Mapoly0070s0095



Description

ZINC FINGER PROTEIN 207

Reference DB

Database ID Description
KOG KOG2893 Zn finger protein
OrthoMCL OG5_129325
PANTHER PTHR23215 ZINC FINGER PROTEIN 207

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC2H2-12 transcription factor, C2H2-ZnF Mapoly0070s0095.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0070s0095.1 scaffold_70:1040610..1047382  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0070s0095.2 scaffold_70:1040610..1047382  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0070s0095.3 scaffold_70:1040588..1046667  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0070s0095.4 scaffold_70:1040610..1046637  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0070s0095.1  

Gene structure:

mRNA scaffold_70:1040610..1047382  ( + strand )
five_prime_UTR scaffold_70:1040610..1040835  ( + strand )
CDS scaffold_70:1040836..1041026  ( + strand )
CDS scaffold_70:1042663..1042775  ( + strand )
CDS scaffold_70:1043111..1043237  ( + strand )
CDS scaffold_70:1043871..1044337  ( + strand )
CDS scaffold_70:1044530..1044693  ( + strand )
CDS scaffold_70:1045144..1045197  ( + strand )
CDS scaffold_70:1045824..1045901  ( + strand )
three_prime_UTR scaffold_70:1045902..1046256  ( + strand )
three_prime_UTR scaffold_70:1046727..1046892  ( + strand )
three_prime_UTR scaffold_70:1047104..1047382  ( + strand )

Sequences:

Gene

>Mapoly0070s0095.1
CGAAGCAGGGCAAGGTCCGGAGAGGACTCGTACTCCGTCGGAGATGCTAATCGTCGAGGAATTTTGACGTGCACGTCTGGCTGTGCGGAGGGTGCCTAGCAGACGTAACCGTGTTGGATCCGTGACGTTTTTGGATGCTCGAGGCGCCCGGGGTCCTTCGTGTTCGAGTAGTTTCGAGAGCCGGATGTGTATGAGGGCGCGCTCGTGAGCGACTCGGTGGGGAAAAATGGGAAAGAAGAAGAAAAAGTCGTTCAAGGTGTGGTGTTTCTATTGCGAGAGGGAGTTCGAGGACGAGAAAATTTTAATTCAGCATCAGAAGGCCAAGCACTTCAAGTGCCATGTCTGCCACAAGAAGTTGTCGACGGCCGGTGGCATGGTGGTGCACGTTCTCCAAGTCCACAAGGAGTCTATCACGAAGTAAGACCATTTTCTCTGAATTCGTTTTGTACTGTTTGCGCCGCAGAATGATTTGAAAGTTGTGGATTGTAGTGTGCGACGGTCTGTGTATTGCGTACTGGATTTTTTGGTATTTCTGTGTCCACTTCGAAAATCAGTTACAGGCGAGTCAAGATTCTCGAAGTAGGGGACCGCTCTCGTGAAGCATTCGCCACAGAATACGACCGCTGCAGGGTTCGAGTGATAGCCAAAATAAATTGTAAACGTTACTTCGTCCGGAAGATTAATTGTCAGAGATGTGTTCGACTACAGTTCGGGAGCTTCTGTGAGGCTTACATGATAGTATTGCTTGTTAATTTCATTACACATGAAATTTGAGGGGCACGTGAAGATAACGGGCTTGTCCAAGGTGGTGATTGTGATATGCAGTGGAACAGTACAGCTCAATTTTTAAATCTAGGAAGCTTTGTAGCTGTTTTTGAAGCCATGAGACAATTTTGCTTCAGATTTTTGAAAAAAGTCGCGTCTTGGATTGGTTGTTGACAGCAAGCAGTGTCGCATTTCATCAGGCAGAATCACTAAGGTCGCCGTTGACAAGAACTTAGATAAATAGTTTCTTCGTTGTAGGTGACTGACAAGAGTTTGATCCAGGTTAAATCTTACATGTGATTTTTTACGCTTTGGATTGTATTCTCAATTCACTCAGTTCTTGCATCATCCACTAGATTGTCTTACCCACAGCTCAGCATATGACAGTGTCACAGATGAATGCATGACTGAAAAATTGTCAAGGCCTAATTTTCAAGGAGGCCTGAACACACTGACTGATTGCCACTAATTTCATTAGCCGTACTCACTTGAAAATTCACCTAGAATCAGTGTGTTAAAAATGTACTGTGATTGTGCTGAATATCTATACACTGAGCCTTAGAAACCCCAGGTTCACAGGTACGGTCACCAGTAATTCTTAAGGTGTTGATTTGTTTTCGTCCCGTACACCACAGGGATTTTTTCCTCGATAGAATCGAAAGCACGGTCGGTAAGTAGGGTAGTAGCAGCTGCTAATGTGATTGGTTGTTGATGCGCTCCTTGATTTGGGATGACTTTTAAGATCGTAGTGTAGAAGAGCAGGAAAGTAAAATTTCATTAAAGGCATGGTATTGGCGAGAAGTTCCCTATATCCAAGAAGCTTCTTCTGGACGGATGTCTATGCTTATGCTTCTGCTCCTCCTGCTCTGCGTGCATTTTGTTACTCCAGTGAGAAAAATAATTTGACAACTGGAAGTGAATTGCACCTCTTGGAATACTACGGTAGAGAAGTTGAAATTGAGACATTCAGTGGGCTTTCTTCGATCGACCCAGCTGGCCTTTAGTGTGTTTTTGAATTCACGTATGTCAAATAAGTCGTGGATGCTATGAGTTGATGGCCAGCTGGTGTTGGTTCAGATCTTTCTAGACATATAAATGCCTGGGCTTTGATTTCCTAATTTTTAAACCAGTCACAGGACTTTCAGTGTAGTCAATAACTTCAACACAATACTTTCTTTGCTTTAGTGTTCGACTTCGTAAAGTATGTAACCGTCTCCACTGTAGCTGGATACCTGTGTCCGCCACTTCCGAAACTTCGTACTTATTTTTCTGTTTGCGTTACAATTAGGGTTCCAAATGCGAAACCGGAGAGGGAGTCAACGGAACCTGAAATATTTGGCATGGAGGGTATCCCCCCCGAGATTCTAGCTGCGCATGACGGGGACCAAGGTGGGCTGGATGGTATGGAAATCAATGGCCTTTTTTTTTGTCAGTCATTCTGCAATATCATCATCTACTGAGTTCGTGTTCTACAGATATTGTTTGTGCTTTGGCAGCAACACTAGTATGTACTTCACAAATCTCAAGGTTCTACTGAGGTTCTTATCCTGCGCCTGTTCAAATTTTGTCTTTGAGTTGAGAGGTGGTTCCTTCCTCTATCACAGTTGTGAGGAACTATTGGGATTGGAACAGTGTCAAGGGGTCCAGTTTTTAGTACGTTAAGTCAAAACCTTTCGCTCCTTTTGTATCAATTAGTATGATTTTTAATGTCCTCTCGGAGCCTCCGGCTCACGCAGACGATGAAAAGCCTGCAAAGGTTGCGAGGGTGGAGATTCCCCCCTCTTCGCCATTTGGTGGCTTAGTAATGGGACCGATTGCTCTCGGTATGGCCTCCCAACCGATGTATTCTCCAATGCCGCCTGTGTAAGTATCTCTTCTTATATCCCTTACTACCGTTGCCTTTTTGTGTTCGTGGTGTATGTGGCCGACCAGGTGTGGGATGCTTGGTTTCATTCAAGGTATGTAGGACATATCTTCTGAAATGGTATAAGCCATTGTTTCCTGCTGCCCATTTTGTGAGGTCAAGGTCTGGAAAGCAGGACAGGCTGGAAACGTGCATTTTTTGTGAATTTTTTCTCGTAATTGAGCTTTCTCTTGTACATGAGATTCAAGGATGGAAGCTTTTCCTGTGTCCAAAGTGTTCTTCCTTCGGACTTTGGTTCAGGCTAGGATTTCCCCCAGATCCAAATTTTATAGTTTATTCTCGCAGAGATAAGCACATCACACTTGTTTTGATGCTTGTGGACTCTTGCTTCGTCTTTCAAAGTGAAGCAGAGAACGTTGCATCTTTCTGGTGATTCACATGATTTATTAAGGCGGCCTAGCCCATTTGAAGTGTTAGTAGGTCTGATCAGTTTCGTAATGTGCTTTATACCAGTGGGGAGTTTGACTGGATAGCACGCATCTGTTTATTGATTTTCTCCTTCATTGCATTGTGATATTTTGATGTATTAAGTTCAAATAAGTTAGAAAATATGACTCTGTTGTGCATTGCAGATATATGTCCCAACAACCCAGTGGCCCACGACCTCCTTCTTGGCCACCTCAACCGCCGAACTCACATGGGTGGAACCATATGCACCCTGGACAACCCCCAATGCACCCACCACGACCCCCTCCTCCACCACAACCGCTGTTTCCAATACAGGCTCCCAATCCACCTTCTATGTCATCAGCCTCTGCGCTACCACCAGCGCAGCCATTATTTCCTATTCGACCAGCTGCCCCCCCATCTTCGGCTCCTCCTTCGCAGCCTTTATTTCCTGTCAATGGTACGCCATCCACTGGTTCTTCTTCTTCGTCATCATCAGTTGGTACGTCGTCTAGCGGAGTTCCTTTGAGGAGCCCAGGAAATGGGCAGACTGCGGTGGACAGCACTAGTGGAGCTGGGTCCTTACCAGGAGGTCAGAGTTCAGTCACATCAGCAACTATGGTGGGACGCCCTCCTTCCTTACCTTTTGGAGGTAAGAAACACCCATTCTCGGTATCTGTTTTAATATTTCGCATCGTCAATTCACTCCCCATTGTTGTATTTTGCCAAGATGTGAGTAGTAGCGTGTGTCAAGAGTTCCACATTTGGATTCTGCGCCATGCGGTCCGTTTCTCTATGTAATAGTTTGCTTCAAGCTTATTAGCTTTGTCTCGATGTATGACAGGAGTTCCGAATTTACCCCCCTCAGGAAGTCACATGTACGCATCTGCCCCAAGCACAGGAGGTCCGTCCATTGGCCCACCTCCAGTTATATCAAACAAACCTCCCGGTCCTCCAGGCTTGACCAACGAGGTCTACCTTGTCTGGGATGACGAGATTTTGTCCATGGTAAGGTGTCTTTGACAAAACTAAATGGATCCGATTTTTGCTTTTATTTCATTCACCAGCTCCTTCGTATACATCTTTTCTTATCGTAGCAAATGAATATGGCGTGCTTGGCACATCTGGCTTTCTATTCATCAACACTTCAAACACATGAGGAGACACCAAACTGTTCAGGACATTTATATTCCAGTGGACTTTTCAGACTTTCTATTTTAGTCTTTGTGCAGTTGAAGCAGAGTAGATATAATTCACTAGTTTTACAAGCAGCCTTCACCCTCAGGCCATCTTACAGGCTCTCAACTTTCAGCATTTTCTCATGTTGAGAAATGTCTTTTACCGCGTACTGTGTTGAACTCTAATGGTCATACCGACGGCTCACAATATTCTATTTACTATCATTCTACGGTGCCGATGCTTCCTCTTATTGAGAATTGTACGATATCTGTCGTGCAGGAGGAGAGAAGACTGTCTTTACCTCAGTATCAGGTGCTTGATGAAACCTCACAGGTAAGCACCAAACTTGACGTTGATTGATAGGTTGACGACGGCTGGCAAAAGATGGTGTGTACATGAACTCTCTGCAAAATGTTTATGAAAGTGCTAGAGGATTATAGCTCAGAATGACTAAGTACAGGAGACGACATGTACTTGACGAATCCCGACGGCATCAGTAAAAAACTTGATTCGGCCAATGCCGGGAGTGTGTCCTGGTTTAGGGTTAAGCTTTCATTCGGGGGCAAGCATGTCTGTTAGCTCTTCTTGGTCATGGTTTGGTAGTGGTTGCCAGCTTCTGAAGCTTCCCTACTTGGTGGTATTTATCACTTGTATTGGAGCACAAGAGTAGCCTGCAGTCATTGCAGTGAATCTGAAATGATAGTGCGTTAAGTCGCTACATATGGACACTTTAATGCTGTTTCGTTCAAGCTCGTTAGGTGTTTCAAGGATCTGCTGGGCCATGTTTGCATTCCACATTGAAAGAGGCAGCCAAGGTTTGGTACTTATTAGCACTAATTCTGGTCAGAGGTCAGTGGTTCTACCCTTGGCCTTTGGATTCAAAATTTCGTGCTGCTATAAGACGAAAACACTAGGGAGCACTAGTGTGAGAAAGAAGTTGACGATTTGTTTGCTCTCAGATGAATACGATTGAAGCAGCATTTGACAGAAGAATTTTGGAGGGCAGACTTGCCGGGCGGATGGGATTCCGTGTGTAAAAGGTACACTATATTCAGCTTGCACTTCGAGAGTATTGTTGGCTACCTGGGTGGAGTCGGTGACTTGTGGGAGCATTACACAGTTTACAGAGGCATAGAATTGATCGTTCATATATTGCTCGGGTGCTGTAATGCTCTGCTTGAGTTGCCTCAGAACATCAAGAGATGCAGATTTTCTCGCTCGTCATGCATGAGTTTCTGCCTATCTTGTATCGGCAACAACGTACGTTTTATCGCTCTTGAAAGTGAAACAGGGAGAAATCGATTGGCCTCGTTGCGCCGTCACAGGTCATACTTAAAAAAATCCTCGAAGTTTTGATGGTTATGCTTTGGAGGCGACAGACTTATACCACAGGTGATAGCTACAATTGATGACTCTGTCGAGAATTGTGTACAATGGCTAGGTAACAATTGCCCTAAAATGTGGGTGTGGCCTAATTCATGGTAGATTCTACAGCCCCCAGAGCCTGGGGTATACAAGACTTCTAACGTCGAACGGGAACACAGTCACTTCATTAGATGCGGGCAGAGGCGCAAGTAGTGGAAGTCTAGGTTCACAGGGTTGTAGTGATAAGTTGTCATACGGGCTTTGGCCCTTGGGGATCTTTGTAGCTGGCACTTGCGTCACGCCCTTACCGCCTGAATTATTTGAAGGCTAAAGGAAAAAGAATCTTGTTCGGAAGCTGTGAATTGATCCAATGTATGAAAACACGTTCATTATATGGACCTTATACGTCCTCGAGCTAATTGCTCGTGAGAGTGTTGAGCCTTTGTTCATTACAAATTCTGCGGTTCTCAATCCGGTCGCTCTCTCTACTATTTCAGAACTAAGGTTCGAAGCGAAGTTGAATCGTTGGCTCAGTTTGGGATATGGAAGAACGGTGTTGTAAGAAATCATAACTGAGCCTGAAATGGAGATTGGCCTAAATAATCAAGAAAGTGGTGTACAATGTTCGATCTGCATTTACCCTGCCTGTTCTGTTACATGAGGGTAATTTTAGTACCCAATGTTGTTCTGAGTGTAAACCGAGTATGACCAATATAACTCTTGTGAAAAATAATGTAACTGAGGAGTAAGTGCATCATATTGTGAGATCATTGTAGGTCAGCTTCATTTATCTCCAAGTGTTGTGAACTATATTAATTCATTTGCTTGAAGCTTGTGGAATGCACTCTAAAATTGAAATGAAACAACGTTTCAGAGGTAGGAACTGAATTTTCAATCAGCACAATTCCTAAGGCGGTGGGACGCACATCATATTATCACAAGCGATATTGGCGGTTGAAAGCAAGTGTCCCTAGAGGAAACAATGTTTTATTGGTACTAGATTTTGCAACTTGCCATTTCAAAACTGGATAAATGACATGATGCTTTAAGCACAAATGTGTCAAAACTATTAATCCACAAGTTCTGCACTCCACACACTGAAACTTACTTTGTTATTCTCTCTCAAAATAATTTGATGAAATCACTAAAAAAC

