Mapoly0069s0009



Description

ABA responsive element binding factor

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
KEGGORTH K14432 ABA responsive element binding factor
OrthoMCL OG5_144915
PFAM PF00170 BZIP transcription factor
PANTHER PTHR22952 CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED
PANTHER PTHR22952:SF103

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpABI5A bZIP transcription factor Mapoly0069s0009.1 Public
MpBZIP11 transcription factor, bZIP Mapoly0069s0009.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0069s0009.1 scaffold_69:164857..166926  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0069s0009.1  

Gene structure:

mRNA scaffold_69:164857..166926  ( - strand )
three_prime_UTR scaffold_69:164857..165333  ( - strand )
three_prime_UTR scaffold_69:165454..165546  ( - strand )
CDS scaffold_69:165547..165648  ( - strand )
CDS scaffold_69:165755..166786  ( - strand )
five_prime_UTR scaffold_69:166787..166926  ( - strand )

Sequences:

Gene

>Mapoly0069s0009.1
GTACTTGGCCGGTGAGCGGTAGCGCTTACCACCCCGTATACCTCAGGTACCTTGGGGCGTCGCTCTTATAGTGCGATTGAGCGTTGGCTGGCGAGGAGATTTGTTTCGATCAGTCGGGCGATCGAACATTGTTTGAGTCGATGATGGCTTCGACATCCGGGGGTGCCCAGATGGGCACCCGCAACGTGCCCTTCACGCCGATTACGAGGCAGAATTCGATTTTTTCTTTAACCCTGGACGAATTGCAGAACGCCATCGACCCTGGGAAGCATTTCGGGTCGATGAATATGGACGAGTTTCTGAAGAATGTTTGGTCCGCGGAAGAAAATCAGACCATGTCGCTGGCTATTTCGACCAGCAACGAGAGCAACGCCCCGCAGTCCTCGTCGGCCACGGGAGGCGGACTAGCTCGCCAGGGAAGTTTAACGCACCCAGGAAGTTTGTCACTGTCGCGGACCCTTAGTCGGAAAACGGTCGATGAGGTGTGGAGAGATATCCACCGCGTTCCCGAGCCCACTGCCAAGGAGCAACAGAGGGCCAATAATTATGGGGAAATGACCCTCGAGGACTTTCTCGTCAAAGCGGGCGTGGTGCGCGAGGATTCCGAGTCCGGGAGCCCAGCTTCCAACAATACCAACACTTTCACTGCACCGTTTGCTGCTCCGTTGGCAAGCCAGAATCCCTTCCATGGGCCTACGGTTCTGGCCCAATCTACTCACCAAGCGGCCATGGAAGCGGCCATTGCACATAATCAGCATCAGCAGCATGTTGAATGGCACAATTATCAGCTCAAAAGCAATGCGATGCAACATCAGCAACATGTGCTTCAACAACAAGCTCAAGAAGCAGCTGCAGCTTATGCAATGCCGAAGCGGGGACCTGTGATCGCTCTCCCGGGAACTCCATCCGGGAGTGGTTTAGAGGGATCATCTGATGGGGGTTTGCAAGTAAACGGTCTTTCTCCAGCCATCACCACACCGGACACTCCGAACCGGGGCAGGAAGCGTGGTCCAGAGTCCATGCCAGAGAAGACAGTGGAGCGACGGCAGCGAAGAATGATAAAAAATCGCGAATCTGCCGCAAGATCACGGGCGAGGAAGCAAGCCTATACAGTAGAACTCGAGGCCGAAGTCAGCCAGTTGAAGGAGGAAAACAATCGGCTGAGGAAGGAGGTATGAAGGCTTTTTTGTGTGGTTGTGAGCAATACCTTGTCCTTTGGACTTCATTGCATGTACTGGACTCTAACGTTTTCCACTCGTATCCTTTGTGCTCGTGCAGATGGAGGAAGCGTCAAAGAGAAAGCGGGAGGAGTTGTTGATCCAGGAGGTACCGCCACGAAAGAACCAAGCCTTGCGGAGAAGTTGCTCAATCTCTTGGTGACGATTTTAAAGGTTTAAACCAACAAACAATATACAATTTTCCAGCACATCTGTGTTCAGCCTCAAACATTCTTCTCTCTCATTTCTTCGTACGGTAAGCGCTCCGAGCTCAAAGTCTCTTTATTTTTTTTTTCTCGAAAATTGCTCTGTTGGCTTACTTTTTGGAAAACCTGAAGTTAGTACTACACCATACTGATCGATGTTGTGGTAGCAGGTCCCGAATTGATCCTTGAAAATGATCAGGTTGGTCAGGTTGGTTGAAGTTGAGGATTTGATCGAGAGCTTTTCTTATCTTAAATCTGTTTCTGCCCTTAGGTATGATACTCGCCTGTCAAACACACCAGTCCCTCAGAAAGTAAGTAGAGTGGTGTAACAAGTGTATAGTTCTTCCGAGTTATATTGTCAAAAAGTAGGCGTACACATTTTCTCCTAAAGGACTGAGAATGTGTGCTTAGGTCAGTAGTAACAGTAGCAGGTTAGCTGTTCAAAGTACCGATAGAGAATCAGGAGTATTGCTTAGGTTTATACAGTGGCAATCCTCTATAATCACAATAACGAAATGTTTTTCCTCCTCGAGTGCCGATTTAAGCTGGCCTTCAGAAAGGTTGTATCTTGAGCTCATCCTTTGTATAGACACACTTCGCACTGTTGTTAATTCAAAGCTTGCGTTCCTGGTTTATTTTTCAGCGGC

