Mapoly0072s0031



Description

brassinosteroid resistant 1/2

Reference DB

Database ID Description
KEGGORTH K14503 Brassinosteroid resistant 1/2
PFAM PF05687 Plant protein of unknown function (DUF822)
PANTHER PTHR31506 FAMILY NOT NAMED
PANTHER PTHR31506:SF2

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBZR3 transcription factor, BZR/BES Mapoly0072s0031.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0072s0031.1 scaffold_72:282728..291421  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0072s0031.2 scaffold_72:282728..291421  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0072s0031.1  

Gene structure:

mRNA scaffold_72:282728..291421  ( - strand )
three_prime_UTR scaffold_72:282728..283079  ( - strand )
three_prime_UTR scaffold_72:283365..283975  ( - strand )
CDS scaffold_72:283976..284415  ( - strand )
CDS scaffold_72:284518..284631  ( - strand )
CDS scaffold_72:287184..287273  ( - strand )
CDS scaffold_72:287402..288254  ( - strand )
CDS scaffold_72:288881..289216  ( - strand )
five_prime_UTR scaffold_72:289217..289264  ( - strand )
five_prime_UTR scaffold_72:289795..291421  ( - strand )

Sequences:

Gene

>Mapoly0072s0031.1
CGTTTTAATGCGCAACGGACTCGGACTGGTCTAAAGACAGGAAGGAAGGAAGCTCTTTGCATTAAATTACCTGTCGGCAGAATTTTGAGGTTAACGAGTTCATAGCTTATAGCTTACAGCTTACAGGGCTCATTCTAGAAGGATCGGAAGGATTCCAGCTAACAGGGATGAGACGGATATATTTACGATTTTCTTCGAGTAGAGTAAGATCCAGATTCCAGATTCCGGAGCCAAATGACTTGTACGACACAACTTCAATGGCATGACAACCTGTTGAGAAAATTCGTTAACCCAGTACCTGTCGGCTGTAATGCGAATTCGCTCGGCAATAAGAGAATTATTGGGACCGTTAGACCAAATACAGGGTCATACATGTGACCGAAGAGATATTCACGAATTTTACCGAGCTCTGCAGTCCAGCAATCTTGGGATTGGATAACCTCGGACTGAGCCATGCTGGGGGTAGGGATGGGTGTGTCCAATGAGACTGCAGCGAGTGGTCTTCGTCGGTATCGTCCGAGTCTTCGGATATCGTCCAGATTATTTTTGACAGGAGAGGAAGATGGGGAGTTTGGAAGAGAGGGAGACGACGATTAGTGTGGGCGAAGCGCTTGGAGGTCAGGGTGGCTTTAGAAGGAGTTTTTTACTTCTTCCATGTGAAACGATGTTCCTTGTCGGGACACAGGAAGGAGAAGGAACCGCAAGACACCGTAATCCATGTACATGTGGTCCCGAGGCCATCCGAAAGTTCATTAAGTTCCACTCTGAGCGACTCGGGCTTTAATGTAGGTGCTGGAGATGGGCGACGGTGTTGGAACGATGTTGTCTTCTGCTGTCATAGGGTGTTCCATTCAATAGGTAAAGCAGTTTCGACAGGCGGACATTTGCTATACTCCAGGACTGTCGAAATCAGACTCATTGCTTCAGCGAAAGGTCTGCTTGGTTTGGTACGCACAGCTATGATGGAGTGATCGGAGTGTGACATGAAGTGTATCGGGGAGCTTTGCCTAGTAGATGACATCGTTATTGTGCTGGGGACTGAAGAACGCGGTTATACGACTTTCGGTGTGAAGTGTGGGTGGTGAGAAGGGCGTGATGGTTGACGTTTAGAGCTGAGCTTTCTTACCTAAGGCTGCTTCTGATCAGACAGTGACTGGTCCAGAAGTTTGGATATAAGTTTTTTGATGGCTAAAGGCAGCTGCAGCCTTCTCCAGATTTAAAGCGTACGAGTCCAGTGCAGGGATTCTGTCGAGATATATGCTCCACCCATGTTCATTGGGTGAAAGGATGCACAAACTTGGGATGTGAACTTCTCGTCACGAGCAAGTCTTTTCTCGATAATAACGCTTATATCGAAGGGTCGATGCACTGTGAGTGCGTTTTCTAACCGAGAGGAATCTGACCACAACCACCTTTGGAACCAAAGTTGAGCTGAGAAGGATTTTAGAACATATCGATTACCGCTTATTCAACTTCTCTCCTTCTGCTATCATTTCAAAGAGCTCAAAATCTCCGCACTGTGGCAGCGCGCGTCAAAGTCGTGCCGGTTGAAACAGCTCCAAGACCTGGTGATAAAACCTATGAAAATCCCGAACACAAAGTGATTCGGGAGTCAGGACGACAGAAGGTAAACTTTCAATGGGCTGCGTGATCATCATCTCAGGTCTGGTTCAAAAGGGTCTTTTTGATAGACATATAGAACTTCTGTTGGAATAGCACTCGGGAGAGGTTACAAGAACTTTTTAAGTTCCCATAGTGGAGTCTGATACCTTTTTTGCTTGTGTTTTGCCTGAGCACTGAAGGTGAGCTCTGAGCTCCTTTCATGTAGAGTCCCTACTATTCTCAAAGGCTAGAAATTCAATTTCTCTTGATGACCATTATTTGTGTTCTGTCCACTTCACGGCTTTGAACCAACTCGACTGCACCCTGGGACAATTAGTGGGTGATCAGGTCATTCTTTTCTTGCATGTCTGATCTCTGCGCATGCTTCACAGACAGATCGTACACGCTCGTGACAAGTCTAGACCACATAGACCCAACCTTGGATTGTTCCTTGTGTGAAAGAAGTAAAAGCCTCTTACTTCTTCTCCTCTTCGGGGTCCGTGTCATGTTTATACAGGCCTTCTGAAAGTGGTATGGTCTGTCTATCGTGTTAAGGTCCCATAATTCAAAGCCTTCTCCAGAGTCTTCTGAAGTCGCTGCAAAATGGCGAATCGTGCTGCCGAAGCTAGCAGCTCATACAACTTCAAGGTTCGTGGATGCATAAAGTCCACCTCTGGTCCGTGGATAGTAAGGAGACCTCCCACCAAGAATTCCGGCCGAGGCGCGACTTCTGTACTTAGAATGCCTTCTCCTAGGGAACGGGAGAACAACAAAAAGAGAGAGAGGAGAAGGAGAGCAGTCGCAGCTCGCATTTTCGCTGGCCTGAGGCAGTATGGTAACTACAGGCTACCGAAACACGCAGACCACAATGAGGTTTTGAAGGCTTTGTGTGCAGAGGCTGGATGGATCGTGGAGGAAGACGGCACAATATACCGCCAGGTTTGTGGACAGTCGTTCAAATGCTATGATTCACATTCAAGGGACACACGAGATTTTGAAACCTAGATGAAGTTCGTTGTAGTATATTCTTAAGAGGTGCGATGAAGATCATGAATTTTGGAGACGTTATAGTATCTTCATAGACAAAAGGTGGAAATGGTGATGGTTTTTATTTTGGTTTCACATCGAAAACTTTTCGAGTACTCTCTTTGCTACCCGGACCCTAGCGTGGAATATTGAGTAACTAGTTTCAAACTGCTGAATATGTGAACCGGAGCTAAGCACTCCGATTTACAAGATTCAAGACGAAAGTCGATGAGGTCTCTAAACTTCATTTTTCTTTAAGTTATATCAAGACGTCTAGTCACCTAAACCAGCCAGTAAACATTCAGAGCAGTCTCTGATATCTTTGGTGATGGTGTGTTATCGGAGTAGTTGAAATCAAGCCAATTATGTGCAGGTCAAGGATTTTGATCTGGAAAATTGTAATTCCTTCCATATTCCAGTACTATATTTCCCACATTTGGCAGTCGAGGTGGCCTTTCACAATGACAGGATTATAGCACTAATCGTTGTATTTTGGCAGTGGACTAATATCAGTGACAACTGTTGCACGCACTTTGCAGGGACACAAAACCCCTGAACTTAAAGCTGATCTCCAGGAGAGCGAGGTCATCAACGTAAACTGCACATGTGAAATACAAGAGGCGGCTCTTGATTCCGACGGACCCGAGTCGGCGCTAGATCGCTTCAAATATGAGACGAGCACTCCTTCTTCGTCATGCGGTCAGAGCGATGAGACAACATGCTCTATAAGATCCAGAAATAGTGGTAGAAACAACTGTGATCAACCGACTGTTGCAGGAATCTGTGATTACGACTTGAATCTTAGTGGGACAGAAGGCGATTATGAAGAGCTTGACCAAGTTGCTGTGGAGAACGAAGAGAGTACAGTCATGATGTCGGGTCTTCCAGAGCCAAAGAATTTAGAGACAAGTGCGGAAGATTGCGACACGAATATCGAGTTCTTCATAAATCCAGAATCGCGACCAATGAACCTTCCTAAATCAGAAAGGTCCACTGGAGAATGCAACGCTTCATATCATCAAGAATTTCAGTTTTTCGCTGGTCTTTTCCCTGGACCTAGTGACCTACTCACTGCAGCTCTCGCCGTTGCTGATGACACACCGAGCTGCTGTGTTCGTCCAACGAGAGATCTGAATTCACCGCCTATATTTGAGGGAAGCACGTCAACTGAGTTTCCGAATGCCGTTAATTGCAGTCTGCCTCCCGCGCCGTCGATGGATAATACCTTTATTAAAAAGGAGAGCTATAATGATCAGATCTATCTGAAGAATATGGGCAGACAGGACTCGACGTGGATTCCTGCATGTAACGACCACAATGGTCGGAGTGGAGATGCCGATTCATCCCCTTCATCATCAGATACGCCTGAGCTCGAGCTCTTATCCAGCGGTGGTAGGTCTCAACTTCGATGTACAGAGCAGTTACATACGTACATTACACAACGTAGCTTAACTATTTCTTAAGAGAGCCTGCGATTTTTGTTTGTTCATCGATTTCTGTACGTTTTGTGAGTCTTGCAGATGTGATGATTGATTCGACGAGCCCATGCAGGATGGACGCGGGCCGCGTAAGCTGTTCTGATGCTAGCGACTGCCCTTGTGCTATTTCTGGTATGTATATATTTATCAACTTTTCTCCCACTACTCGGAGGACTCGCATTTATTTGCCATTTCTTCAAAGAACTTCCAATTGATTATTAGTGCACCTCCATGTCTGCTCGAATTATCTTTTCTAGTCCACGTTCGCGCATCCAATTGTCTCAAAGCCCATCACATCTCCACATATAAACGTTCGGAAGTTCCGTGCGGGGCAGGTAGGGAAGCTGTCGAGGACAGCTTAGGTCTTTTCCATTCAGTAGGGTCTAGAGCGGATCACACTGACGATATAAATAGTAAATGACCGATATCATATAATCCTGAAAGATGGATTTGACGCCTCTGAGTTGCAGTTCAAAGCTTTTTATTTTCGTCAGTTCATAGCTCGACTTAACATGGATGCAGATCAGATAGTTGACAGCTCCAATGCTATTTGCAGGACTGGTTATTATAACTGGAATTTTTAATTATATTTTCGTATGAGGAAATTTATATAAAAATTTTAGAGAAAAATTGCCCTCTCAACTCCAAAATTTTATTTTGGAAATGATATATTTAATTGCATTGTGTTAATTATGTAGTTGCAACTGATTGACATAAAATATATTCGTGTCGAAAATGCAGCAGACTCCTTTGATTTCCCTTTTTCGGGATGTATAATATAGTTTTTATAGTATAACTAGTTTAATGTACATAAGAAAACAAGATCGGTTCTCACAAGTAATTAGGTGTTTGATGCTTTGTACTTAACGATCCAGTTACTCGGTCTCTTCTATCTAGCATCCCAAGGCGGATCTTCGCAGTCCGATGGTGGATTTAACTTGCCCGATTTAAATTCAGAAGGTTTCGAACCTTGAGTCTCCAGTCCGAACCATTGTTCGAAAGCTCATCCTCTACGCTTTGACAATTCTTCCAACAAGATGATTGAGACTGAATTAAGAAACAGTCTCAATGATTTAGTACCAACAGAGGTAATATACCATCACTGTCGCTACTGGTATGTCAAAATCCACCATGATATTCCTAGACCTGTTATTCCTTCTTTTCAGTGGGCTCTTCCAAGTAGGAAGTAACATAAACCATTTTGGGTTGATACAAGCAAACATTTGATATACGGGCTGCAAAATTTCGTAGTGCTAATATATTTTATTAGTTGCTGCTCAGCCAGCTTCTTCTTTGTATTTCTTTTGTCACTTGTTTCTGTCTACATGAACCACAAGCTTCTGGAATATTCCTTTTCAATTAGTTTTGCGTTGAATTTCTGTAAGCCTTGTAGCTGTGTAGTCAACGCTGCTTTGGTAGATGTGATCTTCTGATCTAAGATGCACAACAATACTACGAATTTCTGTAGGGGTCACAACTGTCTCATCGGTATTTCATTCAAGCATATCTCTTATAAATACCAAAAACGAAGAATATCTAGGCCTAGACTGCATTCGAAGTATTTAGATAAGAATATTATATATCCAGAGGTGTGAAAATATAAGTTTATTTATGTATTCATTTATTCATACTTGTAGAAAATTATTCTTGAGTGCAGCATGTTCTTAGTATTATTCATGAGATGAAGTCTGAATGCAATGTGGGGTTGTATGCAAGGGACTCTTGTAATATGTATCGTATGGGGAGGAGAAACTTATTTCCGTTGTCCCAAAAATGACATGCAACGAAACTTCTTTGCTTATCTTCGGTTTCCCATTGTTCTTGTCAGGGTGTGCTGCTATTTTTATTATTTTTTTAACCCTGTGAGCCCGTCCTAGTTTCCGGTCCTCGCCTATTATCAATATTATTGTTAGTGTGCATTGTGGATTGATGAACACTTTGTGGTAGGGTTTTTAATTCATTTTCTGGTATTATTGCAGCCGTATCTTGTATTCTGCTTTTGCTGTTAAATTTCTCCATCCACGGTGTGGTTCTCTTCAGGTTGTACATGTGCAAAGTTCTGCTTCTTGTCATATCTAAAGTACATAACAGTTAAGTCATGTATATCTTCATTTGAATTCAAGCTATAGCTTGCATTTTAAAGTACCTTAACGCCGGATTTGCTTCGTAAGGCTATCACCTTATATTTTCCAAAACACTAGCCGATCACAATACCTTGTCCGAGCGTAGTGTATATATGTTTCATGATGCAAAAGATGGCTATGAAATTATAAGAGCGTATGAAACTTGTAATCAAGATTAGAAGCAAGATATGCTATTTAGCGGAAATACTGCTACCTTTCAGTACCTATAAATTACAGATTTTATGACTGATCCAAAAATGCTTCCTATTCACATTTAGTTCATAACACTACTTTGTTCTTTCTTTCATCTAAGACAAAGATTGGAAGAAACTCTACAGGCAGTGAGCAGTCTAAATCAGGAGTAATGTATAACCGTTGGATGAGCTGGTCCAACAATGTGCTACATAAATGGTCAAATGAAAATTCTTCATATTGTTAAGGGCAGGAGGTGGAAGGCTGATAAACGTAAATTCACAAACTTTGAAACTTCATTTGATTTTTTTCGTGATTTAATCTTTTGAGACGTCCATAAGTTGTCTCACTCCAGCTCTCTATGTGCAGATGAGACCCCATTGCAAAGCTCAGTTTCCAATGGCTTACTTATAGCGAGAAACTATCGAGTTCCACCAGTCTCATACGCAGGTATCCACAGACATCTGACGCTCCAGCATTTGGGTATGTCAAAACACAGCTGCAGTATTCATTTTCCATCAGTTTGCAGGGGAAGCTCAAGGGCTAAATATGATAACTTTGCCACAACTGGTGTTTCTTCTGCAGGTCCAGATCAAGGGTATCTCCTCGATCGGAAGAATGGAAGTAGTTCAGCACTCAGCAATCAGCGATCTATGCAGTCCACCCGTGAATATAGCAATTGGAACGACCTCACCCACCGCGCTTCTGGCCGAGGTGGTCAAACGGCAGCAGCCACCAACATAGGCCACCATCAGTCAGTATCGATCACAACAGCTGCTTCCAAGCCCTTTGATAAGACTGCTTTGTATGAATTTTCTCCAGGTACGGATTTCCATGGTCAGAACAAACAGCAGTACCGCGGGCCCTTGATATTACCACCGAAGCAGCAGCAGCTGCAGTCAGCACCACCGGTGGATGCCCTGTCCCTCACCCTTTGCACATCTACAGGCTCTACCGGTCTTAGCTCAGAATATCCATTTTGCTTTATCAAACGTCATATTAAGCTTCCCATCCCCCAAACTTAATCGTGTACCCTCTTTCCTCAATATCATTATCTCCGACTGAATATTATAGTTTCGTGTTTCAAACGCCTCATCATTGATATAAAACTCGCCTTTTTGCATCGGCAAACCATGATAATTATGGGGTAATAACGAATGTGCGTTTAAATTGTAGATTCATTTCTACCAAGAAAGTTGATCAGAAATATATGTGAACGATTTTGTGAGCTGCTTTTGTCGACCTTAACATTTCAACTGTAAATTAGTTGCAACTCTTATGTCGAGTTTGTCAGCAGCGTGTTAGCAGCAAAGGGCAGTGGCGAATGCCATTCTCTGAGCATGGGCTGAGATGCTGTTTGCATACGCCCTATTTCGATCAGTTGATCAAATTGAACCAAATTTTCTAACCGCATCAAACCTGAAGAAGGTTCAGTTTTATGTTTCTTAACTTCAAGCTGATTTTGTAAAATTATGCTCTTGTGCAAGCAAAATAGGTGTGCTGTCTGCAGACTCCTTGGTTTTTATTTAGAAGTTTCGGCTTATGTTCGACCTATGCTTCGGCTTATGCTATGACTAGTGTTTCGACTTATGCCTTTCGACTGTCCCAAATCCACATGATTCAGAGCTCGTAAACTGTAAGTATGATATTGACTGAATAGATGAGGTTTTATTTCATTTCTTTACTGTTGAGTTGCTCCATGATGGCGATTTATACAACCTCAAATCACTCTAGTTATCTGATCGTTGTCATACTTTGAAGAACCGATTGACCGATTTATCTTCGATTAAGCTCGAGAACCGTCGCAGCGAAGGGTTAAGAGAATTTTTACTTAGAATATCCTTGTCAATATTTTCCATAAAATTACAGTTGATCTCTTACCGTGAGACTTACCATAATCCTTAATTGACATTTCAAACAGAATAAACGGAATGCTTCAACAGATTTCACCAGGAGAGATTGTGTGCATTCATAAGGTGATGCAGCCAAAGCAGAAAACTGTTACAATAGATAGAACAGAAAAATGGGTATCCTTTCACGAAATGAGGTAAGGAGGCCATCCCTGCAGAAACGGGAAGATTAGGAAGAAAAGCACGAAGAACAAACTTTGCTTCTTCATGTAAAGAGATTAAAGTTGAATCTAATTTTTCCTATAACAACCACGGATATTAACCTGTTGACTTTGTGGATACAAAATCTTTTTGTATCCACGACGTCAGTTATTAAGTCAGTTGTCATAGAAAATTGTTATACTTGTATTTCTTAATAGCTTC