mRNA

>Mapoly0070s0095.1
CGAAGCAGGGCAAGGTCCGGAGAGGACTCGTACTCCGTCGGAGATGCTAATCGTCGAGGAATTTTGACGTGCACGTCTGGCTGTGCGGAGGGTGCCTAGCAGACGTAACCGTGTTGGATCCGTGACGTTTTTGGATGCTCGAGGCGCCCGGGGTCCTTCGTGTTCGAGTAGTTTCGAGAGCCGGATGTGTATGAGGGCGCGCTCGTGAGCGACTCGGTGGGGAAAAATGGGAAAGAAGAAGAAAAAGTCGTTCAAGGTGTGGTGTTTCTATTGCGAGAGGGAGTTCGAGGACGAGAAAATTTTAATTCAGCATCAGAAGGCCAAGCACTTCAAGTGCCATGTCTGCCACAAGAAGTTGTCGACGGCCGGTGGCATGGTGGTGCACGTTCTCCAAGTCCACAAGGAGTCTATCACGAAGGTTCCAAATGCGAAACCGGAGAGGGAGTCAACGGAACCTGAAATATTTGGCATGGAGGGTATCCCCCCCGAGATTCTAGCTGCGCATGACGGGGACCAAGGTGGGCTGGATGACGATGAAAAGCCTGCAAAGGTTGCGAGGGTGGAGATTCCCCCCTCTTCGCCATTTGGTGGCTTAGTAATGGGACCGATTGCTCTCGGTATGGCCTCCCAACCGATGTATTCTCCAATGCCGCCTGTATATATGTCCCAACAACCCAGTGGCCCACGACCTCCTTCTTGGCCACCTCAACCGCCGAACTCACATGGGTGGAACCATATGCACCCTGGACAACCCCCAATGCACCCACCACGACCCCCTCCTCCACCACAACCGCTGTTTCCAATACAGGCTCCCAATCCACCTTCTATGTCATCAGCCTCTGCGCTACCACCAGCGCAGCCATTATTTCCTATTCGACCAGCTGCCCCCCCATCTTCGGCTCCTCCTTCGCAGCCTTTATTTCCTGTCAATGGTACGCCATCCACTGGTTCTTCTTCTTCGTCATCATCAGTTGGTACGTCGTCTAGCGGAGTTCCTTTGAGGAGCCCAGGAAATGGGCAGACTGCGGTGGACAGCACTAGTGGAGCTGGGTCCTTACCAGGAGGTCAGAGTTCAGTCACATCAGCAACTATGGTGGGACGCCCTCCTTCCTTACCTTTTGGAGGAGTTCCGAATTTACCCCCCTCAGGAAGTCACATGTACGCATCTGCCCCAAGCACAGGAGGTCCGTCCATTGGCCCACCTCCAGTTATATCAAACAAACCTCCCGGTCCTCCAGGCTTGACCAACGAGGTCTACCTTGTCTGGGATGACGAGATTTTGTCCATGGAGGAGAGAAGACTGTCTTTACCTCAGTATCAGGTGCTTGATGAAACCTCACAGATGAATACGATTGAAGCAGCATTTGACAGAAGAATTTTGGAGGGCAGACTTGCCGGGCGGATGGGATTCCGTGTGTAAAAGGTACACTATATTCAGCTTGCACTTCGAGAGTATTGTTGGCTACCTGGGTGGAGTCGGTGACTTGTGGGAGCATTACACAGTTTACAGAGGCATAGAATTGATCGTTCATATATTGCTCGGGTGCTGTAATGCTCTGCTTGAGTTGCCTCAGAACATCAAGAGATGCAGATTTTCTCGCTCGTCATGCATGAGTTTCTGCCTATCTTGTATCGGCAACAACGTACGTTTTATCGCTCTTGAAAGTGAAACAGGGAGAAATCGATTGGCCTCGTTGCGCCGTCACAGGTCATACTTAAAAAAATCCTCGAAGTTTTGATGGTTATGCTTTGGAGGCGACAGACTTATACCACAGAACTAAGGTTCGAAGCGAAGTTGAATCGTTGGCTCAGTTTGGGATATGGAAGAACGGTGTTGTAAGAAATCATAACTGAGCCTGAAATGGAGATTGGCCTAAATAATCAAGAAAGTGGTGTACAATGTTCGATCTGCATTTACCCTGCCTGTTCTGTTACATGAGGAGGTAGGAACTGAATTTTCAATCAGCACAATTCCTAAGGCGGTGGGACGCACATCATATTATCACAAGCGATATTGGCGGTTGAAAGCAAGTGTCCCTAGAGGAAACAATGTTTTATTGGTACTAGATTTTGCAACTTGCCATTTCAAAACTGGATAAATGACATGATGCTTTAAGCACAAATGTGTCAAAACTATTAATCCACAAGTTCTGCACTCCACACACTGAAACTTACTTTGTTATTCTCTCTCAAAATAATTTGATGAAATCACTAAAAAAC

CDS

>Mapoly0070s0095.1
ATGGGAAAGAAGAAGAAAAAGTCGTTCAAGGTGTGGTGTTTCTATTGCGAGAGGGAGTTCGAGGACGAGAAAATTTTAATTCAGCATCAGAAGGCCAAGCACTTCAAGTGCCATGTCTGCCACAAGAAGTTGTCGACGGCCGGTGGCATGGTGGTGCACGTTCTCCAAGTCCACAAGGAGTCTATCACGAAGGTTCCAAATGCGAAACCGGAGAGGGAGTCAACGGAACCTGAAATATTTGGCATGGAGGGTATCCCCCCCGAGATTCTAGCTGCGCATGACGGGGACCAAGGTGGGCTGGATGACGATGAAAAGCCTGCAAAGGTTGCGAGGGTGGAGATTCCCCCCTCTTCGCCATTTGGTGGCTTAGTAATGGGACCGATTGCTCTCGGTATGGCCTCCCAACCGATGTATTCTCCAATGCCGCCTGTATATATGTCCCAACAACCCAGTGGCCCACGACCTCCTTCTTGGCCACCTCAACCGCCGAACTCACATGGGTGGAACCATATGCACCCTGGACAACCCCCAATGCACCCACCACGACCCCCTCCTCCACCACAACCGCTGTTTCCAATACAGGCTCCCAATCCACCTTCTATGTCATCAGCCTCTGCGCTACCACCAGCGCAGCCATTATTTCCTATTCGACCAGCTGCCCCCCCATCTTCGGCTCCTCCTTCGCAGCCTTTATTTCCTGTCAATGGTACGCCATCCACTGGTTCTTCTTCTTCGTCATCATCAGTTGGTACGTCGTCTAGCGGAGTTCCTTTGAGGAGCCCAGGAAATGGGCAGACTGCGGTGGACAGCACTAGTGGAGCTGGGTCCTTACCAGGAGGTCAGAGTTCAGTCACATCAGCAACTATGGTGGGACGCCCTCCTTCCTTACCTTTTGGAGGAGTTCCGAATTTACCCCCCTCAGGAAGTCACATGTACGCATCTGCCCCAAGCACAGGAGGTCCGTCCATTGGCCCACCTCCAGTTATATCAAACAAACCTCCCGGTCCTCCAGGCTTGACCAACGAGGTCTACCTTGTCTGGGATGACGAGATTTTGTCCATGGAGGAGAGAAGACTGTCTTTACCTCAGTATCAGGTGCTTGATGAAACCTCACAGATGAATACGATTGAAGCAGCATTTGACAGAAGAATTTTGGAGGGCAGACTTGCCGGGCGGATGGGATTCCGTGTGTAA

Protein

>Mapoly0070s0095.1
MGKKKKKSFKVWCFYCEREFEDEKILIQHQKAKHFKCHVCHKKLSTAGGMVVHVLQVHKESITKVPNAKPERESTEPEIFGMEGIPPEILAAHDGDQGGLDDDEKPAKVARVEIPPSSPFGGLVMGPIALGMASQPMYSPMPPVYMSQQPSGPRPPSWPPQPPNSHGWNHMHPGQPPMHPPRPPPPPQPLFPIQAPNPPSMSSASALPPAQPLFPIRPAAPPSSAPPSQPLFPVNGTPSTGSSSSSSSVGTSSSGVPLRSPGNGQTAVDSTSGAGSLPGGQSSVTSATMVGRPPSLPFGGVPNLPPSGSHMYASAPSTGGPSIGPPPVISNKPPGPPGLTNEVYLVWDDEILSMEERRLSLPQYQVLDETSQMNTIEAAFDRRILEGRLAGRMGFRV

Mapoly0070s0095.2  

Gene structure:

mRNA scaffold_70:1040610..1047382  ( + strand )
five_prime_UTR scaffold_70:1040610..1040835  ( + strand )
CDS scaffold_70:1040836..1041026  ( + strand )
CDS scaffold_70:1042663..1042775  ( + strand )
CDS scaffold_70:1043111..1043237  ( + strand )
CDS scaffold_70:1043871..1044337  ( + strand )
CDS scaffold_70:1044530..1044693  ( + strand )
CDS scaffold_70:1045144..1045197  ( + strand )
CDS scaffold_70:1045824..1045901  ( + strand )
three_prime_UTR scaffold_70:1045902..1045904  ( + strand )
three_prime_UTR scaffold_70:1046056..1046256  ( + strand )
three_prime_UTR scaffold_70:1046727..1046892  ( + strand )
three_prime_UTR scaffold_70:1047104..1047382  ( + strand )

Sequences:

Gene

>Mapoly0070s0095.2
CGAAGCAGGGCAAGGTCCGGAGAGGACTCGTACTCCGTCGGAGATGCTAATCGTCGAGGAATTTTGACGTGCACGTCTGGCTGTGCGGAGGGTGCCTAGCAGACGTAACCGTGTTGGATCCGTGACGTTTTTGGATGCTCGAGGCGCCCGGGGTCCTTCGTGTTCGAGTAGTTTCGAGAGCCGGATGTGTATGAGGGCGCGCTCGTGAGCGACTCGGTGGGGAAAAATGGGAAAGAAGAAGAAAAAGTCGTTCAAGGTGTGGTGTTTCTATTGCGAGAGGGAGTTCGAGGACGAGAAAATTTTAATTCAGCATCAGAAGGCCAAGCACTTCAAGTGCCATGTCTGCCACAAGAAGTTGTCGACGGCCGGTGGCATGGTGGTGCACGTTCTCCAAGTCCACAAGGAGTCTATCACGAAGTAAGACCATTTTCTCTGAATTCGTTTTGTACTGTTTGCGCCGCAGAATGATTTGAAAGTTGTGGATTGTAGTGTGCGACGGTCTGTGTATTGCGTACTGGATTTTTTGGTATTTCTGTGTCCACTTCGAAAATCAGTTACAGGCGAGTCAAGATTCTCGAAGTAGGGGACCGCTCTCGTGAAGCATTCGCCACAGAATACGACCGCTGCAGGGTTCGAGTGATAGCCAAAATAAATTGTAAACGTTACTTCGTCCGGAAGATTAATTGTCAGAGATGTGTTCGACTACAGTTCGGGAGCTTCTGTGAGGCTTACATGATAGTATTGCTTGTTAATTTCATTACACATGAAATTTGAGGGGCACGTGAAGATAACGGGCTTGTCCAAGGTGGTGATTGTGATATGCAGTGGAACAGTACAGCTCAATTTTTAAATCTAGGAAGCTTTGTAGCTGTTTTTGAAGCCATGAGACAATTTTGCTTCAGATTTTTGAAAAAAGTCGCGTCTTGGATTGGTTGTTGACAGCAAGCAGTGTCGCATTTCATCAGGCAGAATCACTAAGGTCGCCGTTGACAAGAACTTAGATAAATAGTTTCTTCGTTGTAGGTGACTGACAAGAGTTTGATCCAGGTTAAATCTTACATGTGATTTTTTACGCTTTGGATTGTATTCTCAATTCACTCAGTTCTTGCATCATCCACTAGATTGTCTTACCCACAGCTCAGCATATGACAGTGTCACAGATGAATGCATGACTGAAAAATTGTCAAGGCCTAATTTTCAAGGAGGCCTGAACACACTGACTGATTGCCACTAATTTCATTAGCCGTACTCACTTGAAAATTCACCTAGAATCAGTGTGTTAAAAATGTACTGTGATTGTGCTGAATATCTATACACTGAGCCTTAGAAACCCCAGGTTCACAGGTACGGTCACCAGTAATTCTTAAGGTGTTGATTTGTTTTCGTCCCGTACACCACAGGGATTTTTTCCTCGATAGAATCGAAAGCACGGTCGGTAAGTAGGGTAGTAGCAGCTGCTAATGTGATTGGTTGTTGATGCGCTCCTTGATTTGGGATGACTTTTAAGATCGTAGTGTAGAAGAGCAGGAAAGTAAAATTTCATTAAAGGCATGGTATTGGCGAGAAGTTCCCTATATCCAAGAAGCTTCTTCTGGACGGATGTCTATGCTTATGCTTCTGCTCCTCCTGCTCTGCGTGCATTTTGTTACTCCAGTGAGAAAAATAATTTGACAACTGGAAGTGAATTGCACCTCTTGGAATACTACGGTAGAGAAGTTGAAATTGAGACATTCAGTGGGCTTTCTTCGATCGACCCAGCTGGCCTTTAGTGTGTTTTTGAATTCACGTATGTCAAATAAGTCGTGGATGCTATGAGTTGATGGCCAGCTGGTGTTGGTTCAGATCTTTCTAGACATATAAATGCCTGGGCTTTGATTTCCTAATTTTTAAACCAGTCACAGGACTTTCAGTGTAGTCAATAACTTCAACACAATACTTTCTTTGCTTTAGTGTTCGACTTCGTAAAGTATGTAACCGTCTCCACTGTAGCTGGATACCTGTGTCCGCCACTTCCGAAACTTCGTACTTATTTTTCTGTTTGCGTTACAATTAGGGTTCCAAATGCGAAACCGGAGAGGGAGTCAACGGAACCTGAAATATTTGGCATGGAGGGTATCCCCCCCGAGATTCTAGCTGCGCATGACGGGGACCAAGGTGGGCTGGATGGTATGGAAATCAATGGCCTTTTTTTTTGTCAGTCATTCTGCAATATCATCATCTACTGAGTTCGTGTTCTACAGATATTGTTTGTGCTTTGGCAGCAACACTAGTATGTACTTCACAAATCTCAAGGTTCTACTGAGGTTCTTATCCTGCGCCTGTTCAAATTTTGTCTTTGAGTTGAGAGGTGGTTCCTTCCTCTATCACAGTTGTGAGGAACTATTGGGATTGGAACAGTGTCAAGGGGTCCAGTTTTTAGTACGTTAAGTCAAAACCTTTCGCTCCTTTTGTATCAATTAGTATGATTTTTAATGTCCTCTCGGAGCCTCCGGCTCACGCAGACGATGAAAAGCCTGCAAAGGTTGCGAGGGTGGAGATTCCCCCCTCTTCGCCATTTGGTGGCTTAGTAATGGGACCGATTGCTCTCGGTATGGCCTCCCAACCGATGTATTCTCCAATGCCGCCTGTGTAAGTATCTCTTCTTATATCCCTTACTACCGTTGCCTTTTTGTGTTCGTGGTGTATGTGGCCGACCAGGTGTGGGATGCTTGGTTTCATTCAAGGTATGTAGGACATATCTTCTGAAATGGTATAAGCCATTGTTTCCTGCTGCCCATTTTGTGAGGTCAAGGTCTGGAAAGCAGGACAGGCTGGAAACGTGCATTTTTTGTGAATTTTTTCTCGTAATTGAGCTTTCTCTTGTACATGAGATTCAAGGATGGAAGCTTTTCCTGTGTCCAAAGTGTTCTTCCTTCGGACTTTGGTTCAGGCTAGGATTTCCCCCAGATCCAAATTTTATAGTTTATTCTCGCAGAGATAAGCACATCACACTTGTTTTGATGCTTGTGGACTCTTGCTTCGTCTTTCAAAGTGAAGCAGAGAACGTTGCATCTTTCTGGTGATTCACATGATTTATTAAGGCGGCCTAGCCCATTTGAAGTGTTAGTAGGTCTGATCAGTTTCGTAATGTGCTTTATACCAGTGGGGAGTTTGACTGGATAGCACGCATCTGTTTATTGATTTTCTCCTTCATTGCATTGTGATATTTTGATGTATTAAGTTCAAATAAGTTAGAAAATATGACTCTGTTGTGCATTGCAGATATATGTCCCAACAACCCAGTGGCCCACGACCTCCTTCTTGGCCACCTCAACCGCCGAACTCACATGGGTGGAACCATATGCACCCTGGACAACCCCCAATGCACCCACCACGACCCCCTCCTCCACCACAACCGCTGTTTCCAATACAGGCTCCCAATCCACCTTCTATGTCATCAGCCTCTGCGCTACCACCAGCGCAGCCATTATTTCCTATTCGACCAGCTGCCCCCCCATCTTCGGCTCCTCCTTCGCAGCCTTTATTTCCTGTCAATGGTACGCCATCCACTGGTTCTTCTTCTTCGTCATCATCAGTTGGTACGTCGTCTAGCGGAGTTCCTTTGAGGAGCCCAGGAAATGGGCAGACTGCGGTGGACAGCACTAGTGGAGCTGGGTCCTTACCAGGAGGTCAGAGTTCAGTCACATCAGCAACTATGGTGGGACGCCCTCCTTCCTTACCTTTTGGAGGTAAGAAACACCCATTCTCGGTATCTGTTTTAATATTTCGCATCGTCAATTCACTCCCCATTGTTGTATTTTGCCAAGATGTGAGTAGTAGCGTGTGTCAAGAGTTCCACATTTGGATTCTGCGCCATGCGGTCCGTTTCTCTATGTAATAGTTTGCTTCAAGCTTATTAGCTTTGTCTCGATGTATGACAGGAGTTCCGAATTTACCCCCCTCAGGAAGTCACATGTACGCATCTGCCCCAAGCACAGGAGGTCCGTCCATTGGCCCACCTCCAGTTATATCAAACAAACCTCCCGGTCCTCCAGGCTTGACCAACGAGGTCTACCTTGTCTGGGATGACGAGATTTTGTCCATGGTAAGGTGTCTTTGACAAAACTAAATGGATCCGATTTTTGCTTTTATTTCATTCACCAGCTCCTTCGTATACATCTTTTCTTATCGTAGCAAATGAATATGGCGTGCTTGGCACATCTGGCTTTCTATTCATCAACACTTCAAACACATGAGGAGACACCAAACTGTTCAGGACATTTATATTCCAGTGGACTTTTCAGACTTTCTATTTTAGTCTTTGTGCAGTTGAAGCAGAGTAGATATAATTCACTAGTTTTACAAGCAGCCTTCACCCTCAGGCCATCTTACAGGCTCTCAACTTTCAGCATTTTCTCATGTTGAGAAATGTCTTTTACCGCGTACTGTGTTGAACTCTAATGGTCATACCGACGGCTCACAATATTCTATTTACTATCATTCTACGGTGCCGATGCTTCCTCTTATTGAGAATTGTACGATATCTGTCGTGCAGGAGGAGAGAAGACTGTCTTTACCTCAGTATCAGGTGCTTGATGAAACCTCACAGGTAAGCACCAAACTTGACGTTGATTGATAGGTTGACGACGGCTGGCAAAAGATGGTGTGTACATGAACTCTCTGCAAAATGTTTATGAAAGTGCTAGAGGATTATAGCTCAGAATGACTAAGTACAGGAGACGACATGTACTTGACGAATCCCGACGGCATCAGTAAAAAACTTGATTCGGCCAATGCCGGGAGTGTGTCCTGGTTTAGGGTTAAGCTTTCATTCGGGGGCAAGCATGTCTGTTAGCTCTTCTTGGTCATGGTTTGGTAGTGGTTGCCAGCTTCTGAAGCTTCCCTACTTGGTGGTATTTATCACTTGTATTGGAGCACAAGAGTAGCCTGCAGTCATTGCAGTGAATCTGAAATGATAGTGCGTTAAGTCGCTACATATGGACACTTTAATGCTGTTTCGTTCAAGCTCGTTAGGTGTTTCAAGGATCTGCTGGGCCATGTTTGCATTCCACATTGAAAGAGGCAGCCAAGGTTTGGTACTTATTAGCACTAATTCTGGTCAGAGGTCAGTGGTTCTACCCTTGGCCTTTGGATTCAAAATTTCGTGCTGCTATAAGACGAAAACACTAGGGAGCACTAGTGTGAGAAAGAAGTTGACGATTTGTTTGCTCTCAGATGAATACGATTGAAGCAGCATTTGACAGAAGAATTTTGGAGGGCAGACTTGCCGGGCGGATGGGATTCCGTGTGTAAAAGGTACACTATATTCAGCTTGCACTTCGAGAGTATTGTTGGCTACCTGGGTGGAGTCGGTGACTTGTGGGAGCATTACACAGTTTACAGAGGCATAGAATTGATCGTTCATATATTGCTCGGGTGCTGTAATGCTCTGCTTGAGTTGCCTCAGAACATCAAGAGATGCAGATTTTCTCGCTCGTCATGCATGAGTTTCTGCCTATCTTGTATCGGCAACAACGTACGTTTTATCGCTCTTGAAAGTGAAACAGGGAGAAATCGATTGGCCTCGTTGCGCCGTCACAGGTCATACTTAAAAAAATCCTCGAAGTTTTGATGGTTATGCTTTGGAGGCGACAGACTTATACCACAGGTGATAGCTACAATTGATGACTCTGTCGAGAATTGTGTACAATGGCTAGGTAACAATTGCCCTAAAATGTGGGTGTGGCCTAATTCATGGTAGATTCTACAGCCCCCAGAGCCTGGGGTATACAAGACTTCTAACGTCGAACGGGAACACAGTCACTTCATTAGATGCGGGCAGAGGCGCAAGTAGTGGAAGTCTAGGTTCACAGGGTTGTAGTGATAAGTTGTCATACGGGCTTTGGCCCTTGGGGATCTTTGTAGCTGGCACTTGCGTCACGCCCTTACCGCCTGAATTATTTGAAGGCTAAAGGAAAAAGAATCTTGTTCGGAAGCTGTGAATTGATCCAATGTATGAAAACACGTTCATTATATGGACCTTATACGTCCTCGAGCTAATTGCTCGTGAGAGTGTTGAGCCTTTGTTCATTACAAATTCTGCGGTTCTCAATCCGGTCGCTCTCTCTACTATTTCAGAACTAAGGTTCGAAGCGAAGTTGAATCGTTGGCTCAGTTTGGGATATGGAAGAACGGTGTTGTAAGAAATCATAACTGAGCCTGAAATGGAGATTGGCCTAAATAATCAAGAAAGTGGTGTACAATGTTCGATCTGCATTTACCCTGCCTGTTCTGTTACATGAGGGTAATTTTAGTACCCAATGTTGTTCTGAGTGTAAACCGAGTATGACCAATATAACTCTTGTGAAAAATAATGTAACTGAGGAGTAAGTGCATCATATTGTGAGATCATTGTAGGTCAGCTTCATTTATCTCCAAGTGTTGTGAACTATATTAATTCATTTGCTTGAAGCTTGTGGAATGCACTCTAAAATTGAAATGAAACAACGTTTCAGAGGTAGGAACTGAATTTTCAATCAGCACAATTCCTAAGGCGGTGGGACGCACATCATATTATCACAAGCGATATTGGCGGTTGAAAGCAAGTGTCCCTAGAGGAAACAATGTTTTATTGGTACTAGATTTTGCAACTTGCCATTTCAAAACTGGATAAATGACATGATGCTTTAAGCACAAATGTGTCAAAACTATTAATCCACAAGTTCTGCACTCCACACACTGAAACTTACTTTGTTATTCTCTCTCAAAATAATTTGATGAAATCACTAAAAAAC

