Mapoly0069s0069



Description

HD-ZIP protein N terminus

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0005634 Nucleus
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
KEGGORTH K09338 Homeobox-leucine zipper protein
KOG KOG0483 Transcription factor HEX, contains HOX and HALZ domains
OrthoMCL OG5_150040
PFAM PF00046 Homeobox domain
PFAM PF02183 Homeobox associated leucine zipper
PFAM PF04618 HD-ZIP protein N terminus
PANTHER PTHR24326 FAMILY NOT NAMED
PANTHER PTHR24326:SF105

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC2HDZ Homeodomain protein Public
MpHD14 transcription factor, HD Mapoly0069s0069.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0069s0069.1 scaffold_69:864309..867428  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0069s0069.1  

Gene structure:

mRNA scaffold_69:864309..867428  ( + strand )
five_prime_UTR scaffold_69:864309..865235  ( + strand )
CDS scaffold_69:865236..865539  ( + strand )
CDS scaffold_69:865739..866052  ( + strand )
CDS scaffold_69:866178..866257  ( + strand )
CDS scaffold_69:866525..866804  ( + strand )
three_prime_UTR scaffold_69:866805..867428  ( + strand )

Sequences:

Gene

>Mapoly0069s0069.1
CAGCAGCTGGTCTGAAATCCCCCACCTCCTTACATTCGAGCAACACAATTGGCATTCTAGTTTCTCTCGTGACCCGTCTCCCACTGCAAGTCGCTCTCACCTCCCTCTCTCTCTCACTCTCTCTCTTTCTCGGGTCTCCTCTCCTGCTCGCCTATCTCTATCTCGTCCGCTTTCCAGCTCCAGTCATTCTCTCATCCGCTTGCGTGCTCGCTCTCCCTTCCAATCTCTGTCAATCTTTCTCCCTCTCTCTCTCTCTCACTCTCACTCTCTTCTCGGCCTGCCCCACTGGGCGAGTGCTGTGTTGCGCACACAAGTCGAACATTCCACTGTTAGTTTGTCTGTATGACTGTCCGGCTCTAGCAGGCAAGGCGAAGAAGGTTGGCCTGGCGGGCAGAGGCTGGAATTTGAAGAAGAAACCAGCAGTCGCGTTCCATCGTCTTCTGCTTCTTCTTCTTCTTGCTCCGTGCTCGCTTTTCGAACGAGTTTCGTAGCGAGTGCCATTCGCTCGGCGTACAGACCAGCCCAGCTCTCTGTGGCAGGCAGGCAGGCAGGCAGGCAGGCCTTGCTCTCTCCTGCAGCTCTGGAACAGGAAGGCTCTCGAAAGACTGCGAGGTAACGCGCAGCTCCTTCTCGGCTTCGCTGTTCTCGGTTCTCTGCAATCTCTCATTCACGATCGGAGCTCGGCGGGTCGAGCATCACGGATTGCTCAGACGAACCATTTCGGCTGTGCGTGCCGGGAGGAACCCGTCGTCCGTCAATCAGTTGGTCTTTCATGCTGCTGACGTCGAGGATTTTCTCGTCTCAGAGCGTGGCGACGTGAGCCTGAGAAATACGGACGGCTTGGCTTGGTTCTGGTGGTGGTGGTGGTGTCGGTGTCGGAGCCGGCTCTGAACACGACGAGGAAGCAAGACTTGACAATCAGTCTAGATGATGCTCCTAGCGGAGGGGAAGGATAGATTACGGGAGGAGGTGCAGCGGCTTAGGGCGATGCAAGGCTCCGGAGCGAGCTTGAGCCTCAGCGTAGACTTGAGCATGATGGTAGCGAGGAGCCAGGACGATTGCTCCACCGTAAGACGGCAGTGCCCCGTGCAACTGGATCTGCTGCCCATGCCCACTTTTCCATCGGCTGCAGCAGCCCCGCACCCTCCCACGCAGCAGTCGCAGTCGCAGTCCCACAATCCCTTCCCGTGGAAACCTCTCTTCAACAGATCCCGTTCCAACTCTGCCAGTGGTATGCATTCTAGCGCCTCTACCTCTCGTGTCTTTTTGTTTTCGCTCCTCTGCTCGTGAAGCACTGTCATGCGTCTTCCATTTCATCTGTTGCCTCTGTTGGTTCTCTGTTGATTCTGTACGTCCTCGCTGCGCAATCGGCGCGCGTGTTGGGTGCAATTTGCTGTCCCTGACGTGCAATTGGTGCTCATTGTGCTCAGGTAATGAAGACATCGAGGCGGCGGAAACTTACTCCTCGGGACACGGAGGATCACCTCGAGGAATCGACGTCAATCAAATCCCGTCTTCAGCCGATTGCGACGACGTGGTGGTCTCGTCCCCCAACAGCATCAATCTGAAAAGGGAGAGGGAGAAAACGCACGATTTTGACCTGGAACGCGACCGCACGTGTGACATTTCCTCGAGAGGCAGCGACGAGGAAGAAGGGGGCACCACGAGGAAGAAGCTCAGACTGTCCAAGGAGCAGTCGGCTCTCCTCGAGGAAAGCTTCAAAGAGCACAGCACCCTCAACCCGGTACTAATCTCACCCGCCTGCCTCTTCGTCCGTTTCCACCCTTGTGTCCTCTTCTTGCTCATGGCCTGCAAAGACTCTCTGGCCTTCTTCGTCCATTCTAACTCCATTGTTGTTCGGCTTTTCAGAAGCAAAAGAACGCACTCGCCAAGCAGTTGAACTTGCGGCCTCGCCAAGTCGAAGTTTGGTTCCAAAACAGAAGAGCAAGGTACTTTCACGATTCATTGGAATTGGTTCAGTTCGCAGCTGTCGTTGTTTGGCGTAGTGTTTGGTATAAGGGCCTGGCTCGGCTGGATTGGATGAAAGCGAGATCTTATTTACGATGATGGTGGTCGAGTGAGTCGGTAGAGGAAAGAGTCGTTCTGTCAGTATCTGGTATTTGTCAAGGGGCGGGCGGGGCTAGCGAGCGATGTGAGTGAAGGTCGGAAGGGCACGACTGGACCCGAGTCTGACGTGAAGGCTGATGATTGTGCAGGACCAAGCTGAAACAAACCGAGGTCGATTGCGAGCTTCTGAAGCGATGCTGCGAGACTCTGACGGAGGAGAACCGGAGACTGCAGAAGGAGCTGCAGGAGCTGAGAGCGCTGAAGGTGGCTCCTCCGTGTGTCATTGCGCACGACTTCTACATGCCGCTACCTGCCGCCACCCTGACCATGTGCCCATCCTGTGAAAGAGTAACCACCATGGACAACAAGACACTTGCCTTCGCCAAGCCCGGATTCTCCCACTACTCGCAATCCTCGGCCGCATGTTAGAGGCGGCCGGATCGAAGCACAGACAGGAAGGAAGGATGGAGGGTGAAGAAGCCACAGGAAAGGTGGAACGAACGGTAGGTAGGTTGTATACATTCACATGACACACAGACAGACATCGAGGACTCTTAAAGGCCTCCTGTAATATTGTTACTCACTCACTCACTCACACTCAAGAGCTCAATGATCATTTGTGTATTTCTCAAGTTAGCATAGAATTCTTCCACACTGGAAGCTTGTAATTGACAACAATGTAGACATCATGTTAAAAACGGTCGCAGTGTACACGATCTAGATTTTTTAAAGATCTGAGCAGCTGCCCAAATTGAAGATCAGTGGTCTGATCGCACTCAATGCAGCGAGATGATAGTGCATGCAGGCAGCCAGCCATGTAAGTAGTTGGTAGGATAGAGGTATGGATGATCTTTGTGCAACCAGCAGTTCCATACATGAGTTTGACCCTGAGTGATTATACTGTCAATGTCTCAATTCTGCCGGCCCCTCGGCAGTCTGGCCCTGAGTGTTTCATTCTTGAGCAAAATCGACGGAGCGAATCTACGATCAAACCCGGGTTCACATTTTTGTATGGCCTTGTTGAAATAAAGATGCTTTACTGGAAACTTCTCA

