTAGATAATCTGTATTATCTGACCACACCAGGATTTTAGTCTTCATCTATTGAGAGGAGCACCATTGCCCTTCACTCTGTGTTTACGGCTAAGTAAACGCTTGAACGTATAATGTCTCTCGCCGGACTAGGCGGGATGCCAAACTATGCGAAAACTGAACCAGTTGTATCAATGGATGATGAACCAAAAACTGTAGAAAAGAACTTAGCAACCTGCAAGGTTGAGGATATCAGTGTTTTGGAGAGTAAAGTAGGACATTCATCCTTCGGGAATGAAATAGATAGAACAGTGGAAGAAAAGAGGACAAGAATCTGCGTCGAGTCTAGAGGAGAAAGGAGGTTGCAAGTGAAGGTTGATGAAGGTGCAGCTTCTGGTGAGAGTGGACCAAGGAGCACTGGAGGAGGCCGAGAAAGATGTAGAGGTTGTGGAGTGAGAGAGGAACCGAGAAAGAATGAGCTCTGCGAGAGTTGTAAACAAGAGGGTTCCGGGAATTTCGAGGGGAAAGTCACAAGGTCAAGCACTCGAAGGCGACTGGGCGTCCAACCTGTCACACCACGTCTTGAAGAACCTCGTGCAGTGCGAGCCAATCGAGGAATGAAACGTCGTTTTCCTGGTATAATTCCCACCTCGAATGCTATTCACTCTCGTTCACTAGATTTGAGAATTATGATTAGTGAACGTTGCACGTCGAAAAGAATACGACTGTATTCTTGACCCCCTTGCATGCTCCATTTGTTCATTGTACACCTTTGACTAGTTTCTGCTATTCCTTTGACGAGCTCTATTGCCGCGGTTTAACTCATAGGAGGGACTGATCGTGAAGGTGCTGTTTCAGGGGACGAATCAGACGACAACTGCGACAAGCGGAAGCGAACTCGAGTTCGAAGCATATCCAAAGTTTGTGGACCCAACGCCCAGCAGCAGTCAGGCTCCGAAACATCTGGAAAAGGTATGTGAATCTTGCCACTAGCACTTGAAATTGATTTGTGCCAGTCGTTTGACGAACATGTGCACTTGTTGGTCAAACGTATCACATGGCTTGCAAGAGTAACTTCATCCAGTACCATGTGTAATTTCGGACCACGAAAAATCTCCTTCGAATGCTAGTATAACTGGCTGATCCACGACCCTACTTGGTGTAACCAGGTTCTGATTTTGCTCTTGAGCAACCAGAACCACCAATGGCCAACTTAGCCTCGTCAGCTCCTTTACAAGGCTTTAGAATCTGAAATGGATGAAGTTCACGGCATCCAGTAAATTTCATCCTCTTTGTCCAAAACGCTGAACATGTTCAGGTCTTTGTGGCAGGTAAGGAAGCTATTGATAAGGATTGGAAGCCGAGCGTGCGAGGAAAGCGACGGGGCCGACAGAGTAAGCCTCTTCCTGCGCACCCTTTCTGAATCTACGTTATGAAACCTCACAAAGCAAATCCTATCTCTCTTAGAGACACAAATGAGTTCTTCATACGCAGTTAGGGTACGATGTGTTTGATGTACACATAGCCGCCTACAGTTTGAGTTTTATCTTTACAGCAGCCTCAAGACGCAAGACTCTTGAAACTCAAAGTCAAGCCTTTCTAGTCGGGATCACTCTATTGGATGTTTCCAGATCGTGTTGAAGAGCTACACATGGTTTATAAGTAGTACACGAGTACAACAGAGCACCTAGAATTTACCAACATAACCCCGGGGTCCCAAAATTTGGTTTACTGGCCACGTTTCTCCAGACTGTTTTCAATGCGTCGTAGCCATTCGCATTACGGCATGTGTTAAAGTGGGCCTACTCCATTTGGGCCGTCATAAACGTTAAGAGGGGATTCATTTTTAGGCCTCACTCGAGCAAAGCTGGTTGGAAGACTTCAGTAGCTTGGGGACATTAGAGGTCACAGCTGAGCTGGTCATTTGGTTTTTTTGCGTGTTCTAAATGTACAGCTCTCTATAAGTAAGCTGATTGTCTAGCTCGCCCTTATAAACAATTATCATTTGTTGTTATTTTCCAGGTGAAGTCTTCCTATGCAACGTTGAAGGTTGCGAAAAGAGCTTTGTCGATGCTGTTGCGCTTTACAATCACGGTCGTGTGCACGGAGACAGGCCTTACGTATGCCATTGGGAAGGATGCACAAAGGTGTGCTTCATATCCCGAACAGTAGGAGAGTCTGGTAGCTTCATAGTTGAAGCATTTGATGGTTGCAGTAGTCCTCGATATGTGCAGCTGTGGCTACACATTCGTGAATTTACGTACGCAGTAGACAAGACTATGCTCAGTAAATGATTGATATTTTTTTCAGCATCATGATTGTAGACATCAATATTCTCAAGGGCGAGGTTATCAGGTCTCGTTTGTGCAAGGAAGAAGAAGAAAGGCCAATACTTCATTCTTTTTTATGCTATGTAGTGTGGTTTCTACAGCTCCTGGTCACTAAATCGGTCATTACTAAACGCACTCTGCAGAGGTTTTCGGAGAGATCAAAGCTAAAACGACACTTCCTCATTCACACAGGAGAAAAGCCCTTCATCTGCGTCTACGAAGGTTGTGGAAAGGTGAGTTCTTTTGTGGCCCTGCAACAGGCAAGTATTTGGACAGTCCACACACAAGGCTTGAAGAAGCGAACAAAGATATAATAAATCGTCAGCTTGCCAGCGCTCACTCAGGCGGTTTCTATGTTGTGGTCTATGTCGTGTTCTATGATAACAGTCTACGCAGGACGCGTATTCAGCTCTCTGCTGAAAAGGCGTTACCTTCCTTGTTTGTTATCCGAGATTCATCTGCCTCGACCGATATGTGCCGTTTGTAGCCTGCCTTACTTATGACGCTATGGTGTATACAATTGTTTCTGGTACTCTAACTTCTGACCTCGTCGTCTGATGATCGACAGGCTTTCTCTTTGGACTTTAACTTGCGGTCTCACATGAAGACACACACAGGAGAATACCATGAGTGTCCTCATCCCGGTTGCGAGAAAAGATACTGTCAGGAGTACAAACTGAGGGCGCATATCTGCAAGGAGCACAAGGGAGCAGGAAAATCAAGTGATAATGGAGGTCGCTTGGCGAAAGAGGACTCAGTGATCTCCTCCAATGATAAAGCCGCGAAGAAGAAAGAGAGAGCCGAACAGCTGGAATTACGGAGGGCCAAGCTGGAAAAGTGCAAAGAGGGAAAAAGGAAACGTATTCAGGAGCTTGAAGCAGAACTAGAAGGCGAGATGAAAGAGCTGACCAAACTGGATAAAGCACTTAGAAAAGTTACCCGAGAACAAGAAGAGGAGGAATTCGAAGGCTGTGTGGAGCAGGATTTATTATCAGATAATGCCGGGGAAGCTGAGCTGGGTGAGGTTTACGGGGAGGAGAAAGAAGTGGTAATGTTTGCTCATAAACTCCCTACAGCCGACCAAGGAGCCAGACTCATGAATCAGGTTGTGTTAATTCAGGGTCCTACTCCCCCACTGTCACCATCGATTTCATCGTCTCAACCTTTCTTAATGTCCCGCGTGTCTACTTTAGACAGCACTTCACCCACAGAAAGTGGCCTCCACTCTCATCATAGCACTCATCTACTCCCTTACAGCGTGACTCCCATTTGCCAGTTAAGTATGGACAGCTTGTTTGGAGATAGACGAAATTCACAAAATTTAGTATCGTTTGTGGGCTCCCAGGGTCTTTCAATGAGCAAAGATAGATTAGGTGATCCCCATGGAGGAGGGGTTTCACAAGCCTTTTCAGCCAACTGTCAATCTTCAATATCCTTCATTCATGGTGAACAAAGTTCGCAGTGCGAGCCACCTGTCTCGCAGCTTTTCACATATCAAGAGCAGCCATGTTTGCAAGATTAGGATCTAGAGGCCTTACCTATTTCGTGACTTTGTCACTGAACTTAGAATTTAGAAGTTAGAGTATTACTGTTGGAAAGGGGTAGGAAAGAGAGGCCTAAGAAATGTTCTCACAATCACCAGCGTGCCACTGAAGGATGGTGTCTCACGAAAGATTGTCTTTACTCCTCAGTTTGGAAGCGAAGGCGTCGCGGCCTACTACCTCACAATTATACGGGATACTGCTTGCCGAAGGCACGAGCATTTTCCTCGGGAACTGCGAGAAGCACCGTCCGGGTTCAAATGCCTATTATTGGCTCATAGTTGTGGTGTTTCACCACGTGTGTTGGGAATACATCAACTCCAGTTGGAGGTGTTGATAGAAATTCAATCTAGTAAAGATTTGAGTGACCACTCGCATCGG