mRNA

>Mapoly0070s0095.2
CGAAGCAGGGCAAGGTCCGGAGAGGACTCGTACTCCGTCGGAGATGCTAATCGTCGAGGAATTTTGACGTGCACGTCTGGCTGTGCGGAGGGTGCCTAGCAGACGTAACCGTGTTGGATCCGTGACGTTTTTGGATGCTCGAGGCGCCCGGGGTCCTTCGTGTTCGAGTAGTTTCGAGAGCCGGATGTGTATGAGGGCGCGCTCGTGAGCGACTCGGTGGGGAAAAATGGGAAAGAAGAAGAAAAAGTCGTTCAAGGTGTGGTGTTTCTATTGCGAGAGGGAGTTCGAGGACGAGAAAATTTTAATTCAGCATCAGAAGGCCAAGCACTTCAAGTGCCATGTCTGCCACAAGAAGTTGTCGACGGCCGGTGGCATGGTGGTGCACGTTCTCCAAGTCCACAAGGAGTCTATCACGAAGGTTCCAAATGCGAAACCGGAGAGGGAGTCAACGGAACCTGAAATATTTGGCATGGAGGGTATCCCCCCCGAGATTCTAGCTGCGCATGACGGGGACCAAGGTGGGCTGGATGACGATGAAAAGCCTGCAAAGGTTGCGAGGGTGGAGATTCCCCCCTCTTCGCCATTTGGTGGCTTAGTAATGGGACCGATTGCTCTCGGTATGGCCTCCCAACCGATGTATTCTCCAATGCCGCCTGTATATATGTCCCAACAACCCAGTGGCCCACGACCTCCTTCTTGGCCACCTCAACCGCCGAACTCACATGGGTGGAACCATATGCACCCTGGACAACCCCCAATGCACCCACCACGACCCCCTCCTCCACCACAACCGCTGTTTCCAATACAGGCTCCCAATCCACCTTCTATGTCATCAGCCTCTGCGCTACCACCAGCGCAGCCATTATTTCCTATTCGACCAGCTGCCCCCCCATCTTCGGCTCCTCCTTCGCAGCCTTTATTTCCTGTCAATGGTACGCCATCCACTGGTTCTTCTTCTTCGTCATCATCAGTTGGTACGTCGTCTAGCGGAGTTCCTTTGAGGAGCCCAGGAAATGGGCAGACTGCGGTGGACAGCACTAGTGGAGCTGGGTCCTTACCAGGAGGTCAGAGTTCAGTCACATCAGCAACTATGGTGGGACGCCCTCCTTCCTTACCTTTTGGAGGAGTTCCGAATTTACCCCCCTCAGGAAGTCACATGTACGCATCTGCCCCAAGCACAGGAGGTCCGTCCATTGGCCCACCTCCAGTTATATCAAACAAACCTCCCGGTCCTCCAGGCTTGACCAACGAGGTCTACCTTGTCTGGGATGACGAGATTTTGTCCATGGAGGAGAGAAGACTGTCTTTACCTCAGTATCAGGTGCTTGATGAAACCTCACAGATGAATACGATTGAAGCAGCATTTGACAGAAGAATTTTGGAGGGCAGACTTGCCGGGCGGATGGGATTCCGTGTGTAAAAGAACATCAAGAGATGCAGATTTTCTCGCTCGTCATGCATGAGTTTCTGCCTATCTTGTATCGGCAACAACGTACGTTTTATCGCTCTTGAAAGTGAAACAGGGAGAAATCGATTGGCCTCGTTGCGCCGTCACAGGTCATACTTAAAAAAATCCTCGAAGTTTTGATGGTTATGCTTTGGAGGCGACAGACTTATACCACAGAACTAAGGTTCGAAGCGAAGTTGAATCGTTGGCTCAGTTTGGGATATGGAAGAACGGTGTTGTAAGAAATCATAACTGAGCCTGAAATGGAGATTGGCCTAAATAATCAAGAAAGTGGTGTACAATGTTCGATCTGCATTTACCCTGCCTGTTCTGTTACATGAGGAGGTAGGAACTGAATTTTCAATCAGCACAATTCCTAAGGCGGTGGGACGCACATCATATTATCACAAGCGATATTGGCGGTTGAAAGCAAGTGTCCCTAGAGGAAACAATGTTTTATTGGTACTAGATTTTGCAACTTGCCATTTCAAAACTGGATAAATGACATGATGCTTTAAGCACAAATGTGTCAAAACTATTAATCCACAAGTTCTGCACTCCACACACTGAAACTTACTTTGTTATTCTCTCTCAAAATAATTTGATGAAATCACTAAAAAAC

CDS

>Mapoly0070s0095.2
ATGGGAAAGAAGAAGAAAAAGTCGTTCAAGGTGTGGTGTTTCTATTGCGAGAGGGAGTTCGAGGACGAGAAAATTTTAATTCAGCATCAGAAGGCCAAGCACTTCAAGTGCCATGTCTGCCACAAGAAGTTGTCGACGGCCGGTGGCATGGTGGTGCACGTTCTCCAAGTCCACAAGGAGTCTATCACGAAGGTTCCAAATGCGAAACCGGAGAGGGAGTCAACGGAACCTGAAATATTTGGCATGGAGGGTATCCCCCCCGAGATTCTAGCTGCGCATGACGGGGACCAAGGTGGGCTGGATGACGATGAAAAGCCTGCAAAGGTTGCGAGGGTGGAGATTCCCCCCTCTTCGCCATTTGGTGGCTTAGTAATGGGACCGATTGCTCTCGGTATGGCCTCCCAACCGATGTATTCTCCAATGCCGCCTGTATATATGTCCCAACAACCCAGTGGCCCACGACCTCCTTCTTGGCCACCTCAACCGCCGAACTCACATGGGTGGAACCATATGCACCCTGGACAACCCCCAATGCACCCACCACGACCCCCTCCTCCACCACAACCGCTGTTTCCAATACAGGCTCCCAATCCACCTTCTATGTCATCAGCCTCTGCGCTACCACCAGCGCAGCCATTATTTCCTATTCGACCAGCTGCCCCCCCATCTTCGGCTCCTCCTTCGCAGCCTTTATTTCCTGTCAATGGTACGCCATCCACTGGTTCTTCTTCTTCGTCATCATCAGTTGGTACGTCGTCTAGCGGAGTTCCTTTGAGGAGCCCAGGAAATGGGCAGACTGCGGTGGACAGCACTAGTGGAGCTGGGTCCTTACCAGGAGGTCAGAGTTCAGTCACATCAGCAACTATGGTGGGACGCCCTCCTTCCTTACCTTTTGGAGGAGTTCCGAATTTACCCCCCTCAGGAAGTCACATGTACGCATCTGCCCCAAGCACAGGAGGTCCGTCCATTGGCCCACCTCCAGTTATATCAAACAAACCTCCCGGTCCTCCAGGCTTGACCAACGAGGTCTACCTTGTCTGGGATGACGAGATTTTGTCCATGGAGGAGAGAAGACTGTCTTTACCTCAGTATCAGGTGCTTGATGAAACCTCACAGATGAATACGATTGAAGCAGCATTTGACAGAAGAATTTTGGAGGGCAGACTTGCCGGGCGGATGGGATTCCGTGTGTAA