mRNA

>Mapoly0072s0031.1
CGTTTTAATGCGCAACGGACTCGGACTGGTCTAAAGACAGGAAGGAAGGAAGCTCTTTGCATTAAATTACCTGTCGGCAGAATTTTGAGGTTAACGAGTTCATAGCTTATAGCTTACAGCTTACAGGGCTCATTCTAGAAGGATCGGAAGGATTCCAGCTAACAGGGATGAGACGGATATATTTACGATTTTCTTCGAGTAGAGTAAGATCCAGATTCCAGATTCCGGAGCCAAATGACTTGTACGACACAACTTCAATGGCATGACAACCTGTTGAGAAAATTCGTTAACCCAGTACCTGTCGGCTGTAATGCGAATTCGCTCGGCAATAAGAGAATTATTGGGACCGTTAGACCAAATACAGGGTCATACATGTGACCGAAGAGATATTCACGAATTTTACCGAGCTCTGCAGTCCAGCAATCTTGGGATTGGATAACCTCGGACTGAGCCATGCTGGGGGTAGGGATGGGTGTGTCCAATGAGACTGCAGCGAGTGGTCTTCGTCGGTATCGTCCGAGTCTTCGGATATCGTCCAGATTATTTTTGACAGGAGAGGAAGATGGGGAGTTTGGAAGAGAGGGAGACGACGATTAGTGTGGGCGAAGCGCTTGGAGGTCAGGGTGGCTTTAGAAGGAGTTTTTTACTTCTTCCATGTGAAACGATGTTCCTTGTCGGGACACAGGAAGGAGAAGGAACCGCAAGACACCGTAATCCATGTACATGTGGTCCCGAGGCCATCCGAAAGTTCATTAAGTTCCACTCTGAGCGACTCGGGCTTTAATGTAGGTGCTGGAGATGGGCGACGGTGTTGGAACGATGTTGTCTTCTGCTGTCATAGGGTGTTCCATTCAATAGGTAAAGCAGTTTCGACAGGCGGACATTTGCTATACTCCAGGACTGTCGAAATCAGACTCATTGCTTCAGCGAAAGGTCTGCTTGGTTTGGTACGCACAGCTATGATGGAGTGATCGGAGTGTGACATGAAGTGTATCGGGGAGCTTTGCCTAGTAGATGACATCGTTATTGTGCTGGGGACTGAAGAACGCGGTTATACGACTTTCGGTGTGAAGTGTGGGTGGTGAGAAGGGCGTGATGGTTGACGTTTAGAGCTGAGCTTTCTTACCTAAGGCTGCTTCTGATCAGACAGTGACTGGTCCAGAAGTTTGGATATAAGTTTTTTGATGGCTAAAGGCAGCTGCAGCCTTCTCCAGATTTAAAGCGTACGAGTCCAGTGCAGGGATTCTGTCGAGATATATGCTCCACCCATGTTCATTGGGTGAAAGGATGCACAAACTTGGGATGTGAACTTCTCGTCACGAGCAAGTCTTTTCTCGATAATAACGCTTATATCGAAGGGTCGATGCACTGTGAGTGCGTTTTCTAACCGAGAGGAATCTGACCACAACCACCTTTGGAACCAAAGTTGAGCTGAGAAGGATTTTAGAACATATCGATTACCGCTTATTCAACTTCTCTCCTTCTGCTATCATTTCAAAGAGCTCAAAATCTCCGCACTGTGGCAGCGCGCGTCAAAGTCGTGCCGGTTGAAACAGCTCCAAGACCTGGTGATAAAACCTATGAAAATCCCGAACACAAAGTGATTCGGGAGTCAGGACGACAGAAGGTCCCATAATTCAAAGCCTTCTCCAGAGTCTTCTGAAGTCGCTGCAAAATGGCGAATCGTGCTGCCGAAGCTAGCAGCTCATACAACTTCAAGGTTCGTGGATGCATAAAGTCCACCTCTGGTCCGTGGATAGTAAGGAGACCTCCCACCAAGAATTCCGGCCGAGGCGCGACTTCTGTACTTAGAATGCCTTCTCCTAGGGAACGGGAGAACAACAAAAAGAGAGAGAGGAGAAGGAGAGCAGTCGCAGCTCGCATTTTCGCTGGCCTGAGGCAGTATGGTAACTACAGGCTACCGAAACACGCAGACCACAATGAGGTTTTGAAGGCTTTGTGTGCAGAGGCTGGATGGATCGTGGAGGAAGACGGCACAATATACCGCCAGGGACACAAAACCCCTGAACTTAAAGCTGATCTCCAGGAGAGCGAGGTCATCAACGTAAACTGCACATGTGAAATACAAGAGGCGGCTCTTGATTCCGACGGACCCGAGTCGGCGCTAGATCGCTTCAAATATGAGACGAGCACTCCTTCTTCGTCATGCGGTCAGAGCGATGAGACAACATGCTCTATAAGATCCAGAAATAGTGGTAGAAACAACTGTGATCAACCGACTGTTGCAGGAATCTGTGATTACGACTTGAATCTTAGTGGGACAGAAGGCGATTATGAAGAGCTTGACCAAGTTGCTGTGGAGAACGAAGAGAGTACAGTCATGATGTCGGGTCTTCCAGAGCCAAAGAATTTAGAGACAAGTGCGGAAGATTGCGACACGAATATCGAGTTCTTCATAAATCCAGAATCGCGACCAATGAACCTTCCTAAATCAGAAAGGTCCACTGGAGAATGCAACGCTTCATATCATCAAGAATTTCAGTTTTTCGCTGGTCTTTTCCCTGGACCTAGTGACCTACTCACTGCAGCTCTCGCCGTTGCTGATGACACACCGAGCTGCTGTGTTCGTCCAACGAGAGATCTGAATTCACCGCCTATATTTGAGGGAAGCACGTCAACTGAGTTTCCGAATGCCGTTAATTGCAGTCTGCCTCCCGCGCCGTCGATGGATAATACCTTTATTAAAAAGGAGAGCTATAATGATCAGATCTATCTGAAGAATATGGGCAGACAGGACTCGACGTGGATTCCTGCATGTAACGACCACAATGGTCGGAGTGGAGATGCCGATTCATCCCCTTCATCATCAGATACGCCTGAGCTCGAGCTCTTATCCAGCGGTGATGTGATGATTGATTCGACGAGCCCATGCAGGATGGACGCGGGCCGCGTAAGCTGTTCTGATGCTAGCGACTGCCCTTGTGCTATTTCTGATGAGACCCCATTGCAAAGCTCAGTTTCCAATGGCTTACTTATAGCGAGAAACTATCGAGTTCCACCAGTCTCATACGCAGGTATCCACAGACATCTGACGCTCCAGCATTTGGGTCCAGATCAAGGGTATCTCCTCGATCGGAAGAATGGAAGTAGTTCAGCACTCAGCAATCAGCGATCTATGCAGTCCACCCGTGAATATAGCAATTGGAACGACCTCACCCACCGCGCTTCTGGCCGAGGTGGTCAAACGGCAGCAGCCACCAACATAGGCCACCATCAGTCAGTATCGATCACAACAGCTGCTTCCAAGCCCTTTGATAAGACTGCTTTGTATGAATTTTCTCCAGGTACGGATTTCCATGGTCAGAACAAACAGCAGTACCGCGGGCCCTTGATATTACCACCGAAGCAGCAGCAGCTGCAGTCAGCACCACCGGTGGATGCCCTGTCCCTCACCCTTTGCACATCTACAGGCTCTACCGGTCTTAGCTCAGAATATCCATTTTGCTTTATCAAACGTCATATTAAGCTTCCCATCCCCCAAACTTAATCGTGTACCCTCTTTCCTCAATATCATTATCTCCGACTGAATATTATAGTTTCGTGTTTCAAACGCCTCATCATTGATATAAAACTCGCCTTTTTGCATCGGCAAACCATGATAATTATGGGGTAATAACGAATGTGCGTTTAAATTGTAGATTCATTTCTACCAAGAAAGTTGATCAGAAATATATGTGAACGATTTTGTGAGCTGCTTTTGTCGACCTTAACATTTCAACTGTAAATTAGTTGCAACTCTTATGTCGAGTTTGTCAGCAGCGTGTTAGCAGCAAAGGGCAGTGGCGAATGCCATTCTCTGAGCATGGGCTGAGATGCTGTTTGCATACGCCCTATTTCGATCAGTTGATCAAATTGAACCAAATTTTCTAACCGCATCAAACCTGAAGAAGGTTCAGTTTTATGTTTCTTAACTTCAAGCTGATTTTGTAAAATTATGCTCTTGTGCAAGCAAAATAGGTGTGCTGTCTGCAGACTCCTTGGTTTTTATTTAGAAGTTTCGGCTTATGTTCGACCTATGCTTCGGCTTATGCTATGACTAGTGTTTCGACTTATGCCTTTCGACTGTCCCAAATCCACATGATTCAGAGCTCGTAAACTAATAAACGGAATGCTTCAACAGATTTCACCAGGAGAGATTGTGTGCATTCATAAGGTGATGCAGCCAAAGCAGAAAACTGTTACAATAGATAGAACAGAAAAATGGGTATCCTTTCACGAAATGAGGTAAGGAGGCCATCCCTGCAGAAACGGGAAGATTAGGAAGAAAAGCACGAAGAACAAACTTTGCTTCTTCATGTAAAGAGATTAAAGTTGAATCTAATTTTTCCTATAACAACCACGGATATTAACCTGTTGACTTTGTGGATACAAAATCTTTTTGTATCCACGACGTCAGTTATTAAGTCAGTTGTCATAGAAAATTGTTATACTTGTATTTCTTAATAGCTTC