mRNA

>Mapoly0068s0079.2
CTGTTAACTTTACTCACCGAACGGCGCTGGCATGAGTAAGAACGAAAATCTGGATTGTAAGCCAGTTGGAGAGAGAGAACCCAGAGATGAGACGATAGAGCTCAATGAGCTGTTCGGTTGGGTCGGATGGACGACGAGACGAGGGTGAACCCGGTGAAGACATACAAAACACAGATTAATTATGAAGGTGAAGGGGTCACGTGAGCAAGGAAAGTGGGTAGAAAGCACGTGAGGTGGATTGTATGAGCGCTGTGTGTGATGGAGAAGAGTTTCATACACTTATCTCCTCGTCTATCCTGTCCAACGAAGGAAACTAATGGGAGAATACACTTTGGGATATCTGGGTAGAATCACCGAAGAGTGTAAGACAACACACGACATCGCATTCGTCTGGGGTTTATGAAATAGTGAAGTGAAGGACGATGTCCTTTCCGATCCGCATCAGCTGACGCCTCCCAAAGCTGAAAGGAACTTCTGTGTCTATTTCCTGTCTGTCCTGCCGTCGAACGAGAACTGATACAGATTCTGCTTCTGTGTACTATGGGTTTGCCTACACCAAATCCTCCAGGTTCGAAATAAGCTTCAGTCGCAGGCAGCCCTGCTGGAAGAGGCTGATTCTCCGTGGAGGTATCAGCCAACTTGGATGCAGTCTGTGCAAGCCTATCTCACGGAGTAGGAATCTTGTCGATAGAAGGGCACTCTGGTATTGGAGCTGCCGGGAGTTATCGCGAAGACCAACTACCAGAATTGGTATTCCATCAGGAGAGTTCGTAGTCAGATGCTTGACATAATCCTGCGAAGTACTTCAGTGCTTGAGACTTCCAGAAACAGAAGATTTATGGACTATCACAAAACCTGCCCCGGAACTAGATAATCTGTATTATCTGACCACACCAGGATTTTAGTCTTCATCTATTGAGAGGAGCACCATTGCCCTTCACTCTGTGTTTACGGCTAAGTAAACGCTTGAACGTATAATGTCTCTCGCCGGACTAGGCGGGATGCCAAACTATGCGAAAACTGAACCAGTTGTATCAATGGATGATGAACCAAAAACTGTAGAAAAGAACTTAGCAACCTGCAAGGTTGAGGATATCAGTGTTTTGGAGAGTAAAGTAGGACATTCATCCTTCGGGAATGAAATAGATAGAACAGTGGAAGAAAAGAGGACAAGAATCTGCGTCGAGTCTAGAGGAGAAAGGAGGTTGCAAGTGAAGGTTGATGAAGGTGCAGCTTCTGGTGAGAGTGGACCAAGGAGCACTGGAGGAGGCCGAGAAAGATGTAGAGGTTGTGGAGTGAGAGAGGAACCGAGAAAGAATGAGCTCTGCGAGAGTTGTAAACAAGAGGGTTCCGGGAATTTCGAGGGGAAAGTCACAAGGTCAAGCACTCGAAGGCGACTGGGCGTCCAACCTGTCACACCACGTCTTGAAGAACCTCGTGCAGTGCGAGCCAATCGAGGAATGAAACGTCGTTTTCCTGGGGACGAATCAGACGACAACTGCGACAAGCGGAAGCGAACTCGAGTTCGAAGCATATCCAAAGTTTGTGGACCCAACGCCCAGCAGCAGTCAGGCTCCGAAACATCTGGAAAAGGTAAGGAAGCTATTGATAAGGATTGGAAGCCGAGCGTGCGAGGAAAGCGACGGGGCCGACAGAGTGAAGTCTTCCTATGCAACGTTGAAGGTTGCGAAAAGAGCTTTGTCGATGCTGTTGCGCTTTACAATCACGGTCGTGTGCACGGAGACAGGCCTTACGTATGCCATTGGGAAGGATGCACAAAGAGGTTTTCGGAGAGATCAAAGCTAAAACGACACTTCCTCATTCACACAGGAGAAAAGCCCTTCATCTGCGTCTACGAAGGTTGTGGAAAGGCTTTCTCTTTGGACTTTAACTTGCGGTCTCACATGAAGACACACACAGGAGAATACCATGAGTGTCCTCATCCCGGTTGCGAGAAAAGATACTGTCAGGAGTACAAACTGAGGGCGCATATCTGCAAGGAGCACAAGGGAGCAGGAAAATCAAGTGATAATGGAGGTCGCTTGGCGAAAGAGGACTCAGTGATCTCCTCCAATGATAAAGCCGCGAAGAAGAAAGAGAGAGCCGAACAGCTGGAATTACGGAGGGCCAAGCTGGAAAAGTGCAAAGAGGGAAAAAGGAAACGTATTCAGGAGCTTGAAGCAGAACTAGAAGGCGAGATGAAAGAGCTGACCAAACTGGATAAAGCACTTAGAAAAGTTACCCGAGAACAAGAAGAGGAGGAATTCGAAGGCTGTGTGGAGCAGGATTTATTATCAGATAATGCCGGGGAAGCTGAGCTGGGTGAGGTTTACGGGGAGGAGAAAGAAGTGGTAATGTTTGCTCATAAACTCCCTACAGCCGACCAAGGAGCCAGACTCATGAATCAGGTTGTGTTAATTCAGGGTCCTACTCCCCCACTGTCACCATCGATTTCATCGTCTCAACCTTTCTTAATGTCCCGCGTGTCTACTTTAGACAGCACTTCACCCACAGAAAGTGGCCTCCACTCTCATCATAGCACTCATCTACTCCCTTACAGCGTGACTCCCATTTGCCAGTTAAGTATGGACAGCTTGTTTGGAGATAGACGAAATTCACAAAATTTAGTATCGTTTGTGGGCTCCCAGGGTCTTTCAATGAGCAAAGATAGATTAGGTGATCCCCATGGAGGAGGGGTTTCACAAGCCTTTTCAGCCAACTGTCAATCTTCAATATCCTTCATTCATGGTGAACAAAGTTCGCAGTGCGAGCCACCTGTCTCGCAGCTTTTCACATATCAAGAGCAGCCATGTTTGCAAGATTAGGATCTAGAGGCCTTACCTATTTCGTGACTTTGTCACTGAACTTAGAATTTAGAAGTTAGAGTATTACTGTTGGAAAGGGGTAGGAAAGAGAGGCCTAAGAAATGTTCTCACAATCACCAGCGTGCCACTGAAGGATGGTGTCTCACGAAAGATTGTCTTTACTCCTCAGTTTGGAAGCGAAGGCGTCGCGGCCTACTACCTCACAATTATACGGGATACTGCTTGCCGAAGGCACGAGCATTTTCCTCGGGAACTGCGAGAAGCACCGTCCGGGTTCAAATGCCTATTATTGGCTCATAGTTGTGGTGTTTCACCACGTGTGTTGGGAATACATCAACTCCAGTTGGAGGTGTTGATAGAAATTCAATCTAGTAAAGATTTGAGTGACCACTCGCATCGG

CDS

>Mapoly0068s0079.2
ATGTCTCTCGCCGGACTAGGCGGGATGCCAAACTATGCGAAAACTGAACCAGTTGTATCAATGGATGATGAACCAAAAACTGTAGAAAAGAACTTAGCAACCTGCAAGGTTGAGGATATCAGTGTTTTGGAGAGTAAAGTAGGACATTCATCCTTCGGGAATGAAATAGATAGAACAGTGGAAGAAAAGAGGACAAGAATCTGCGTCGAGTCTAGAGGAGAAAGGAGGTTGCAAGTGAAGGTTGATGAAGGTGCAGCTTCTGGTGAGAGTGGACCAAGGAGCACTGGAGGAGGCCGAGAAAGATGTAGAGGTTGTGGAGTGAGAGAGGAACCGAGAAAGAATGAGCTCTGCGAGAGTTGTAAACAAGAGGGTTCCGGGAATTTCGAGGGGAAAGTCACAAGGTCAAGCACTCGAAGGCGACTGGGCGTCCAACCTGTCACACCACGTCTTGAAGAACCTCGTGCAGTGCGAGCCAATCGAGGAATGAAACGTCGTTTTCCTGGGGACGAATCAGACGACAACTGCGACAAGCGGAAGCGAACTCGAGTTCGAAGCATATCCAAAGTTTGTGGACCCAACGCCCAGCAGCAGTCAGGCTCCGAAACATCTGGAAAAGGTAAGGAAGCTATTGATAAGGATTGGAAGCCGAGCGTGCGAGGAAAGCGACGGGGCCGACAGAGTGAAGTCTTCCTATGCAACGTTGAAGGTTGCGAAAAGAGCTTTGTCGATGCTGTTGCGCTTTACAATCACGGTCGTGTGCACGGAGACAGGCCTTACGTATGCCATTGGGAAGGATGCACAAAGAGGTTTTCGGAGAGATCAAAGCTAAAACGACACTTCCTCATTCACACAGGAGAAAAGCCCTTCATCTGCGTCTACGAAGGTTGTGGAAAGGCTTTCTCTTTGGACTTTAACTTGCGGTCTCACATGAAGACACACACAGGAGAATACCATGAGTGTCCTCATCCCGGTTGCGAGAAAAGATACTGTCAGGAGTACAAACTGAGGGCGCATATCTGCAAGGAGCACAAGGGAGCAGGAAAATCAAGTGATAATGGAGGTCGCTTGGCGAAAGAGGACTCAGTGATCTCCTCCAATGATAAAGCCGCGAAGAAGAAAGAGAGAGCCGAACAGCTGGAATTACGGAGGGCCAAGCTGGAAAAGTGCAAAGAGGGAAAAAGGAAACGTATTCAGGAGCTTGAAGCAGAACTAGAAGGCGAGATGAAAGAGCTGACCAAACTGGATAAAGCACTTAGAAAAGTTACCCGAGAACAAGAAGAGGAGGAATTCGAAGGCTGTGTGGAGCAGGATTTATTATCAGATAATGCCGGGGAAGCTGAGCTGGGTGAGGTTTACGGGGAGGAGAAAGAAGTGGTAATGTTTGCTCATAAACTCCCTACAGCCGACCAAGGAGCCAGACTCATGAATCAGGTTGTGTTAATTCAGGGTCCTACTCCCCCACTGTCACCATCGATTTCATCGTCTCAACCTTTCTTAATGTCCCGCGTGTCTACTTTAGACAGCACTTCACCCACAGAAAGTGGCCTCCACTCTCATCATAGCACTCATCTACTCCCTTACAGCGTGACTCCCATTTGCCAGTTAAGTATGGACAGCTTGTTTGGAGATAGACGAAATTCACAAAATTTAGTATCGTTTGTGGGCTCCCAGGGTCTTTCAATGAGCAAAGATAGATTAGGTGATCCCCATGGAGGAGGGGTTTCACAAGCCTTTTCAGCCAACTGTCAATCTTCAATATCCTTCATTCATGGTGAACAAAGTTCGCAGTGCGAGCCACCTGTCTCGCAGCTTTTCACATATCAAGAGCAGCCATGTTTGCAAGATTAG

Protein

>Mapoly0068s0079.2
MSLAGLGGMPNYAKTEPVVSMDDEPKTVEKNLATCKVEDISVLESKVGHSSFGNEIDRTVEEKRTRICVESRGERRLQVKVDEGAASGESGPRSTGGGRERCRGCGVREEPRKNELCESCKQEGSGNFEGKVTRSSTRRRLGVQPVTPRLEEPRAVRANRGMKRRFPGDESDDNCDKRKRTRVRSISKVCGPNAQQQSGSETSGKGKEAIDKDWKPSVRGKRRGRQSEVFLCNVEGCEKSFVDAVALYNHGRVHGDRPYVCHWEGCTKRFSERSKLKRHFLIHTGEKPFICVYEGCGKAFSLDFNLRSHMKTHTGEYHECPHPGCEKRYCQEYKLRAHICKEHKGAGKSSDNGGRLAKEDSVISSNDKAAKKKERAEQLELRRAKLEKCKEGKRKRIQELEAELEGEMKELTKLDKALRKVTREQEEEEFEGCVEQDLLSDNAGEAELGEVYGEEKEVVMFAHKLPTADQGARLMNQVVLIQGPTPPLSPSISSSQPFLMSRVSTLDSTSPTESGLHSHHSTHLLPYSVTPICQLSMDSLFGDRRNSQNLVSFVGSQGLSMSKDRLGDPHGGGVSQAFSANCQSSISFIHGEQSSQCEPPVSQLFTYQEQPCLQD

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>