Protein

>Mapoly0070s0095.2
MGKKKKKSFKVWCFYCEREFEDEKILIQHQKAKHFKCHVCHKKLSTAGGMVVHVLQVHKESITKVPNAKPERESTEPEIFGMEGIPPEILAAHDGDQGGLDDDEKPAKVARVEIPPSSPFGGLVMGPIALGMASQPMYSPMPPVYMSQQPSGPRPPSWPPQPPNSHGWNHMHPGQPPMHPPRPPPPPQPLFPIQAPNPPSMSSASALPPAQPLFPIRPAAPPSSAPPSQPLFPVNGTPSTGSSSSSSSVGTSSSGVPLRSPGNGQTAVDSTSGAGSLPGGQSSVTSATMVGRPPSLPFGGVPNLPPSGSHMYASAPSTGGPSIGPPPVISNKPPGPPGLTNEVYLVWDDEILSMEERRLSLPQYQVLDETSQMNTIEAAFDRRILEGRLAGRMGFRV

Mapoly0070s0095.3  

Gene structure:

mRNA scaffold_70:1040588..1046667  ( + strand )
five_prime_UTR scaffold_70:1040588..1040835  ( + strand )
CDS scaffold_70:1040836..1041026  ( + strand )
CDS scaffold_70:1042663..1042775  ( + strand )
CDS scaffold_70:1043111..1043237  ( + strand )
CDS scaffold_70:1043871..1044337  ( + strand )
CDS scaffold_70:1044530..1044693  ( + strand )
CDS scaffold_70:1045144..1045197  ( + strand )
CDS scaffold_70:1045824..1045901  ( + strand )
three_prime_UTR scaffold_70:1045902..1046667  ( + strand )

Sequences:

Gene

>Mapoly0070s0095.3
TTCCTTCCGGTGGAGGAAGACACGAAGCAGGGCAAGGTCCGGAGAGGACTCGTACTCCGTCGGAGATGCTAATCGTCGAGGAATTTTGACGTGCACGTCTGGCTGTGCGGAGGGTGCCTAGCAGACGTAACCGTGTTGGATCCGTGACGTTTTTGGATGCTCGAGGCGCCCGGGGTCCTTCGTGTTCGAGTAGTTTCGAGAGCCGGATGTGTATGAGGGCGCGCTCGTGAGCGACTCGGTGGGGAAAAATGGGAAAGAAGAAGAAAAAGTCGTTCAAGGTGTGGTGTTTCTATTGCGAGAGGGAGTTCGAGGACGAGAAAATTTTAATTCAGCATCAGAAGGCCAAGCACTTCAAGTGCCATGTCTGCCACAAGAAGTTGTCGACGGCCGGTGGCATGGTGGTGCACGTTCTCCAAGTCCACAAGGAGTCTATCACGAAGTAAGACCATTTTCTCTGAATTCGTTTTGTACTGTTTGCGCCGCAGAATGATTTGAAAGTTGTGGATTGTAGTGTGCGACGGTCTGTGTATTGCGTACTGGATTTTTTGGTATTTCTGTGTCCACTTCGAAAATCAGTTACAGGCGAGTCAAGATTCTCGAAGTAGGGGACCGCTCTCGTGAAGCATTCGCCACAGAATACGACCGCTGCAGGGTTCGAGTGATAGCCAAAATAAATTGTAAACGTTACTTCGTCCGGAAGATTAATTGTCAGAGATGTGTTCGACTACAGTTCGGGAGCTTCTGTGAGGCTTACATGATAGTATTGCTTGTTAATTTCATTACACATGAAATTTGAGGGGCACGTGAAGATAACGGGCTTGTCCAAGGTGGTGATTGTGATATGCAGTGGAACAGTACAGCTCAATTTTTAAATCTAGGAAGCTTTGTAGCTGTTTTTGAAGCCATGAGACAATTTTGCTTCAGATTTTTGAAAAAAGTCGCGTCTTGGATTGGTTGTTGACAGCAAGCAGTGTCGCATTTCATCAGGCAGAATCACTAAGGTCGCCGTTGACAAGAACTTAGATAAATAGTTTCTTCGTTGTAGGTGACTGACAAGAGTTTGATCCAGGTTAAATCTTACATGTGATTTTTTACGCTTTGGATTGTATTCTCAATTCACTCAGTTCTTGCATCATCCACTAGATTGTCTTACCCACAGCTCAGCATATGACAGTGTCACAGATGAATGCATGACTGAAAAATTGTCAAGGCCTAATTTTCAAGGAGGCCTGAACACACTGACTGATTGCCACTAATTTCATTAGCCGTACTCACTTGAAAATTCACCTAGAATCAGTGTGTTAAAAATGTACTGTGATTGTGCTGAATATCTATACACTGAGCCTTAGAAACCCCAGGTTCACAGGTACGGTCACCAGTAATTCTTAAGGTGTTGATTTGTTTTCGTCCCGTACACCACAGGGATTTTTTCCTCGATAGAATCGAAAGCACGGTCGGTAAGTAGGGTAGTAGCAGCTGCTAATGTGATTGGTTGTTGATGCGCTCCTTGATTTGGGATGACTTTTAAGATCGTAGTGTAGAAGAGCAGGAAAGTAAAATTTCATTAAAGGCATGGTATTGGCGAGAAGTTCCCTATATCCAAGAAGCTTCTTCTGGACGGATGTCTATGCTTATGCTTCTGCTCCTCCTGCTCTGCGTGCATTTTGTTACTCCAGTGAGAAAAATAATTTGACAACTGGAAGTGAATTGCACCTCTTGGAATACTACGGTAGAGAAGTTGAAATTGAGACATTCAGTGGGCTTTCTTCGATCGACCCAGCTGGCCTTTAGTGTGTTTTTGAATTCACGTATGTCAAATAAGTCGTGGATGCTATGAGTTGATGGCCAGCTGGTGTTGGTTCAGATCTTTCTAGACATATAAATGCCTGGGCTTTGATTTCCTAATTTTTAAACCAGTCACAGGACTTTCAGTGTAGTCAATAACTTCAACACAATACTTTCTTTGCTTTAGTGTTCGACTTCGTAAAGTATGTAACCGTCTCCACTGTAGCTGGATACCTGTGTCCGCCACTTCCGAAACTTCGTACTTATTTTTCTGTTTGCGTTACAATTAGGGTTCCAAATGCGAAACCGGAGAGGGAGTCAACGGAACCTGAAATATTTGGCATGGAGGGTATCCCCCCCGAGATTCTAGCTGCGCATGACGGGGACCAAGGTGGGCTGGATGGTATGGAAATCAATGGCCTTTTTTTTTGTCAGTCATTCTGCAATATCATCATCTACTGAGTTCGTGTTCTACAGATATTGTTTGTGCTTTGGCAGCAACACTAGTATGTACTTCACAAATCTCAAGGTTCTACTGAGGTTCTTATCCTGCGCCTGTTCAAATTTTGTCTTTGAGTTGAGAGGTGGTTCCTTCCTCTATCACAGTTGTGAGGAACTATTGGGATTGGAACAGTGTCAAGGGGTCCAGTTTTTAGTACGTTAAGTCAAAACCTTTCGCTCCTTTTGTATCAATTAGTATGATTTTTAATGTCCTCTCGGAGCCTCCGGCTCACGCAGACGATGAAAAGCCTGCAAAGGTTGCGAGGGTGGAGATTCCCCCCTCTTCGCCATTTGGTGGCTTAGTAATGGGACCGATTGCTCTCGGTATGGCCTCCCAACCGATGTATTCTCCAATGCCGCCTGTGTAAGTATCTCTTCTTATATCCCTTACTACCGTTGCCTTTTTGTGTTCGTGGTGTATGTGGCCGACCAGGTGTGGGATGCTTGGTTTCATTCAAGGTATGTAGGACATATCTTCTGAAATGGTATAAGCCATTGTTTCCTGCTGCCCATTTTGTGAGGTCAAGGTCTGGAAAGCAGGACAGGCTGGAAACGTGCATTTTTTGTGAATTTTTTCTCGTAATTGAGCTTTCTCTTGTACATGAGATTCAAGGATGGAAGCTTTTCCTGTGTCCAAAGTGTTCTTCCTTCGGACTTTGGTTCAGGCTAGGATTTCCCCCAGATCCAAATTTTATAGTTTATTCTCGCAGAGATAAGCACATCACACTTGTTTTGATGCTTGTGGACTCTTGCTTCGTCTTTCAAAGTGAAGCAGAGAACGTTGCATCTTTCTGGTGATTCACATGATTTATTAAGGCGGCCTAGCCCATTTGAAGTGTTAGTAGGTCTGATCAGTTTCGTAATGTGCTTTATACCAGTGGGGAGTTTGACTGGATAGCACGCATCTGTTTATTGATTTTCTCCTTCATTGCATTGTGATATTTTGATGTATTAAGTTCAAATAAGTTAGAAAATATGACTCTGTTGTGCATTGCAGATATATGTCCCAACAACCCAGTGGCCCACGACCTCCTTCTTGGCCACCTCAACCGCCGAACTCACATGGGTGGAACCATATGCACCCTGGACAACCCCCAATGCACCCACCACGACCCCCTCCTCCACCACAACCGCTGTTTCCAATACAGGCTCCCAATCCACCTTCTATGTCATCAGCCTCTGCGCTACCACCAGCGCAGCCATTATTTCCTATTCGACCAGCTGCCCCCCCATCTTCGGCTCCTCCTTCGCAGCCTTTATTTCCTGTCAATGGTACGCCATCCACTGGTTCTTCTTCTTCGTCATCATCAGTTGGTACGTCGTCTAGCGGAGTTCCTTTGAGGAGCCCAGGAAATGGGCAGACTGCGGTGGACAGCACTAGTGGAGCTGGGTCCTTACCAGGAGGTCAGAGTTCAGTCACATCAGCAACTATGGTGGGACGCCCTCCTTCCTTACCTTTTGGAGGTAAGAAACACCCATTCTCGGTATCTGTTTTAATATTTCGCATCGTCAATTCACTCCCCATTGTTGTATTTTGCCAAGATGTGAGTAGTAGCGTGTGTCAAGAGTTCCACATTTGGATTCTGCGCCATGCGGTCCGTTTCTCTATGTAATAGTTTGCTTCAAGCTTATTAGCTTTGTCTCGATGTATGACAGGAGTTCCGAATTTACCCCCCTCAGGAAGTCACATGTACGCATCTGCCCCAAGCACAGGAGGTCCGTCCATTGGCCCACCTCCAGTTATATCAAACAAACCTCCCGGTCCTCCAGGCTTGACCAACGAGGTCTACCTTGTCTGGGATGACGAGATTTTGTCCATGGTAAGGTGTCTTTGACAAAACTAAATGGATCCGATTTTTGCTTTTATTTCATTCACCAGCTCCTTCGTATACATCTTTTCTTATCGTAGCAAATGAATATGGCGTGCTTGGCACATCTGGCTTTCTATTCATCAACACTTCAAACACATGAGGAGACACCAAACTGTTCAGGACATTTATATTCCAGTGGACTTTTCAGACTTTCTATTTTAGTCTTTGTGCAGTTGAAGCAGAGTAGATATAATTCACTAGTTTTACAAGCAGCCTTCACCCTCAGGCCATCTTACAGGCTCTCAACTTTCAGCATTTTCTCATGTTGAGAAATGTCTTTTACCGCGTACTGTGTTGAACTCTAATGGTCATACCGACGGCTCACAATATTCTATTTACTATCATTCTACGGTGCCGATGCTTCCTCTTATTGAGAATTGTACGATATCTGTCGTGCAGGAGGAGAGAAGACTGTCTTTACCTCAGTATCAGGTGCTTGATGAAACCTCACAGGTAAGCACCAAACTTGACGTTGATTGATAGGTTGACGACGGCTGGCAAAAGATGGTGTGTACATGAACTCTCTGCAAAATGTTTATGAAAGTGCTAGAGGATTATAGCTCAGAATGACTAAGTACAGGAGACGACATGTACTTGACGAATCCCGACGGCATCAGTAAAAAACTTGATTCGGCCAATGCCGGGAGTGTGTCCTGGTTTAGGGTTAAGCTTTCATTCGGGGGCAAGCATGTCTGTTAGCTCTTCTTGGTCATGGTTTGGTAGTGGTTGCCAGCTTCTGAAGCTTCCCTACTTGGTGGTATTTATCACTTGTATTGGAGCACAAGAGTAGCCTGCAGTCATTGCAGTGAATCTGAAATGATAGTGCGTTAAGTCGCTACATATGGACACTTTAATGCTGTTTCGTTCAAGCTCGTTAGGTGTTTCAAGGATCTGCTGGGCCATGTTTGCATTCCACATTGAAAGAGGCAGCCAAGGTTTGGTACTTATTAGCACTAATTCTGGTCAGAGGTCAGTGGTTCTACCCTTGGCCTTTGGATTCAAAATTTCGTGCTGCTATAAGACGAAAACACTAGGGAGCACTAGTGTGAGAAAGAAGTTGACGATTTGTTTGCTCTCAGATGAATACGATTGAAGCAGCATTTGACAGAAGAATTTTGGAGGGCAGACTTGCCGGGCGGATGGGATTCCGTGTGTAAAAGGTACACTATATTCAGCTTGCACTTCGAGAGTATTGTTGGCTACCTGGGTGGAGTCGGTGACTTGTGGGAGCATTACACAGTTTACAGAGGCATAGAATTGATCGTTCATATATTGCTCGGGTGCTGTAATGCTCTGCTTGAGTTGCCTCAGAACATCAAGAGATGCAGATTTTCTCGCTCGTCATGCATGAGTTTCTGCCTATCTTGTATCGGCAACAACGTACGTTTTATCGCTCTTGAAAGTGAAACAGGGAGAAATCGATTGGCCTCGTTGCGCCGTCACAGGTCATACTTAAAAAAATCCTCGAAGTTTTGATGGTTATGCTTTGGAGGCGACAGACTTATACCACAGGTGATAGCTACAATTGATGACTCTGTCGAGAATTGTGTACAATGGCTAGGTAACAATTGCCCTAAAATGTGGGTGTGGCCTAATTCATGGTAGATTCTACAGCCCCCAGAGCCTGGGGTATACAAGACTTCTAACGTCGAACGGGAACACAGTCACTTCATTAGATGCGGGCAGAGGCGCAAGTAGTGGAAGTCTAGGTTCACAGGGTTGTAGTGATAAGTTGTCATACGGGCTTTGGCCCTTGGGGATCTTTGTAGCTGGCACTTGCGTCACGCCCTTACCGCCTGAATTATTTGAAGGCTAAAGGAAAAAGAATCTTGTTCGGAAGCTGTGAATTGATCCAATGTATGAAAACACGTTCATTATATGGACCTTATACGTCCTCGAGCTAATTGCTCGTGAGAGTGTTGA

