Mapoly0069s0060



Description

SERINE/THREONINE-PROTEIN KINASE RIO

Reference DB

Database ID Description
KOG KOG2462 C2H2-type Zn-finger protein
OrthoMCL OG5_141069
PANTHER PTHR10593 SERINE/THREONINE-PROTEIN KINASE RIO
PANTHER PTHR10593:SF20

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC2H2-10 transcription factor, C2H2-ZnF Mapoly0069s0060.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0069s0060.1 scaffold_69:713171..719955  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0069s0060.1  

Gene structure:

mRNA scaffold_69:713171..719955  ( - strand )
three_prime_UTR scaffold_69:713171..713881  ( - strand )
three_prime_UTR scaffold_69:714945..715018  ( - strand )
CDS scaffold_69:715019..715108  ( - strand )
CDS scaffold_69:715354..715465  ( - strand )
CDS scaffold_69:715865..716267  ( - strand )
CDS scaffold_69:716634..716934  ( - strand )
five_prime_UTR scaffold_69:716935..717516  ( - strand )
five_prime_UTR scaffold_69:718138..719955  ( - strand )

Sequences:

Gene

>Mapoly0069s0060.1
AATGAATAGGTTAAGCATCCGCCAGGTACCGAGCAGCAGTCGATGGCCTGGCCTGTCGTGCTCCCGATGGACGCCCGGCCTCTATGACGTATCTTGAACGAGGGAGATTGATTGATTCTTTCTATGTCGATGAGCCCAGCATGCAATCACAGCAGCAAGAATCCATTCCACACTCGTCTTTCGCATCTGGCTGGGAAAAGGTCGCGGACCCACTATCAAATCGAATCCCATCAGGTCGGGGTTATCACAAAGCATCGGACTGGATTCTAAACCCGTGTACTGCCACGCTTTGAGCCGTAGCGGTGCCGGACATCTCCTGAGAGAAATCACTCATCCATTCCTTTGTGCGGGTTCAGGCATTCGTACATTTGTTCGCTCGCTGATCTCTGAGGGAGGCCGGCCGGCCGCGAAAGCAGGCAAAGTGTGTGGGGGGCAATTCGCCTTTCGCAGAGGATCGTGCGTCCAATGGCTCGCAGTACAGTAATTGCAACCATGAGAATCGAGGACTTTCCATCGAGCGCATTCTTCAATCTCCACTGTGCTCTCCTCGCACATTCCTCCTGTACAGAGAGTGGATGTTCTTGTGTCCCTGGGAGGGGCTGCACTTTTCAGGGACTGCCGGTCGAGTGTGTTGCGGTGGTTAAATGAACCACGGTTGGACGGATGGACGGACCGACCGAGGGGTTGCGGGTGGGATGCATTGCGACGGAAGGAGGTGGGAATGGCGGTGAATGGAGCGGCAGTCGGTCATGATGGAGGAGGGGCGGAGAACCTACTGGAAGACAGGAGGTCGAGCACGGAGTTGGGACGGCACTGGCGAGAGGAGGTACCTGCCCCACCAAGTCGGTCCGGTCAACACGTTAATCAGCATTTAGGATAGATGAGGACCTTCGCCTATCAACGAGCATGGCGACGCACAGCGGGGAGTTACATCACGCGTCTTATCTTGACGTCTATGGGGCACAGCTTTAAGCGGCCTTTTAGCGGAATGGCCCCGTGCAGATGCCGGTCATCAAGAGGGGAGCCGCTCCGCCATCTCTCGTCAATAAAAAGCCACACCGCCACGACATCTCGACCGTCGGTGCCGACTGCATCCGGCGGTCGATCGTCGGGGGCCGGATCAGTGTCCGGTGGGTGCCAGCCAAATATGGGCGTACCGTGGGCGATCACGCTGGAAAAGGCGGGTGACGTGGCGGGAACGAGGAGATAACTCTGACGTGGTGGGCTACTAGGGTGACGTGGGAGCGAAGCGTCTAGGGTTCCCCGGCCTGGCCATGGCTATGGCGGACGCTCAACCAGGGGTCAGCTCTCTCGCAAGCTATTGAATATTCTCGGGAAATGGAAGCGCCTGATCTCACCCCCTTGCAATTTCTCCTTCCTTCGTCCCTTGCCTTGCCTTGCCCTTCCTCCTCCTCCCTCCCCCTCACTCCCCCTCCGTCCTTCTGATCCCCATTCCTGTCTGGTCTGGCGAGCTCGCCTTGCTCAAACTGCACTGAACTGAAAATTGCGAGCAGCAAACGACAAGCCTGTGTTGTTAGTTCGTTGGCTCATTGTGTTGTTGTTTTGTTGTCTTTGTGCGGTGTCCGGTGGCGTACGCTGTCTCCTAGTTCGGCTCGAATGATCAGTGAGTGAGGGAGTGAGTGAGGGAGAGAGTAGTGACGGACTAGAATGAGTGTGTAAAGAGTGAAGGAGTACTGGGAGGCAACTCGGCGTCCGTTGGCGATTTCTCCCCAGTCGAATACGGAAATGAATTTTAGCAGCAGTCAGGCCAGCGATAACCCTTAAGGTTCACTGACCTGAGAATTGTCGCATCCGCAGGTGAGTGATGACGGCTGTCGGTGCTCACTGACTTCCTTCGATTTTTCATCGTTTGTTCGTTGTGGAATCAGAAGCCGCTGGCTTGGTTCTACAGGGGGAAGACGACGAGGCACGCTCAGTGTTGAATTTTGTATTTGTCGTCTCGTCTCCTGTGCACACGGGATTAGTCATAGGGGCTTGGACGGTAATGCATTTCACTACCGAAGGCAGCTGAAAAGAGTGTGCAGCCTTTACATGAAGCTGTGGCTCGTGTATGGTGTCTCGTGATAGCAGAGGATGCATGCGAATTCTGGAGCCTCTTTGGCCTGAAGCAATTTGAGAATTGCATATTTAGCATGAGCTCTCACGGAGCACTCTGGTTATGCTATGAACCACTCTAGAGCACGTTGGATGGCTCGTCGCGAACTTTTGATGATTGTGCAGTCCTTATCATTGGACGTAGACCAACACCGACTACGTGAAGCCCACCAAATGTTGCATATTGTGTTTCTTCGTCAGAAGTTACGGTTTTGTTGCATTAGAGGTTCCAATATCTGCCCCCATCAGTGTGGTGACAGAGTTTTGAATTTGAACACCGTGAATCAAAGTGACATTTGGAGAATTATGCCTGTCGATTTCCAGGTCGGCGACAGGGTTTGGCATCTACAAACGAAAGGTCATCATTTACATTCGTTTCGTCACTCTTTAATGCCACTTTTGTGTGGCCTCATGAGCAGATTCTCATTTTTACCCATGGTGATGCGAGTCGTCACGCAGTACAGTGCAATATTGCCCATGATTTGATTGAGGAGGCTACGAATCTCCGTGCGAAGTTCTCTGAGTTATCACGTGTAGTGTTGGCATGCCGAAAGATTGTAAAAATTTTGTGCCGTTCACTGCAACGAACGACTGATGCGATGGTCAAGAGTGTGCGCTTGGATGTGTTTGTACGGGAAGTTCTAAACCAAAGTTAACAGCGAAGATGAGGCGAAGAATGGAGTCGCGTGCTCGTGATTCAACAACTAAGAAAGCCGTTTGATCACTCGTTAAATGTTGTGGGTTTTGGTGAGGTTGCAAGCAGCTGAGTACTGAGTACACATGTACAATGGGTAATATGCAGAGGATTGAGAGGAAGAAATCGACGGTTTTCCAAAGTACATGTGGATAAGCTGTTCAGAAACTTTTCTTCTCTTTGGAAAAGTAAGGTGGAGTTAACGGAGAAACATGCTAGGCGAAGTGGAGAGCGTTACTGATAAGATGGCGTCTTCAAGTTGTACGTCACCTTCAGTTAACGAGCCGATGTCAGGAACCGAGCCAACCTCAGCAGATAGCGTTTCGGAAGAGGAGCTTTCACTGGATGTAAAACCAATTATAGTTGAGACAACACAGGCTCCCTCCTGTACCGAGCTAGTATCAGTACAGTTACCGGCCATTAACACGACTACCACGTCTGCAACCCTCAATGTGCAGAACAATGAGAAACAACAGGGCGTTAAGAGGAAACGAAATCTTCCTGGAACCCCAGGTAAGGTGTGGTTTGTGGCTAAAGATCACGCTTGAATCATCTGGTCCGCCTAAGAAGAAACTTTTGTCTGATTAGCATGTTCACGTGAAATCCACAGTCTTGTACAGAATTATCTACTGTTCGATTATCCATCCCTAAGTCGAGGGATGGATAATTTGCGATTAGGGACTTGTACCAACTCTTGTACGAAGCATTAACTAGTCATTACAGGCAATATGTTTATATGGTGCAGTTTGCTGCACGGGCTTTGTACATATTTCTCCTGGTTGAAACGGGCGTTGTGTTGAAGTTGCAAATACCAATGACATATATATATGTCATAATTTATATTTAAATCTTGATTGGACGAGTTTTTGATATGCGCAGATCCAGATGCTGAAGTAGTCGCACTTTCGCCTAAGACGTTGATGGCTACTCACAAATTTACCTGCGAAGTTTGTGGTAGAGGTTTTCAGAGGGAACAGAACCTACAATTACACAAGCGCGGGCACAATCTTCCTGGTAGCCTGAAACCTAGAGCTAATAAAGACAAGGAGATTCGAAAGAAAGTCTATGTCTGTCCAGAGCCGACTTGTGTTCATCATGATCCTGCCCGGGCATTGGGAGATCTGACCGGCATAAAGAAACACTTCTGTAGAAAGCACGGAGAGAAGAAATGGAAGTGCGATAAGTGCTGTAAAAAGTATGCGGTTTTGTCAGACTGGAAAGCACATTCGAAAACATGTGGGACGCGAGATTATAAATGCGAATGCGGAAGTATATTTTACAGGTGAATTTTCCAGCTTCAAACTCCCCTTGCCTTTTTTAACTCCCAGCGTATTTAACGTAAAAATTTAATGATTATGAAGAGGTTCTGAACATATTATTCCACTCAAAAACCAAATATTAGTTGGAAATTCTAGAGGACAATTCTTCAACCTTACTGTCCATGTCTGCTCTCAAGAAGCGTGATTTTCATCGTTGGAAGGTTCGATGTTATGTTTTGGTAACGTTTCAACCTCTTTACGGGGAGGGGTCCTTTCTACAGATAGTCACCAAACTGTGGACTTGAATGAAACTGTTGGGATGATCTGTAGGTACTAATGAGATTCTTAGGTTTTGGTGTTTTTGCTTAGATTCGGAAATGGTGAATAACGGATACCTAAGCTGATTTTTTTTCTTTTTGCAGAAGAGATAGTTTTGTCACTCACAAAGCATTTTGTGATGAATTGGCCGAAGAGAGTGCAAGACTCGCCGCAGGGTCTAGTGAACCTCCTGCCCCCGTTCTTCTCTTGGATGCTGTAAGCAATTCGTCCTCAATCTCACTAGAACTACTCTTGAAATGTATTGAGCCCAAGGTGTAGGGGTTCTATAACCTAGTGGTGGACAAGCTACGCCCTTGCATGACGCAGCAGCTCACAAGTGTTCCTTTTTTCAAGTTGTTGGAAGTAACTTTGAGTCGAGATATAGGACGACGCATGCAACAGGTCTCTGCTTCATAATAATATATTATTGATTCCTTGGATGAAACTGGATCCCTTTTCAGATGCCTCCTGAGGACAAGGACGAACCTGTCAGCTATCGACAGCTTCTTGGAGAAGATGACATTGACGATAACGATCAAGCCGGGGCTTGAACCAGAGAAAATTAGAAGATTGAAAGACACTTTGGAGATTAAATGTGAAGAATTTTTCTCATTGAAAGGTACAGGTGTGGTGATCCCTATCTTGATCCCCGACTATGCTTTGAAAGCTTTTATCTCAATTACGAAATTGCTACTTTAGTGATTTTTGGAAGAGGTGCTAGTGACATCAGGGGTGAAATACTCGTGTAGTTTGTTTTTCCGGTCAATTTCCTACAGCTTCCTACAAGTAGTTTGCAGATGTATGTTGTCGATTGCTAAGACTTTTTCCTTGGATCGTCAGCTCCATGTTTGTTTCAGCTTTGTGAAACAAACACTGTCCAACAAAAAACCCTATCTCATCGCAATCAGTTGCATCTGTATCCTATAGCATTATCTACTGTGAGCGAATGACATAATTGAGTCGTTTCGTCTCAATTAATCTTTCTTCCCTTCCAATCCTTTTCCTAGTCACTAGCACCACACGCATGTATCAGTACATTCAGTTTCGGTCAGGGATAATTTCCATCAACAACGAGAAGCTCAGGTGGATGGTTATAACCTAGGTAGGTTACACTAGTGGGAAGGGTATGGTGTCACGAGGTCTTTAGGAAAGTTTTTGGATAAATACCTTCACCCCTGAATTCAATAAACTATCTTGCTGAATCAGGACTTTTCTTCAAGTTCAAGACATAGTGCTATTCGTATTTGTCGCTGTGATTAACACTTTGTTCTGGGTCCATGTAACAAGAAGTTCAAACGATGTCAAAGGACGAGACTTGAAACCTGGCATGAATGTTGGGAAGAACCACATTTTTGGAGAACTACTCAGCCAGGGCCCCATGGTCTTCAGACTATGGCTTATACAATCATATGAGAATCTCTGTATTGTACTCCGCGTTGTCCCATTTCCCTTCTTCGTTAGCATTTTCTAGACTGGGCTTGGGTTGTATAACTTCATCCTGTAACTGAGGATCACTTTATCTACAACGATCATCTTGCGGAGATGTCGATCTGGATATGCCTGTCGCTGTCATGGACTCATTATACACATAGATAACATATACTTTACATTTTAAAAAATTTGCCCCGGCAGTGTCAGCCCAGCATATGAATTGGTTTCTGACTATGGTGGTTGGCTTTCTGATATAGGTCGAGCACGCTACGCCGCATGAGATGATTTGTAAGAGCCGAGGACGCGTAAGGAATGGAAACTGCAGAGGTGAATTGTGCATCCTTTTTGAAGTACTTTTGCAGCCATTCCAGCTAGGAACTGGTCCTTTCTGCAACAGAGACTAGTAGAAAGCGTTCCGATTCTCACACTTCACTTGTATTGTACTCCGTTATAGAAGGCCCTGGGAGCTGTTTCCGACTTTGAAAGTTGAGCTAGAGTATCAACCCCACTCAGCTGCAGCTACCAACCCTTAGAGATGAGAAGATCTGCGGTATACAACCGAGTCTTATGTACTATTTATGGGTTACATTAGCCCGAAAGGATGTAGAGCTTTTAGATGTTCACACGAGCTGATTAGGATATTTTTTGTTTTGTGTTCTGCCTTGATTTGCAGTGGTTCATGTTACCAGCACTTTCTGATGTACAAGTTTTGCAGAATCTCTTTAGAGTTTATCAGTCCCATCACCATCTGTCTTCGAGATCTTTTGTGACCAAGTGTATACTGTGCTCGGCACTATATTTGGTGATTGTGATTGTAGTGCACGTAATGATTATCAGCTCGAACAGTTTGACACGGATTACAAAATCAATCTTCAATTTTGTTTTTTGTTAAGTCATCCAATCTGACCTAATATACATTTAGGTTCAAAATGACCATCTTAAAGCTAAAGGTTGCAGTTTAGTATAGC