mRNA

>Mapoly0069s0069.1
CAGCAGCTGGTCTGAAATCCCCCACCTCCTTACATTCGAGCAACACAATTGGCATTCTAGTTTCTCTCGTGACCCGTCTCCCACTGCAAGTCGCTCTCACCTCCCTCTCTCTCTCACTCTCTCTCTTTCTCGGGTCTCCTCTCCTGCTCGCCTATCTCTATCTCGTCCGCTTTCCAGCTCCAGTCATTCTCTCATCCGCTTGCGTGCTCGCTCTCCCTTCCAATCTCTGTCAATCTTTCTCCCTCTCTCTCTCTCTCACTCTCACTCTCTTCTCGGCCTGCCCCACTGGGCGAGTGCTGTGTTGCGCACACAAGTCGAACATTCCACTGTTAGTTTGTCTGTATGACTGTCCGGCTCTAGCAGGCAAGGCGAAGAAGGTTGGCCTGGCGGGCAGAGGCTGGAATTTGAAGAAGAAACCAGCAGTCGCGTTCCATCGTCTTCTGCTTCTTCTTCTTCTTGCTCCGTGCTCGCTTTTCGAACGAGTTTCGTAGCGAGTGCCATTCGCTCGGCGTACAGACCAGCCCAGCTCTCTGTGGCAGGCAGGCAGGCAGGCAGGCAGGCCTTGCTCTCTCCTGCAGCTCTGGAACAGGAAGGCTCTCGAAAGACTGCGAGGTAACGCGCAGCTCCTTCTCGGCTTCGCTGTTCTCGGTTCTCTGCAATCTCTCATTCACGATCGGAGCTCGGCGGGTCGAGCATCACGGATTGCTCAGACGAACCATTTCGGCTGTGCGTGCCGGGAGGAACCCGTCGTCCGTCAATCAGTTGGTCTTTCATGCTGCTGACGTCGAGGATTTTCTCGTCTCAGAGCGTGGCGACGTGAGCCTGAGAAATACGGACGGCTTGGCTTGGTTCTGGTGGTGGTGGTGGTGTCGGTGTCGGAGCCGGCTCTGAACACGACGAGGAAGCAAGACTTGACAATCAGTCTAGATGATGCTCCTAGCGGAGGGGAAGGATAGATTACGGGAGGAGGTGCAGCGGCTTAGGGCGATGCAAGGCTCCGGAGCGAGCTTGAGCCTCAGCGTAGACTTGAGCATGATGGTAGCGAGGAGCCAGGACGATTGCTCCACCGTAAGACGGCAGTGCCCCGTGCAACTGGATCTGCTGCCCATGCCCACTTTTCCATCGGCTGCAGCAGCCCCGCACCCTCCCACGCAGCAGTCGCAGTCGCAGTCCCACAATCCCTTCCCGTGGAAACCTCTCTTCAACAGATCCCGTTCCAACTCTGCCAGTGGTAATGAAGACATCGAGGCGGCGGAAACTTACTCCTCGGGACACGGAGGATCACCTCGAGGAATCGACGTCAATCAAATCCCGTCTTCAGCCGATTGCGACGACGTGGTGGTCTCGTCCCCCAACAGCATCAATCTGAAAAGGGAGAGGGAGAAAACGCACGATTTTGACCTGGAACGCGACCGCACGTGTGACATTTCCTCGAGAGGCAGCGACGAGGAAGAAGGGGGCACCACGAGGAAGAAGCTCAGACTGTCCAAGGAGCAGTCGGCTCTCCTCGAGGAAAGCTTCAAAGAGCACAGCACCCTCAACCCGAAGCAAAAGAACGCACTCGCCAAGCAGTTGAACTTGCGGCCTCGCCAAGTCGAAGTTTGGTTCCAAAACAGAAGAGCAAGGACCAAGCTGAAACAAACCGAGGTCGATTGCGAGCTTCTGAAGCGATGCTGCGAGACTCTGACGGAGGAGAACCGGAGACTGCAGAAGGAGCTGCAGGAGCTGAGAGCGCTGAAGGTGGCTCCTCCGTGTGTCATTGCGCACGACTTCTACATGCCGCTACCTGCCGCCACCCTGACCATGTGCCCATCCTGTGAAAGAGTAACCACCATGGACAACAAGACACTTGCCTTCGCCAAGCCCGGATTCTCCCACTACTCGCAATCCTCGGCCGCATGTTAGAGGCGGCCGGATCGAAGCACAGACAGGAAGGAAGGATGGAGGGTGAAGAAGCCACAGGAAAGGTGGAACGAACGGTAGGTAGGTTGTATACATTCACATGACACACAGACAGACATCGAGGACTCTTAAAGGCCTCCTGTAATATTGTTACTCACTCACTCACTCACACTCAAGAGCTCAATGATCATTTGTGTATTTCTCAAGTTAGCATAGAATTCTTCCACACTGGAAGCTTGTAATTGACAACAATGTAGACATCATGTTAAAAACGGTCGCAGTGTACACGATCTAGATTTTTTAAAGATCTGAGCAGCTGCCCAAATTGAAGATCAGTGGTCTGATCGCACTCAATGCAGCGAGATGATAGTGCATGCAGGCAGCCAGCCATGTAAGTAGTTGGTAGGATAGAGGTATGGATGATCTTTGTGCAACCAGCAGTTCCATACATGAGTTTGACCCTGAGTGATTATACTGTCAATGTCTCAATTCTGCCGGCCCCTCGGCAGTCTGGCCCTGAGTGTTTCATTCTTGAGCAAAATCGACGGAGCGAATCTACGATCAAACCCGGGTTCACATTTTTGTATGGCCTTGTTGAAATAAAGATGCTTTACTGGAAACTTCTCA

CDS

>Mapoly0069s0069.1
ATGATGCTCCTAGCGGAGGGGAAGGATAGATTACGGGAGGAGGTGCAGCGGCTTAGGGCGATGCAAGGCTCCGGAGCGAGCTTGAGCCTCAGCGTAGACTTGAGCATGATGGTAGCGAGGAGCCAGGACGATTGCTCCACCGTAAGACGGCAGTGCCCCGTGCAACTGGATCTGCTGCCCATGCCCACTTTTCCATCGGCTGCAGCAGCCCCGCACCCTCCCACGCAGCAGTCGCAGTCGCAGTCCCACAATCCCTTCCCGTGGAAACCTCTCTTCAACAGATCCCGTTCCAACTCTGCCAGTGGTAATGAAGACATCGAGGCGGCGGAAACTTACTCCTCGGGACACGGAGGATCACCTCGAGGAATCGACGTCAATCAAATCCCGTCTTCAGCCGATTGCGACGACGTGGTGGTCTCGTCCCCCAACAGCATCAATCTGAAAAGGGAGAGGGAGAAAACGCACGATTTTGACCTGGAACGCGACCGCACGTGTGACATTTCCTCGAGAGGCAGCGACGAGGAAGAAGGGGGCACCACGAGGAAGAAGCTCAGACTGTCCAAGGAGCAGTCGGCTCTCCTCGAGGAAAGCTTCAAAGAGCACAGCACCCTCAACCCGAAGCAAAAGAACGCACTCGCCAAGCAGTTGAACTTGCGGCCTCGCCAAGTCGAAGTTTGGTTCCAAAACAGAAGAGCAAGGACCAAGCTGAAACAAACCGAGGTCGATTGCGAGCTTCTGAAGCGATGCTGCGAGACTCTGACGGAGGAGAACCGGAGACTGCAGAAGGAGCTGCAGGAGCTGAGAGCGCTGAAGGTGGCTCCTCCGTGTGTCATTGCGCACGACTTCTACATGCCGCTACCTGCCGCCACCCTGACCATGTGCCCATCCTGTGAAAGAGTAACCACCATGGACAACAAGACACTTGCCTTCGCCAAGCCCGGATTCTCCCACTACTCGCAATCCTCGGCCGCATGTTAG

Protein

>Mapoly0069s0069.1
MMLLAEGKDRLREEVQRLRAMQGSGASLSLSVDLSMMVARSQDDCSTVRRQCPVQLDLLPMPTFPSAAAAPHPPTQQSQSQSHNPFPWKPLFNRSRSNSASGNEDIEAAETYSSGHGGSPRGIDVNQIPSSADCDDVVVSSPNSINLKREREKTHDFDLERDRTCDISSRGSDEEEGGTTRKKLRLSKEQSALLEESFKEHSTLNPKQKNALAKQLNLRPRQVEVWFQNRRARTKLKQTEVDCELLKRCCETLTEENRRLQKELQELRALKVAPPCVIAHDFYMPLPAATLTMCPSCERVTTMDNKTLAFAKPGFSHYSQSSAAC

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>