CDS

>Mapoly0072s0031.1
ATGGCGAATCGTGCTGCCGAAGCTAGCAGCTCATACAACTTCAAGGTTCGTGGATGCATAAAGTCCACCTCTGGTCCGTGGATAGTAAGGAGACCTCCCACCAAGAATTCCGGCCGAGGCGCGACTTCTGTACTTAGAATGCCTTCTCCTAGGGAACGGGAGAACAACAAAAAGAGAGAGAGGAGAAGGAGAGCAGTCGCAGCTCGCATTTTCGCTGGCCTGAGGCAGTATGGTAACTACAGGCTACCGAAACACGCAGACCACAATGAGGTTTTGAAGGCTTTGTGTGCAGAGGCTGGATGGATCGTGGAGGAAGACGGCACAATATACCGCCAGGGACACAAAACCCCTGAACTTAAAGCTGATCTCCAGGAGAGCGAGGTCATCAACGTAAACTGCACATGTGAAATACAAGAGGCGGCTCTTGATTCCGACGGACCCGAGTCGGCGCTAGATCGCTTCAAATATGAGACGAGCACTCCTTCTTCGTCATGCGGTCAGAGCGATGAGACAACATGCTCTATAAGATCCAGAAATAGTGGTAGAAACAACTGTGATCAACCGACTGTTGCAGGAATCTGTGATTACGACTTGAATCTTAGTGGGACAGAAGGCGATTATGAAGAGCTTGACCAAGTTGCTGTGGAGAACGAAGAGAGTACAGTCATGATGTCGGGTCTTCCAGAGCCAAAGAATTTAGAGACAAGTGCGGAAGATTGCGACACGAATATCGAGTTCTTCATAAATCCAGAATCGCGACCAATGAACCTTCCTAAATCAGAAAGGTCCACTGGAGAATGCAACGCTTCATATCATCAAGAATTTCAGTTTTTCGCTGGTCTTTTCCCTGGACCTAGTGACCTACTCACTGCAGCTCTCGCCGTTGCTGATGACACACCGAGCTGCTGTGTTCGTCCAACGAGAGATCTGAATTCACCGCCTATATTTGAGGGAAGCACGTCAACTGAGTTTCCGAATGCCGTTAATTGCAGTCTGCCTCCCGCGCCGTCGATGGATAATACCTTTATTAAAAAGGAGAGCTATAATGATCAGATCTATCTGAAGAATATGGGCAGACAGGACTCGACGTGGATTCCTGCATGTAACGACCACAATGGTCGGAGTGGAGATGCCGATTCATCCCCTTCATCATCAGATACGCCTGAGCTCGAGCTCTTATCCAGCGGTGATGTGATGATTGATTCGACGAGCCCATGCAGGATGGACGCGGGCCGCGTAAGCTGTTCTGATGCTAGCGACTGCCCTTGTGCTATTTCTGATGAGACCCCATTGCAAAGCTCAGTTTCCAATGGCTTACTTATAGCGAGAAACTATCGAGTTCCACCAGTCTCATACGCAGGTATCCACAGACATCTGACGCTCCAGCATTTGGGTCCAGATCAAGGGTATCTCCTCGATCGGAAGAATGGAAGTAGTTCAGCACTCAGCAATCAGCGATCTATGCAGTCCACCCGTGAATATAGCAATTGGAACGACCTCACCCACCGCGCTTCTGGCCGAGGTGGTCAAACGGCAGCAGCCACCAACATAGGCCACCATCAGTCAGTATCGATCACAACAGCTGCTTCCAAGCCCTTTGATAAGACTGCTTTGTATGAATTTTCTCCAGGTACGGATTTCCATGGTCAGAACAAACAGCAGTACCGCGGGCCCTTGATATTACCACCGAAGCAGCAGCAGCTGCAGTCAGCACCACCGGTGGATGCCCTGTCCCTCACCCTTTGCACATCTACAGGCTCTACCGGTCTTAGCTCAGAATATCCATTTTGCTTTATCAAACGTCATATTAAGCTTCCCATCCCCCAAACTTAA

Protein

>Mapoly0072s0031.1
MANRAAEASSSYNFKVRGCIKSTSGPWIVRRPPTKNSGRGATSVLRMPSPRERENNKKRERRRRAVAARIFAGLRQYGNYRLPKHADHNEVLKALCAEAGWIVEEDGTIYRQGHKTPELKADLQESEVINVNCTCEIQEAALDSDGPESALDRFKYETSTPSSSCGQSDETTCSIRSRNSGRNNCDQPTVAGICDYDLNLSGTEGDYEELDQVAVENEESTVMMSGLPEPKNLETSAEDCDTNIEFFINPESRPMNLPKSERSTGECNASYHQEFQFFAGLFPGPSDLLTAALAVADDTPSCCVRPTRDLNSPPIFEGSTSTEFPNAVNCSLPPAPSMDNTFIKKESYNDQIYLKNMGRQDSTWIPACNDHNGRSGDADSSPSSSDTPELELLSSGDVMIDSTSPCRMDAGRVSCSDASDCPCAISDETPLQSSVSNGLLIARNYRVPPVSYAGIHRHLTLQHLGPDQGYLLDRKNGSSSALSNQRSMQSTREYSNWNDLTHRASGRGGQTAAATNIGHHQSVSITTAASKPFDKTALYEFSPGTDFHGQNKQQYRGPLILPPKQQQLQSAPPVDALSLTLCTSTGSTGLSSEYPFCFIKRHIKLPIPQT