mRNA

>Mapoly0069s0060.1
AATGAATAGGTTAAGCATCCGCCAGGTACCGAGCAGCAGTCGATGGCCTGGCCTGTCGTGCTCCCGATGGACGCCCGGCCTCTATGACGTATCTTGAACGAGGGAGATTGATTGATTCTTTCTATGTCGATGAGCCCAGCATGCAATCACAGCAGCAAGAATCCATTCCACACTCGTCTTTCGCATCTGGCTGGGAAAAGGTCGCGGACCCACTATCAAATCGAATCCCATCAGGTCGGGGTTATCACAAAGCATCGGACTGGATTCTAAACCCGTGTACTGCCACGCTTTGAGCCGTAGCGGTGCCGGACATCTCCTGAGAGAAATCACTCATCCATTCCTTTGTGCGGGTTCAGGCATTCGTACATTTGTTCGCTCGCTGATCTCTGAGGGAGGCCGGCCGGCCGCGAAAGCAGGCAAAGTGTGTGGGGGGCAATTCGCCTTTCGCAGAGGATCGTGCGTCCAATGGCTCGCAGTACAGTAATTGCAACCATGAGAATCGAGGACTTTCCATCGAGCGCATTCTTCAATCTCCACTGTGCTCTCCTCGCACATTCCTCCTGTACAGAGAGTGGATGTTCTTGTGTCCCTGGGAGGGGCTGCACTTTTCAGGGACTGCCGGTCGAGTGTGTTGCGGTGGTTAAATGAACCACGGTTGGACGGATGGACGGACCGACCGAGGGGTTGCGGGTGGGATGCATTGCGACGGAAGGAGGTGGGAATGGCGGTGAATGGAGCGGCAGTCGGTCATGATGGAGGAGGGGCGGAGAACCTACTGGAAGACAGGAGGTCGAGCACGGAGTTGGGACGGCACTGGCGAGAGGAGGTACCTGCCCCACCAAGTCGGTCCGGTCAACACGTTAATCAGCATTTAGGATAGATGAGGACCTTCGCCTATCAACGAGCATGGCGACGCACAGCGGGGAGTTACATCACGCGTCTTATCTTGACGTCTATGGGGCACAGCTTTAAGCGGCCTTTTAGCGGAATGGCCCCGTGCAGATGCCGGTCATCAAGAGGGGAGCCGCTCCGCCATCTCTCGTCAATAAAAAGCCACACCGCCACGACATCTCGACCGTCGGTGCCGACTGCATCCGGCGGTCGATCGTCGGGGGCCGGATCAGTGTCCGGTGGGTGCCAGCCAAATATGGGCGTACCGTGGGCGATCACGCTGGAAAAGGCGGGTGACGTGGCGGGAACGAGGAGATAACTCTGACGTGGTGGGCTACTAGGGTGACGTGGGAGCGAAGCGTCTAGGGTTCCCCGGCCTGGCCATGGCTATGGCGGACGCTCAACCAGGGGTCAGCTCTCTCGCAAGCTATTGAATATTCTCGGGAAATGGAAGCGCCTGATCTCACCCCCTTGCAATTTCTCCTTCCTTCGTCCCTTGCCTTGCCTTGCCCTTCCTCCTCCTCCCTCCCCCTCACTCCCCCTCCGTCCTTCTGATCCCCATTCCTGTCTGGTCTGGCGAGCTCGCCTTGCTCAAACTGCACTGAACTGAAAATTGCGAGCAGCAAACGACAAGCCTGTGTTGTTAGTTCGTTGGCTCATTGTGTTGTTGTTTTGTTGTCTTTGTGCGGTGTCCGGTGGCGTACGCTGTCTCCTAGTTCGGCTCGAATGATCAGTGAGTGAGGGAGTGAGTGAGGGAGAGAGTAGTGACGGACTAGAATGAGTGTGTAAAGAGTGAAGGAGTACTGGGAGGCAACTCGGCGTCCGTTGGCGATTTCTCCCCAGTCGAATACGGAAATGAATTTTAGCAGCAGTCAGGCCAGCGATAACCCTTAAGGTTCACTGACCTGAGAATTGTCGCATCCGCAGGTCGGCGACAGGGTTTGGCATCTACAAACGAAAGGTCATCATTTACATTCGTTTCGTCACTCTTTAATGCCACTTTTGTGTGGCCTCATGAGCAGATTCTCATTTTTACCCATGGTGATGCGAGTCGTCACGCAGTACAGTGCAATATTGCCCATGATTTGATTGAGGAGGCTACGAATCTCCGTGCGAAGTTCTCTGAGTTATCACGTGTAGTGTTGGCATGCCGAAAGATTGTAAAAATTTTGTGCCGTTCACTGCAACGAACGACTGATGCGATGGTCAAGAGTGTGCGCTTGGATGTGTTTGTACGGGAAGTTCTAAACCAAAGTTAACAGCGAAGATGAGGCGAAGAATGGAGTCGCGTGCTCGTGATTCAACAACTAAGAAAGCCGTTTGATCACTCGTTAAATGTTGTGGGTTTTGGTGAGGTTGCAAGCAGCTGAGTACTGAGTACACATGTACAATGGGTAATATGCAGAGGATTGAGAGGAAGAAATCGACGGTTTTCCAAAGTACATGTGGATAAGCTGTTCAGAAACTTTTCTTCTCTTTGGAAAAGTAAGGTGGAGTTAACGGAGAAACATGCTAGGCGAAGTGGAGAGCGTTACTGATAAGATGGCGTCTTCAAGTTGTACGTCACCTTCAGTTAACGAGCCGATGTCAGGAACCGAGCCAACCTCAGCAGATAGCGTTTCGGAAGAGGAGCTTTCACTGGATGTAAAACCAATTATAGTTGAGACAACACAGGCTCCCTCCTGTACCGAGCTAGTATCAGTACAGTTACCGGCCATTAACACGACTACCACGTCTGCAACCCTCAATGTGCAGAACAATGAGAAACAACAGGGCGTTAAGAGGAAACGAAATCTTCCTGGAACCCCAGATCCAGATGCTGAAGTAGTCGCACTTTCGCCTAAGACGTTGATGGCTACTCACAAATTTACCTGCGAAGTTTGTGGTAGAGGTTTTCAGAGGGAACAGAACCTACAATTACACAAGCGCGGGCACAATCTTCCTGGTAGCCTGAAACCTAGAGCTAATAAAGACAAGGAGATTCGAAAGAAAGTCTATGTCTGTCCAGAGCCGACTTGTGTTCATCATGATCCTGCCCGGGCATTGGGAGATCTGACCGGCATAAAGAAACACTTCTGTAGAAAGCACGGAGAGAAGAAATGGAAGTGCGATAAGTGCTGTAAAAAGTATGCGGTTTTGTCAGACTGGAAAGCACATTCGAAAACATGTGGGACGCGAGATTATAAATGCGAATGCGGAAGTATATTTTACAGAAGAGATAGTTTTGTCACTCACAAAGCATTTTGTGATGAATTGGCCGAAGAGAGTGCAAGACTCGCCGCAGGGTCTAGTGAACCTCCTGCCCCCGTTCTTCTCTTGGATGCTATGCCTCCTGAGGACAAGGACGAACCTGTCAGCTATCGACAGCTTCTTGGAGAAGATGACATTGACGATAACGATCAAGCCGGGGCTTGAACCAGAGAAAATTAGAAGATTGAAAGACACTTTGGAGATTAAATGTGAAGAATTTTTCTCATTGAAAGGTACAGGTCGAGCACGCTACGCCGCATGAGATGATTTGTAAGAGCCGAGGACGCGTAAGGAATGGAAACTGCAGAGGTGAATTGTGCATCCTTTTTGAAGTACTTTTGCAGCCATTCCAGCTAGGAACTGGTCCTTTCTGCAACAGAGACTAGTAGAAAGCGTTCCGATTCTCACACTTCACTTGTATTGTACTCCGTTATAGAAGGCCCTGGGAGCTGTTTCCGACTTTGAAAGTTGAGCTAGAGTATCAACCCCACTCAGCTGCAGCTACCAACCCTTAGAGATGAGAAGATCTGCGGTATACAACCGAGTCTTATGTACTATTTATGGGTTACATTAGCCCGAAAGGATGTAGAGCTTTTAGATGTTCACACGAGCTGATTAGGATATTTTTTGTTTTGTGTTCTGCCTTGATTTGCAGTGGTTCATGTTACCAGCACTTTCTGATGTACAAGTTTTGCAGAATCTCTTTAGAGTTTATCAGTCCCATCACCATCTGTCTTCGAGATCTTTTGTGACCAAGTGTATACTGTGCTCGGCACTATATTTGGTGATTGTGATTGTAGTGCACGTAATGATTATCAGCTCGAACAGTTTGACACGGATTACAAAATCAATCTTCAATTTTGTTTTTTGTTAAGTCATCCAATCTGACCTAATATACATTTAGGTTCAAAATGACCATCTTAAAGCTAAAGGTTGCAGTTTAGTATAGC