mRNA

>Mapoly0070s0095.3
TTCCTTCCGGTGGAGGAAGACACGAAGCAGGGCAAGGTCCGGAGAGGACTCGTACTCCGTCGGAGATGCTAATCGTCGAGGAATTTTGACGTGCACGTCTGGCTGTGCGGAGGGTGCCTAGCAGACGTAACCGTGTTGGATCCGTGACGTTTTTGGATGCTCGAGGCGCCCGGGGTCCTTCGTGTTCGAGTAGTTTCGAGAGCCGGATGTGTATGAGGGCGCGCTCGTGAGCGACTCGGTGGGGAAAAATGGGAAAGAAGAAGAAAAAGTCGTTCAAGGTGTGGTGTTTCTATTGCGAGAGGGAGTTCGAGGACGAGAAAATTTTAATTCAGCATCAGAAGGCCAAGCACTTCAAGTGCCATGTCTGCCACAAGAAGTTGTCGACGGCCGGTGGCATGGTGGTGCACGTTCTCCAAGTCCACAAGGAGTCTATCACGAAGGTTCCAAATGCGAAACCGGAGAGGGAGTCAACGGAACCTGAAATATTTGGCATGGAGGGTATCCCCCCCGAGATTCTAGCTGCGCATGACGGGGACCAAGGTGGGCTGGATGACGATGAAAAGCCTGCAAAGGTTGCGAGGGTGGAGATTCCCCCCTCTTCGCCATTTGGTGGCTTAGTAATGGGACCGATTGCTCTCGGTATGGCCTCCCAACCGATGTATTCTCCAATGCCGCCTGTATATATGTCCCAACAACCCAGTGGCCCACGACCTCCTTCTTGGCCACCTCAACCGCCGAACTCACATGGGTGGAACCATATGCACCCTGGACAACCCCCAATGCACCCACCACGACCCCCTCCTCCACCACAACCGCTGTTTCCAATACAGGCTCCCAATCCACCTTCTATGTCATCAGCCTCTGCGCTACCACCAGCGCAGCCATTATTTCCTATTCGACCAGCTGCCCCCCCATCTTCGGCTCCTCCTTCGCAGCCTTTATTTCCTGTCAATGGTACGCCATCCACTGGTTCTTCTTCTTCGTCATCATCAGTTGGTACGTCGTCTAGCGGAGTTCCTTTGAGGAGCCCAGGAAATGGGCAGACTGCGGTGGACAGCACTAGTGGAGCTGGGTCCTTACCAGGAGGTCAGAGTTCAGTCACATCAGCAACTATGGTGGGACGCCCTCCTTCCTTACCTTTTGGAGGAGTTCCGAATTTACCCCCCTCAGGAAGTCACATGTACGCATCTGCCCCAAGCACAGGAGGTCCGTCCATTGGCCCACCTCCAGTTATATCAAACAAACCTCCCGGTCCTCCAGGCTTGACCAACGAGGTCTACCTTGTCTGGGATGACGAGATTTTGTCCATGGAGGAGAGAAGACTGTCTTTACCTCAGTATCAGGTGCTTGATGAAACCTCACAGATGAATACGATTGAAGCAGCATTTGACAGAAGAATTTTGGAGGGCAGACTTGCCGGGCGGATGGGATTCCGTGTGTAAAAGGTACACTATATTCAGCTTGCACTTCGAGAGTATTGTTGGCTACCTGGGTGGAGTCGGTGACTTGTGGGAGCATTACACAGTTTACAGAGGCATAGAATTGATCGTTCATATATTGCTCGGGTGCTGTAATGCTCTGCTTGAGTTGCCTCAGAACATCAAGAGATGCAGATTTTCTCGCTCGTCATGCATGAGTTTCTGCCTATCTTGTATCGGCAACAACGTACGTTTTATCGCTCTTGAAAGTGAAACAGGGAGAAATCGATTGGCCTCGTTGCGCCGTCACAGGTCATACTTAAAAAAATCCTCGAAGTTTTGATGGTTATGCTTTGGAGGCGACAGACTTATACCACAGGTGATAGCTACAATTGATGACTCTGTCGAGAATTGTGTACAATGGCTAGGTAACAATTGCCCTAAAATGTGGGTGTGGCCTAATTCATGGTAGATTCTACAGCCCCCAGAGCCTGGGGTATACAAGACTTCTAACGTCGAACGGGAACACAGTCACTTCATTAGATGCGGGCAGAGGCGCAAGTAGTGGAAGTCTAGGTTCACAGGGTTGTAGTGATAAGTTGTCATACGGGCTTTGGCCCTTGGGGATCTTTGTAGCTGGCACTTGCGTCACGCCCTTACCGCCTGAATTATTTGAAGGCTAAAGGAAAAAGAATCTTGTTCGGAAGCTGTGAATTGATCCAATGTATGAAAACACGTTCATTATATGGACCTTATACGTCCTCGAGCTAATTGCTCGTGAGAGTGTTGA

CDS

>Mapoly0070s0095.3
ATGGGAAAGAAGAAGAAAAAGTCGTTCAAGGTGTGGTGTTTCTATTGCGAGAGGGAGTTCGAGGACGAGAAAATTTTAATTCAGCATCAGAAGGCCAAGCACTTCAAGTGCCATGTCTGCCACAAGAAGTTGTCGACGGCCGGTGGCATGGTGGTGCACGTTCTCCAAGTCCACAAGGAGTCTATCACGAAGGTTCCAAATGCGAAACCGGAGAGGGAGTCAACGGAACCTGAAATATTTGGCATGGAGGGTATCCCCCCCGAGATTCTAGCTGCGCATGACGGGGACCAAGGTGGGCTGGATGACGATGAAAAGCCTGCAAAGGTTGCGAGGGTGGAGATTCCCCCCTCTTCGCCATTTGGTGGCTTAGTAATGGGACCGATTGCTCTCGGTATGGCCTCCCAACCGATGTATTCTCCAATGCCGCCTGTATATATGTCCCAACAACCCAGTGGCCCACGACCTCCTTCTTGGCCACCTCAACCGCCGAACTCACATGGGTGGAACCATATGCACCCTGGACAACCCCCAATGCACCCACCACGACCCCCTCCTCCACCACAACCGCTGTTTCCAATACAGGCTCCCAATCCACCTTCTATGTCATCAGCCTCTGCGCTACCACCAGCGCAGCCATTATTTCCTATTCGACCAGCTGCCCCCCCATCTTCGGCTCCTCCTTCGCAGCCTTTATTTCCTGTCAATGGTACGCCATCCACTGGTTCTTCTTCTTCGTCATCATCAGTTGGTACGTCGTCTAGCGGAGTTCCTTTGAGGAGCCCAGGAAATGGGCAGACTGCGGTGGACAGCACTAGTGGAGCTGGGTCCTTACCAGGAGGTCAGAGTTCAGTCACATCAGCAACTATGGTGGGACGCCCTCCTTCCTTACCTTTTGGAGGAGTTCCGAATTTACCCCCCTCAGGAAGTCACATGTACGCATCTGCCCCAAGCACAGGAGGTCCGTCCATTGGCCCACCTCCAGTTATATCAAACAAACCTCCCGGTCCTCCAGGCTTGACCAACGAGGTCTACCTTGTCTGGGATGACGAGATTTTGTCCATGGAGGAGAGAAGACTGTCTTTACCTCAGTATCAGGTGCTTGATGAAACCTCACAGATGAATACGATTGAAGCAGCATTTGACAGAAGAATTTTGGAGGGCAGACTTGCCGGGCGGATGGGATTCCGTGTGTAA