mRNA

>Mapoly0069s0009.1
GTACTTGGCCGGTGAGCGGTAGCGCTTACCACCCCGTATACCTCAGGTACCTTGGGGCGTCGCTCTTATAGTGCGATTGAGCGTTGGCTGGCGAGGAGATTTGTTTCGATCAGTCGGGCGATCGAACATTGTTTGAGTCGATGATGGCTTCGACATCCGGGGGTGCCCAGATGGGCACCCGCAACGTGCCCTTCACGCCGATTACGAGGCAGAATTCGATTTTTTCTTTAACCCTGGACGAATTGCAGAACGCCATCGACCCTGGGAAGCATTTCGGGTCGATGAATATGGACGAGTTTCTGAAGAATGTTTGGTCCGCGGAAGAAAATCAGACCATGTCGCTGGCTATTTCGACCAGCAACGAGAGCAACGCCCCGCAGTCCTCGTCGGCCACGGGAGGCGGACTAGCTCGCCAGGGAAGTTTAACGCACCCAGGAAGTTTGTCACTGTCGCGGACCCTTAGTCGGAAAACGGTCGATGAGGTGTGGAGAGATATCCACCGCGTTCCCGAGCCCACTGCCAAGGAGCAACAGAGGGCCAATAATTATGGGGAAATGACCCTCGAGGACTTTCTCGTCAAAGCGGGCGTGGTGCGCGAGGATTCCGAGTCCGGGAGCCCAGCTTCCAACAATACCAACACTTTCACTGCACCGTTTGCTGCTCCGTTGGCAAGCCAGAATCCCTTCCATGGGCCTACGGTTCTGGCCCAATCTACTCACCAAGCGGCCATGGAAGCGGCCATTGCACATAATCAGCATCAGCAGCATGTTGAATGGCACAATTATCAGCTCAAAAGCAATGCGATGCAACATCAGCAACATGTGCTTCAACAACAAGCTCAAGAAGCAGCTGCAGCTTATGCAATGCCGAAGCGGGGACCTGTGATCGCTCTCCCGGGAACTCCATCCGGGAGTGGTTTAGAGGGATCATCTGATGGGGGTTTGCAAGTAAACGGTCTTTCTCCAGCCATCACCACACCGGACACTCCGAACCGGGGCAGGAAGCGTGGTCCAGAGTCCATGCCAGAGAAGACAGTGGAGCGACGGCAGCGAAGAATGATAAAAAATCGCGAATCTGCCGCAAGATCACGGGCGAGGAAGCAAGCCTATACAGTAGAACTCGAGGCCGAAGTCAGCCAGTTGAAGGAGGAAAACAATCGGCTGAGGAAGGAGATGGAGGAAGCGTCAAAGAGAAAGCGGGAGGAGTTGTTGATCCAGGAGGTACCGCCACGAAAGAACCAAGCCTTGCGGAGAAGTTGCTCAATCTCTTGGTGACGATTTTAAAGGTTTAAACCAACAAACAATATACAATTTTCCAGCACATCTGTGTTCAGCCTCAAACATTCTTCTCTCTCATTTCTTCGTACGGTCCCGAATTGATCCTTGAAAATGATCAGGTTGGTCAGGTTGGTTGAAGTTGAGGATTTGATCGAGAGCTTTTCTTATCTTAAATCTGTTTCTGCCCTTAGGTATGATACTCGCCTGTCAAACACACCAGTCCCTCAGAAAGTAAGTAGAGTGGTGTAACAAGTGTATAGTTCTTCCGAGTTATATTGTCAAAAAGTAGGCGTACACATTTTCTCCTAAAGGACTGAGAATGTGTGCTTAGGTCAGTAGTAACAGTAGCAGGTTAGCTGTTCAAAGTACCGATAGAGAATCAGGAGTATTGCTTAGGTTTATACAGTGGCAATCCTCTATAATCACAATAACGAAATGTTTTTCCTCCTCGAGTGCCGATTTAAGCTGGCCTTCAGAAAGGTTGTATCTTGAGCTCATCCTTTGTATAGACACACTTCGCACTGTTGTTAATTCAAAGCTTGCGTTCCTGGTTTATTTTTCAGCGGC