CDS

>Mapoly0069s0060.1
ATGCTAGGCGAAGTGGAGAGCGTTACTGATAAGATGGCGTCTTCAAGTTGTACGTCACCTTCAGTTAACGAGCCGATGTCAGGAACCGAGCCAACCTCAGCAGATAGCGTTTCGGAAGAGGAGCTTTCACTGGATGTAAAACCAATTATAGTTGAGACAACACAGGCTCCCTCCTGTACCGAGCTAGTATCAGTACAGTTACCGGCCATTAACACGACTACCACGTCTGCAACCCTCAATGTGCAGAACAATGAGAAACAACAGGGCGTTAAGAGGAAACGAAATCTTCCTGGAACCCCAGATCCAGATGCTGAAGTAGTCGCACTTTCGCCTAAGACGTTGATGGCTACTCACAAATTTACCTGCGAAGTTTGTGGTAGAGGTTTTCAGAGGGAACAGAACCTACAATTACACAAGCGCGGGCACAATCTTCCTGGTAGCCTGAAACCTAGAGCTAATAAAGACAAGGAGATTCGAAAGAAAGTCTATGTCTGTCCAGAGCCGACTTGTGTTCATCATGATCCTGCCCGGGCATTGGGAGATCTGACCGGCATAAAGAAACACTTCTGTAGAAAGCACGGAGAGAAGAAATGGAAGTGCGATAAGTGCTGTAAAAAGTATGCGGTTTTGTCAGACTGGAAAGCACATTCGAAAACATGTGGGACGCGAGATTATAAATGCGAATGCGGAAGTATATTTTACAGAAGAGATAGTTTTGTCACTCACAAAGCATTTTGTGATGAATTGGCCGAAGAGAGTGCAAGACTCGCCGCAGGGTCTAGTGAACCTCCTGCCCCCGTTCTTCTCTTGGATGCTATGCCTCCTGAGGACAAGGACGAACCTGTCAGCTATCGACAGCTTCTTGGAGAAGATGACATTGACGATAACGATCAAGCCGGGGCTTGA

Protein

>Mapoly0069s0060.1
MLGEVESVTDKMASSSCTSPSVNEPMSGTEPTSADSVSEEELSLDVKPIIVETTQAPSCTELVSVQLPAINTTTTSATLNVQNNEKQQGVKRKRNLPGTPDPDAEVVALSPKTLMATHKFTCEVCGRGFQREQNLQLHKRGHNLPGSLKPRANKDKEIRKKVYVCPEPTCVHHDPARALGDLTGIKKHFCRKHGEKKWKCDKCCKKYAVLSDWKAHSKTCGTRDYKCECGSIFYRRDSFVTHKAFCDELAEESARLAAGSSEPPAPVLLLDAMPPEDKDEPVSYRQLLGEDDIDDNDQAGA

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>