Protein

>Mapoly0070s0095.3
MGKKKKKSFKVWCFYCEREFEDEKILIQHQKAKHFKCHVCHKKLSTAGGMVVHVLQVHKESITKVPNAKPERESTEPEIFGMEGIPPEILAAHDGDQGGLDDDEKPAKVARVEIPPSSPFGGLVMGPIALGMASQPMYSPMPPVYMSQQPSGPRPPSWPPQPPNSHGWNHMHPGQPPMHPPRPPPPPQPLFPIQAPNPPSMSSASALPPAQPLFPIRPAAPPSSAPPSQPLFPVNGTPSTGSSSSSSSVGTSSSGVPLRSPGNGQTAVDSTSGAGSLPGGQSSVTSATMVGRPPSLPFGGVPNLPPSGSHMYASAPSTGGPSIGPPPVISNKPPGPPGLTNEVYLVWDDEILSMEERRLSLPQYQVLDETSQMNTIEAAFDRRILEGRLAGRMGFRV

Mapoly0070s0095.4  

Gene structure:

mRNA scaffold_70:1040610..1046637  ( + strand )
five_prime_UTR scaffold_70:1040610..1040835  ( + strand )
CDS scaffold_70:1040836..1041026  ( + strand )
CDS scaffold_70:1042663..1042775  ( + strand )
CDS scaffold_70:1043111..1043237  ( + strand )
CDS scaffold_70:1043871..1044337  ( + strand )
CDS scaffold_70:1044530..1044693  ( + strand )
CDS scaffold_70:1045144..1045197  ( + strand )
CDS scaffold_70:1045824..1045901  ( + strand )
three_prime_UTR scaffold_70:1045902..1045904  ( + strand )
three_prime_UTR scaffold_70:1046056..1046637  ( + strand )

Sequences:

Gene

>Mapoly0070s0095.4
CGAAGCAGGGCAAGGTCCGGAGAGGACTCGTACTCCGTCGGAGATGCTAATCGTCGAGGAATTTTGACGTGCACGTCTGGCTGTGCGGAGGGTGCCTAGCAGACGTAACCGTGTTGGATCCGTGACGTTTTTGGATGCTCGAGGCGCCCGGGGTCCTTCGTGTTCGAGTAGTTTCGAGAGCCGGATGTGTATGAGGGCGCGCTCGTGAGCGACTCGGTGGGGAAAAATGGGAAAGAAGAAGAAAAAGTCGTTCAAGGTGTGGTGTTTCTATTGCGAGAGGGAGTTCGAGGACGAGAAAATTTTAATTCAGCATCAGAAGGCCAAGCACTTCAAGTGCCATGTCTGCCACAAGAAGTTGTCGACGGCCGGTGGCATGGTGGTGCACGTTCTCCAAGTCCACAAGGAGTCTATCACGAAGTAAGACCATTTTCTCTGAATTCGTTTTGTACTGTTTGCGCCGCAGAATGATTTGAAAGTTGTGGATTGTAGTGTGCGACGGTCTGTGTATTGCGTACTGGATTTTTTGGTATTTCTGTGTCCACTTCGAAAATCAGTTACAGGCGAGTCAAGATTCTCGAAGTAGGGGACCGCTCTCGTGAAGCATTCGCCACAGAATACGACCGCTGCAGGGTTCGAGTGATAGCCAAAATAAATTGTAAACGTTACTTCGTCCGGAAGATTAATTGTCAGAGATGTGTTCGACTACAGTTCGGGAGCTTCTGTGAGGCTTACATGATAGTATTGCTTGTTAATTTCATTACACATGAAATTTGAGGGGCACGTGAAGATAACGGGCTTGTCCAAGGTGGTGATTGTGATATGCAGTGGAACAGTACAGCTCAATTTTTAAATCTAGGAAGCTTTGTAGCTGTTTTTGAAGCCATGAGACAATTTTGCTTCAGATTTTTGAAAAAAGTCGCGTCTTGGATTGGTTGTTGACAGCAAGCAGTGTCGCATTTCATCAGGCAGAATCACTAAGGTCGCCGTTGACAAGAACTTAGATAAATAGTTTCTTCGTTGTAGGTGACTGACAAGAGTTTGATCCAGGTTAAATCTTACATGTGATTTTTTACGCTTTGGATTGTATTCTCAATTCACTCAGTTCTTGCATCATCCACTAGATTGTCTTACCCACAGCTCAGCATATGACAGTGTCACAGATGAATGCATGACTGAAAAATTGTCAAGGCCTAATTTTCAAGGAGGCCTGAACACACTGACTGATTGCCACTAATTTCATTAGCCGTACTCACTTGAAAATTCACCTAGAATCAGTGTGTTAAAAATGTACTGTGATTGTGCTGAATATCTATACACTGAGCCTTAGAAACCCCAGGTTCACAGGTACGGTCACCAGTAATTCTTAAGGTGTTGATTTGTTTTCGTCCCGTACACCACAGGGATTTTTTCCTCGATAGAATCGAAAGCACGGTCGGTAAGTAGGGTAGTAGCAGCTGCTAATGTGATTGGTTGTTGATGCGCTCCTTGATTTGGGATGACTTTTAAGATCGTAGTGTAGAAGAGCAGGAAAGTAAAATTTCATTAAAGGCATGGTATTGGCGAGAAGTTCCCTATATCCAAGAAGCTTCTTCTGGACGGATGTCTATGCTTATGCTTCTGCTCCTCCTGCTCTGCGTGCATTTTGTTACTCCAGTGAGAAAAATAATTTGACAACTGGAAGTGAATTGCACCTCTTGGAATACTACGGTAGAGAAGTTGAAATTGAGACATTCAGTGGGCTTTCTTCGATCGACCCAGCTGGCCTTTAGTGTGTTTTTGAATTCACGTATGTCAAATAAGTCGTGGATGCTATGAGTTGATGGCCAGCTGGTGTTGGTTCAGATCTTTCTAGACATATAAATGCCTGGGCTTTGATTTCCTAATTTTTAAACCAGTCACAGGACTTTCAGTGTAGTCAATAACTTCAACACAATACTTTCTTTGCTTTAGTGTTCGACTTCGTAAAGTATGTAACCGTCTCCACTGTAGCTGGATACCTGTGTCCGCCACTTCCGAAACTTCGTACTTATTTTTCTGTTTGCGTTACAATTAGGGTTCCAAATGCGAAACCGGAGAGGGAGTCAACGGAACCTGAAATATTTGGCATGGAGGGTATCCCCCCCGAGATTCTAGCTGCGCATGACGGGGACCAAGGTGGGCTGGATGGTATGGAAATCAATGGCCTTTTTTTTTGTCAGTCATTCTGCAATATCATCATCTACTGAGTTCGTGTTCTACAGATATTGTTTGTGCTTTGGCAGCAACACTAGTATGTACTTCACAAATCTCAAGGTTCTACTGAGGTTCTTATCCTGCGCCTGTTCAAATTTTGTCTTTGAGTTGAGAGGTGGTTCCTTCCTCTATCACAGTTGTGAGGAACTATTGGGATTGGAACAGTGTCAAGGGGTCCAGTTTTTAGTACGTTAAGTCAAAACCTTTCGCTCCTTTTGTATCAATTAGTATGATTTTTAATGTCCTCTCGGAGCCTCCGGCTCACGCAGACGATGAAAAGCCTGCAAAGGTTGCGAGGGTGGAGATTCCCCCCTCTTCGCCATTTGGTGGCTTAGTAATGGGACCGATTGCTCTCGGTATGGCCTCCCAACCGATGTATTCTCCAATGCCGCCTGTGTAAGTATCTCTTCTTATATCCCTTACTACCGTTGCCTTTTTGTGTTCGTGGTGTATGTGGCCGACCAGGTGTGGGATGCTTGGTTTCATTCAAGGTATGTAGGACATATCTTCTGAAATGGTATAAGCCATTGTTTCCTGCTGCCCATTTTGTGAGGTCAAGGTCTGGAAAGCAGGACAGGCTGGAAACGTGCATTTTTTGTGAATTTTTTCTCGTAATTGAGCTTTCTCTTGTACATGAGATTCAAGGATGGAAGCTTTTCCTGTGTCCAAAGTGTTCTTCCTTCGGACTTTGGTTCAGGCTAGGATTTCCCCCAGATCCAAATTTTATAGTTTATTCTCGCAGAGATAAGCACATCACACTTGTTTTGATGCTTGTGGACTCTTGCTTCGTCTTTCAAAGTGAAGCAGAGAACGTTGCATCTTTCTGGTGATTCACATGATTTATTAAGGCGGCCTAGCCCATTTGAAGTGTTAGTAGGTCTGATCAGTTTCGTAATGTGCTTTATACCAGTGGGGAGTTTGACTGGATAGCACGCATCTGTTTATTGATTTTCTCCTTCATTGCATTGTGATATTTTGATGTATTAAGTTCAAATAAGTTAGAAAATATGACTCTGTTGTGCATTGCAGATATATGTCCCAACAACCCAGTGGCCCACGACCTCCTTCTTGGCCACCTCAACCGCCGAACTCACATGGGTGGAACCATATGCACCCTGGACAACCCCCAATGCACCCACCACGACCCCCTCCTCCACCACAACCGCTGTTTCCAATACAGGCTCCCAATCCACCTTCTATGTCATCAGCCTCTGCGCTACCACCAGCGCAGCCATTATTTCCTATTCGACCAGCTGCCCCCCCATCTTCGGCTCCTCCTTCGCAGCCTTTATTTCCTGTCAATGGTACGCCATCCACTGGTTCTTCTTCTTCGTCATCATCAGTTGGTACGTCGTCTAGCGGAGTTCCTTTGAGGAGCCCAGGAAATGGGCAGACTGCGGTGGACAGCACTAGTGGAGCTGGGTCCTTACCAGGAGGTCAGAGTTCAGTCACATCAGCAACTATGGTGGGACGCCCTCCTTCCTTACCTTTTGGAGGTAAGAAACACCCATTCTCGGTATCTGTTTTAATATTTCGCATCGTCAATTCACTCCCCATTGTTGTATTTTGCCAAGATGTGAGTAGTAGCGTGTGTCAAGAGTTCCACATTTGGATTCTGCGCCATGCGGTCCGTTTCTCTATGTAATAGTTTGCTTCAAGCTTATTAGCTTTGTCTCGATGTATGACAGGAGTTCCGAATTTACCCCCCTCAGGAAGTCACATGTACGCATCTGCCCCAAGCACAGGAGGTCCGTCCATTGGCCCACCTCCAGTTATATCAAACAAACCTCCCGGTCCTCCAGGCTTGACCAACGAGGTCTACCTTGTCTGGGATGACGAGATTTTGTCCATGGTAAGGTGTCTTTGACAAAACTAAATGGATCCGATTTTTGCTTTTATTTCATTCACCAGCTCCTTCGTATACATCTTTTCTTATCGTAGCAAATGAATATGGCGTGCTTGGCACATCTGGCTTTCTATTCATCAACACTTCAAACACATGAGGAGACACCAAACTGTTCAGGACATTTATATTCCAGTGGACTTTTCAGACTTTCTATTTTAGTCTTTGTGCAGTTGAAGCAGAGTAGATATAATTCACTAGTTTTACAAGCAGCCTTCACCCTCAGGCCATCTTACAGGCTCTCAACTTTCAGCATTTTCTCATGTTGAGAAATGTCTTTTACCGCGTACTGTGTTGAACTCTAATGGTCATACCGACGGCTCACAATATTCTATTTACTATCATTCTACGGTGCCGATGCTTCCTCTTATTGAGAATTGTACGATATCTGTCGTGCAGGAGGAGAGAAGACTGTCTTTACCTCAGTATCAGGTGCTTGATGAAACCTCACAGGTAAGCACCAAACTTGACGTTGATTGATAGGTTGACGACGGCTGGCAAAAGATGGTGTGTACATGAACTCTCTGCAAAATGTTTATGAAAGTGCTAGAGGATTATAGCTCAGAATGACTAAGTACAGGAGACGACATGTACTTGACGAATCCCGACGGCATCAGTAAAAAACTTGATTCGGCCAATGCCGGGAGTGTGTCCTGGTTTAGGGTTAAGCTTTCATTCGGGGGCAAGCATGTCTGTTAGCTCTTCTTGGTCATGGTTTGGTAGTGGTTGCCAGCTTCTGAAGCTTCCCTACTTGGTGGTATTTATCACTTGTATTGGAGCACAAGAGTAGCCTGCAGTCATTGCAGTGAATCTGAAATGATAGTGCGTTAAGTCGCTACATATGGACACTTTAATGCTGTTTCGTTCAAGCTCGTTAGGTGTTTCAAGGATCTGCTGGGCCATGTTTGCATTCCACATTGAAAGAGGCAGCCAAGGTTTGGTACTTATTAGCACTAATTCTGGTCAGAGGTCAGTGGTTCTACCCTTGGCCTTTGGATTCAAAATTTCGTGCTGCTATAAGACGAAAACACTAGGGAGCACTAGTGTGAGAAAGAAGTTGACGATTTGTTTGCTCTCAGATGAATACGATTGAAGCAGCATTTGACAGAAGAATTTTGGAGGGCAGACTTGCCGGGCGGATGGGATTCCGTGTGTAAAAGGTACACTATATTCAGCTTGCACTTCGAGAGTATTGTTGGCTACCTGGGTGGAGTCGGTGACTTGTGGGAGCATTACACAGTTTACAGAGGCATAGAATTGATCGTTCATATATTGCTCGGGTGCTGTAATGCTCTGCTTGAGTTGCCTCAGAACATCAAGAGATGCAGATTTTCTCGCTCGTCATGCATGAGTTTCTGCCTATCTTGTATCGGCAACAACGTACGTTTTATCGCTCTTGAAAGTGAAACAGGGAGAAATCGATTGGCCTCGTTGCGCCGTCACAGGTCATACTTAAAAAAATCCTCGAAGTTTTGATGGTTATGCTTTGGAGGCGACAGACTTATACCACAGGTGATAGCTACAATTGATGACTCTGTCGAGAATTGTGTACAATGGCTAGGTAACAATTGCCCTAAAATGTGGGTGTGGCCTAATTCATGGTAGATTCTACAGCCCCCAGAGCCTGGGGTATACAAGACTTCTAACGTCGAACGGGAACACAGTCACTTCATTAGATGCGGGCAGAGGCGCAAGTAGTGGAAGTCTAGGTTCACAGGGTTGTAGTGATAAGTTGTCATACGGGCTTTGGCCCTTGGGGATCTTTGTAGCTGGCACTTGCGTCACGCCCTTACCGCCTGAATTATTTGAAGGCTAAAGGAAAAAGAATCTTGTTCGGAAGCTGTGAATTGATCCAATGTATGAAAACACGTTCATTATATGGACCTTATACGT