CDS

>Mapoly0069s0009.1
ATGATGGCTTCGACATCCGGGGGTGCCCAGATGGGCACCCGCAACGTGCCCTTCACGCCGATTACGAGGCAGAATTCGATTTTTTCTTTAACCCTGGACGAATTGCAGAACGCCATCGACCCTGGGAAGCATTTCGGGTCGATGAATATGGACGAGTTTCTGAAGAATGTTTGGTCCGCGGAAGAAAATCAGACCATGTCGCTGGCTATTTCGACCAGCAACGAGAGCAACGCCCCGCAGTCCTCGTCGGCCACGGGAGGCGGACTAGCTCGCCAGGGAAGTTTAACGCACCCAGGAAGTTTGTCACTGTCGCGGACCCTTAGTCGGAAAACGGTCGATGAGGTGTGGAGAGATATCCACCGCGTTCCCGAGCCCACTGCCAAGGAGCAACAGAGGGCCAATAATTATGGGGAAATGACCCTCGAGGACTTTCTCGTCAAAGCGGGCGTGGTGCGCGAGGATTCCGAGTCCGGGAGCCCAGCTTCCAACAATACCAACACTTTCACTGCACCGTTTGCTGCTCCGTTGGCAAGCCAGAATCCCTTCCATGGGCCTACGGTTCTGGCCCAATCTACTCACCAAGCGGCCATGGAAGCGGCCATTGCACATAATCAGCATCAGCAGCATGTTGAATGGCACAATTATCAGCTCAAAAGCAATGCGATGCAACATCAGCAACATGTGCTTCAACAACAAGCTCAAGAAGCAGCTGCAGCTTATGCAATGCCGAAGCGGGGACCTGTGATCGCTCTCCCGGGAACTCCATCCGGGAGTGGTTTAGAGGGATCATCTGATGGGGGTTTGCAAGTAAACGGTCTTTCTCCAGCCATCACCACACCGGACACTCCGAACCGGGGCAGGAAGCGTGGTCCAGAGTCCATGCCAGAGAAGACAGTGGAGCGACGGCAGCGAAGAATGATAAAAAATCGCGAATCTGCCGCAAGATCACGGGCGAGGAAGCAAGCCTATACAGTAGAACTCGAGGCCGAAGTCAGCCAGTTGAAGGAGGAAAACAATCGGCTGAGGAAGGAGATGGAGGAAGCGTCAAAGAGAAAGCGGGAGGAGTTGTTGATCCAGGAGGTACCGCCACGAAAGAACCAAGCCTTGCGGAGAAGTTGCTCAATCTCTTGGTGA

Protein

>Mapoly0069s0009.1
MMASTSGGAQMGTRNVPFTPITRQNSIFSLTLDELQNAIDPGKHFGSMNMDEFLKNVWSAEENQTMSLAISTSNESNAPQSSSATGGGLARQGSLTHPGSLSLSRTLSRKTVDEVWRDIHRVPEPTAKEQQRANNYGEMTLEDFLVKAGVVREDSESGSPASNNTNTFTAPFAAPLASQNPFHGPTVLAQSTHQAAMEAAIAHNQHQQHVEWHNYQLKSNAMQHQQHVLQQQAQEAAAAYAMPKRGPVIALPGTPSGSGLEGSSDGGLQVNGLSPAITTPDTPNRGRKRGPESMPEKTVERRQRRMIKNRESAARSRARKQAYTVELEAEVSQLKEENNRLRKEMEEASKRKREELLIQEVPPRKNQALRRSCSISW

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>