mRNA

>Mapoly0070s0095.4
CGAAGCAGGGCAAGGTCCGGAGAGGACTCGTACTCCGTCGGAGATGCTAATCGTCGAGGAATTTTGACGTGCACGTCTGGCTGTGCGGAGGGTGCCTAGCAGACGTAACCGTGTTGGATCCGTGACGTTTTTGGATGCTCGAGGCGCCCGGGGTCCTTCGTGTTCGAGTAGTTTCGAGAGCCGGATGTGTATGAGGGCGCGCTCGTGAGCGACTCGGTGGGGAAAAATGGGAAAGAAGAAGAAAAAGTCGTTCAAGGTGTGGTGTTTCTATTGCGAGAGGGAGTTCGAGGACGAGAAAATTTTAATTCAGCATCAGAAGGCCAAGCACTTCAAGTGCCATGTCTGCCACAAGAAGTTGTCGACGGCCGGTGGCATGGTGGTGCACGTTCTCCAAGTCCACAAGGAGTCTATCACGAAGGTTCCAAATGCGAAACCGGAGAGGGAGTCAACGGAACCTGAAATATTTGGCATGGAGGGTATCCCCCCCGAGATTCTAGCTGCGCATGACGGGGACCAAGGTGGGCTGGATGACGATGAAAAGCCTGCAAAGGTTGCGAGGGTGGAGATTCCCCCCTCTTCGCCATTTGGTGGCTTAGTAATGGGACCGATTGCTCTCGGTATGGCCTCCCAACCGATGTATTCTCCAATGCCGCCTGTATATATGTCCCAACAACCCAGTGGCCCACGACCTCCTTCTTGGCCACCTCAACCGCCGAACTCACATGGGTGGAACCATATGCACCCTGGACAACCCCCAATGCACCCACCACGACCCCCTCCTCCACCACAACCGCTGTTTCCAATACAGGCTCCCAATCCACCTTCTATGTCATCAGCCTCTGCGCTACCACCAGCGCAGCCATTATTTCCTATTCGACCAGCTGCCCCCCCATCTTCGGCTCCTCCTTCGCAGCCTTTATTTCCTGTCAATGGTACGCCATCCACTGGTTCTTCTTCTTCGTCATCATCAGTTGGTACGTCGTCTAGCGGAGTTCCTTTGAGGAGCCCAGGAAATGGGCAGACTGCGGTGGACAGCACTAGTGGAGCTGGGTCCTTACCAGGAGGTCAGAGTTCAGTCACATCAGCAACTATGGTGGGACGCCCTCCTTCCTTACCTTTTGGAGGAGTTCCGAATTTACCCCCCTCAGGAAGTCACATGTACGCATCTGCCCCAAGCACAGGAGGTCCGTCCATTGGCCCACCTCCAGTTATATCAAACAAACCTCCCGGTCCTCCAGGCTTGACCAACGAGGTCTACCTTGTCTGGGATGACGAGATTTTGTCCATGGAGGAGAGAAGACTGTCTTTACCTCAGTATCAGGTGCTTGATGAAACCTCACAGATGAATACGATTGAAGCAGCATTTGACAGAAGAATTTTGGAGGGCAGACTTGCCGGGCGGATGGGATTCCGTGTGTAAAAGAACATCAAGAGATGCAGATTTTCTCGCTCGTCATGCATGAGTTTCTGCCTATCTTGTATCGGCAACAACGTACGTTTTATCGCTCTTGAAAGTGAAACAGGGAGAAATCGATTGGCCTCGTTGCGCCGTCACAGGTCATACTTAAAAAAATCCTCGAAGTTTTGATGGTTATGCTTTGGAGGCGACAGACTTATACCACAGGTGATAGCTACAATTGATGACTCTGTCGAGAATTGTGTACAATGGCTAGGTAACAATTGCCCTAAAATGTGGGTGTGGCCTAATTCATGGTAGATTCTACAGCCCCCAGAGCCTGGGGTATACAAGACTTCTAACGTCGAACGGGAACACAGTCACTTCATTAGATGCGGGCAGAGGCGCAAGTAGTGGAAGTCTAGGTTCACAGGGTTGTAGTGATAAGTTGTCATACGGGCTTTGGCCCTTGGGGATCTTTGTAGCTGGCACTTGCGTCACGCCCTTACCGCCTGAATTATTTGAAGGCTAAAGGAAAAAGAATCTTGTTCGGAAGCTGTGAATTGATCCAATGTATGAAAACACGTTCATTATATGGACCTTATACGT

CDS

>Mapoly0070s0095.4
ATGGGAAAGAAGAAGAAAAAGTCGTTCAAGGTGTGGTGTTTCTATTGCGAGAGGGAGTTCGAGGACGAGAAAATTTTAATTCAGCATCAGAAGGCCAAGCACTTCAAGTGCCATGTCTGCCACAAGAAGTTGTCGACGGCCGGTGGCATGGTGGTGCACGTTCTCCAAGTCCACAAGGAGTCTATCACGAAGGTTCCAAATGCGAAACCGGAGAGGGAGTCAACGGAACCTGAAATATTTGGCATGGAGGGTATCCCCCCCGAGATTCTAGCTGCGCATGACGGGGACCAAGGTGGGCTGGATGACGATGAAAAGCCTGCAAAGGTTGCGAGGGTGGAGATTCCCCCCTCTTCGCCATTTGGTGGCTTAGTAATGGGACCGATTGCTCTCGGTATGGCCTCCCAACCGATGTATTCTCCAATGCCGCCTGTATATATGTCCCAACAACCCAGTGGCCCACGACCTCCTTCTTGGCCACCTCAACCGCCGAACTCACATGGGTGGAACCATATGCACCCTGGACAACCCCCAATGCACCCACCACGACCCCCTCCTCCACCACAACCGCTGTTTCCAATACAGGCTCCCAATCCACCTTCTATGTCATCAGCCTCTGCGCTACCACCAGCGCAGCCATTATTTCCTATTCGACCAGCTGCCCCCCCATCTTCGGCTCCTCCTTCGCAGCCTTTATTTCCTGTCAATGGTACGCCATCCACTGGTTCTTCTTCTTCGTCATCATCAGTTGGTACGTCGTCTAGCGGAGTTCCTTTGAGGAGCCCAGGAAATGGGCAGACTGCGGTGGACAGCACTAGTGGAGCTGGGTCCTTACCAGGAGGTCAGAGTTCAGTCACATCAGCAACTATGGTGGGACGCCCTCCTTCCTTACCTTTTGGAGGAGTTCCGAATTTACCCCCCTCAGGAAGTCACATGTACGCATCTGCCCCAAGCACAGGAGGTCCGTCCATTGGCCCACCTCCAGTTATATCAAACAAACCTCCCGGTCCTCCAGGCTTGACCAACGAGGTCTACCTTGTCTGGGATGACGAGATTTTGTCCATGGAGGAGAGAAGACTGTCTTTACCTCAGTATCAGGTGCTTGATGAAACCTCACAGATGAATACGATTGAAGCAGCATTTGACAGAAGAATTTTGGAGGGCAGACTTGCCGGGCGGATGGGATTCCGTGTGTAA

Protein

>Mapoly0070s0095.4
MGKKKKKSFKVWCFYCEREFEDEKILIQHQKAKHFKCHVCHKKLSTAGGMVVHVLQVHKESITKVPNAKPERESTEPEIFGMEGIPPEILAAHDGDQGGLDDDEKPAKVARVEIPPSSPFGGLVMGPIALGMASQPMYSPMPPVYMSQQPSGPRPPSWPPQPPNSHGWNHMHPGQPPMHPPRPPPPPQPLFPIQAPNPPSMSSASALPPAQPLFPIRPAAPPSSAPPSQPLFPVNGTPSTGSSSSSSSVGTSSSGVPLRSPGNGQTAVDSTSGAGSLPGGQSSVTSATMVGRPPSLPFGGVPNLPPSGSHMYASAPSTGGPSIGPPPVISNKPPGPPGLTNEVYLVWDDEILSMEERRLSLPQYQVLDETSQMNTIEAAFDRRILEGRLAGRMGFRV

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>