Mapoly0072s0031.2  

Gene structure:

mRNA scaffold_72:282728..291421  ( - strand )
three_prime_UTR scaffold_72:282728..283079  ( - strand )
three_prime_UTR scaffold_72:283365..283975  ( - strand )
CDS scaffold_72:283976..284415  ( - strand )
CDS scaffold_72:284551..284631  ( - strand )
CDS scaffold_72:287184..287273  ( - strand )
CDS scaffold_72:287402..288254  ( - strand )
CDS scaffold_72:288881..289216  ( - strand )
five_prime_UTR scaffold_72:289217..289264  ( - strand )
five_prime_UTR scaffold_72:289795..291421  ( - strand )

Sequences:

Gene

>Mapoly0072s0031.2
CGTTTTAATGCGCAACGGACTCGGACTGGTCTAAAGACAGGAAGGAAGGAAGCTCTTTGCATTAAATTACCTGTCGGCAGAATTTTGAGGTTAACGAGTTCATAGCTTATAGCTTACAGCTTACAGGGCTCATTCTAGAAGGATCGGAAGGATTCCAGCTAACAGGGATGAGACGGATATATTTACGATTTTCTTCGAGTAGAGTAAGATCCAGATTCCAGATTCCGGAGCCAAATGACTTGTACGACACAACTTCAATGGCATGACAACCTGTTGAGAAAATTCGTTAACCCAGTACCTGTCGGCTGTAATGCGAATTCGCTCGGCAATAAGAGAATTATTGGGACCGTTAGACCAAATACAGGGTCATACATGTGACCGAAGAGATATTCACGAATTTTACCGAGCTCTGCAGTCCAGCAATCTTGGGATTGGATAACCTCGGACTGAGCCATGCTGGGGGTAGGGATGGGTGTGTCCAATGAGACTGCAGCGAGTGGTCTTCGTCGGTATCGTCCGAGTCTTCGGATATCGTCCAGATTATTTTTGACAGGAGAGGAAGATGGGGAGTTTGGAAGAGAGGGAGACGACGATTAGTGTGGGCGAAGCGCTTGGAGGTCAGGGTGGCTTTAGAAGGAGTTTTTTACTTCTTCCATGTGAAACGATGTTCCTTGTCGGGACACAGGAAGGAGAAGGAACCGCAAGACACCGTAATCCATGTACATGTGGTCCCGAGGCCATCCGAAAGTTCATTAAGTTCCACTCTGAGCGACTCGGGCTTTAATGTAGGTGCTGGAGATGGGCGACGGTGTTGGAACGATGTTGTCTTCTGCTGTCATAGGGTGTTCCATTCAATAGGTAAAGCAGTTTCGACAGGCGGACATTTGCTATACTCCAGGACTGTCGAAATCAGACTCATTGCTTCAGCGAAAGGTCTGCTTGGTTTGGTACGCACAGCTATGATGGAGTGATCGGAGTGTGACATGAAGTGTATCGGGGAGCTTTGCCTAGTAGATGACATCGTTATTGTGCTGGGGACTGAAGAACGCGGTTATACGACTTTCGGTGTGAAGTGTGGGTGGTGAGAAGGGCGTGATGGTTGACGTTTAGAGCTGAGCTTTCTTACCTAAGGCTGCTTCTGATCAGACAGTGACTGGTCCAGAAGTTTGGATATAAGTTTTTTGATGGCTAAAGGCAGCTGCAGCCTTCTCCAGATTTAAAGCGTACGAGTCCAGTGCAGGGATTCTGTCGAGATATATGCTCCACCCATGTTCATTGGGTGAAAGGATGCACAAACTTGGGATGTGAACTTCTCGTCACGAGCAAGTCTTTTCTCGATAATAACGCTTATATCGAAGGGTCGATGCACTGTGAGTGCGTTTTCTAACCGAGAGGAATCTGACCACAACCACCTTTGGAACCAAAGTTGAGCTGAGAAGGATTTTAGAACATATCGATTACCGCTTATTCAACTTCTCTCCTTCTGCTATCATTTCAAAGAGCTCAAAATCTCCGCACTGTGGCAGCGCGCGTCAAAGTCGTGCCGGTTGAAACAGCTCCAAGACCTGGTGATAAAACCTATGAAAATCCCGAACACAAAGTGATTCGGGAGTCAGGACGACAGAAGGTAAACTTTCAATGGGCTGCGTGATCATCATCTCAGGTCTGGTTCAAAAGGGTCTTTTTGATAGACATATAGAACTTCTGTTGGAATAGCACTCGGGAGAGGTTACAAGAACTTTTTAAGTTCCCATAGTGGAGTCTGATACCTTTTTTGCTTGTGTTTTGCCTGAGCACTGAAGGTGAGCTCTGAGCTCCTTTCATGTAGAGTCCCTACTATTCTCAAAGGCTAGAAATTCAATTTCTCTTGATGACCATTATTTGTGTTCTGTCCACTTCACGGCTTTGAACCAACTCGACTGCACCCTGGGACAATTAGTGGGTGATCAGGTCATTCTTTTCTTGCATGTCTGATCTCTGCGCATGCTTCACAGACAGATCGTACACGCTCGTGACAAGTCTAGACCACATAGACCCAACCTTGGATTGTTCCTTGTGTGAAAGAAGTAAAAGCCTCTTACTTCTTCTCCTCTTCGGGGTCCGTGTCATGTTTATACAGGCCTTCTGAAAGTGGTATGGTCTGTCTATCGTGTTAAGGTCCCATAATTCAAAGCCTTCTCCAGAGTCTTCTGAAGTCGCTGCAAAATGGCGAATCGTGCTGCCGAAGCTAGCAGCTCATACAACTTCAAGGTTCGTGGATGCATAAAGTCCACCTCTGGTCCGTGGATAGTAAGGAGACCTCCCACCAAGAATTCCGGCCGAGGCGCGACTTCTGTACTTAGAATGCCTTCTCCTAGGGAACGGGAGAACAACAAAAAGAGAGAGAGGAGAAGGAGAGCAGTCGCAGCTCGCATTTTCGCTGGCCTGAGGCAGTATGGTAACTACAGGCTACCGAAACACGCAGACCACAATGAGGTTTTGAAGGCTTTGTGTGCAGAGGCTGGATGGATCGTGGAGGAAGACGGCACAATATACCGCCAGGTTTGTGGACAGTCGTTCAAATGCTATGATTCACATTCAAGGGACACACGAGATTTTGAAACCTAGATGAAGTTCGTTGTAGTATATTCTTAAGAGGTGCGATGAAGATCATGAATTTTGGAGACGTTATAGTATCTTCATAGACAAAAGGTGGAAATGGTGATGGTTTTTATTTTGGTTTCACATCGAAAACTTTTCGAGTACTCTCTTTGCTACCCGGACCCTAGCGTGGAATATTGAGTAACTAGTTTCAAACTGCTGAATATGTGAACCGGAGCTAAGCACTCCGATTTACAAGATTCAAGACGAAAGTCGATGAGGTCTCTAAACTTCATTTTTCTTTAAGTTATATCAAGACGTCTAGTCACCTAAACCAGCCAGTAAACATTCAGAGCAGTCTCTGATATCTTTGGTGATGGTGTGTTATCGGAGTAGTTGAAATCAAGCCAATTATGTGCAGGTCAAGGATTTTGATCTGGAAAATTGTAATTCCTTCCATATTCCAGTACTATATTTCCCACATTTGGCAGTCGAGGTGGCCTTTCACAATGACAGGATTATAGCACTAATCGTTGTATTTTGGCAGTGGACTAATATCAGTGACAACTGTTGCACGCACTTTGCAGGGACACAAAACCCCTGAACTTAAAGCTGATCTCCAGGAGAGCGAGGTCATCAACGTAAACTGCACATGTGAAATACAAGAGGCGGCTCTTGATTCCGACGGACCCGAGTCGGCGCTAGATCGCTTCAAATATGAGACGAGCACTCCTTCTTCGTCATGCGGTCAGAGCGATGAGACAACATGCTCTATAAGATCCAGAAATAGTGGTAGAAACAACTGTGATCAACCGACTGTTGCAGGAATCTGTGATTACGACTTGAATCTTAGTGGGACAGAAGGCGATTATGAAGAGCTTGACCAAGTTGCTGTGGAGAACGAAGAGAGTACAGTCATGATGTCGGGTCTTCCAGAGCCAAAGAATTTAGAGACAAGTGCGGAAGATTGCGACACGAATATCGAGTTCTTCATAAATCCAGAATCGCGACCAATGAACCTTCCTAAATCAGAAAGGTCCACTGGAGAATGCAACGCTTCATATCATCAAGAATTTCAGTTTTTCGCTGGTCTTTTCCCTGGACCTAGTGACCTACTCACTGCAGCTCTCGCCGTTGCTGATGACACACCGAGCTGCTGTGTTCGTCCAACGAGAGATCTGAATTCACCGCCTATATTTGAGGGAAGCACGTCAACTGAGTTTCCGAATGCCGTTAATTGCAGTCTGCCTCCCGCGCCGTCGATGGATAATACCTTTATTAAAAAGGAGAGCTATAATGATCAGATCTATCTGAAGAATATGGGCAGACAGGACTCGACGTGGATTCCTGCATGTAACGACCACAATGGTCGGAGTGGAGATGCCGATTCATCCCCTTCATCATCAGATACGCCTGAGCTCGAGCTCTTATCCAGCGGTGGTAGGTCTCAACTTCGATGTACAGAGCAGTTACATACGTACATTACACAACGTAGCTTAACTATTTCTTAAGAGAGCCTGCGATTTTTGTTTGTTCATCGATTTCTGTACGTTTTGTGAGTCTTGCAGATGTGATGATTGATTCGACGAGCCCATGCAGGATGGACGCGGGCCGCGTAAGCTGTTCTGATGCTAGCGACTGCCCTTGTGCTATTTCTGGTATGTATATATTTATCAACTTTTCTCCCACTACTCGGAGGACTCGCATTTATTTGCCATTTCTTCAAAGAACTTCCAATTGATTATTAGTGCACCTCCATGTCTGCTCGAATTATCTTTTCTAGTCCACGTTCGCGCATCCAATTGTCTCAAAGCCCATCACATCTCCACATATAAACGTTCGGAAGTTCCGTGCGGGGCAGGTAGGGAAGCTGTCGAGGACAGCTTAGGTCTTTTCCATTCAGTAGGGTCTAGAGCGGATCACACTGACGATATAAATAGTAAATGACCGATATCATATAATCCTGAAAGATGGATTTGACGCCTCTGAGTTGCAGTTCAAAGCTTTTTATTTTCGTCAGTTCATAGCTCGACTTAACATGGATGCAGATCAGATAGTTGACAGCTCCAATGCTATTTGCAGGACTGGTTATTATAACTGGAATTTTTAATTATATTTTCGTATGAGGAAATTTATATAAAAATTTTAGAGAAAAATTGCCCTCTCAACTCCAAAATTTTATTTTGGAAATGATATATTTAATTGCATTGTGTTAATTATGTAGTTGCAACTGATTGACATAAAATATATTCGTGTCGAAAATGCAGCAGACTCCTTTGATTTCCCTTTTTCGGGATGTATAATATAGTTTTTATAGTATAACTAGTTTAATGTACATAAGAAAACAAGATCGGTTCTCACAAGTAATTAGGTGTTTGATGCTTTGTACTTAACGATCCAGTTACTCGGTCTCTTCTATCTAGCATCCCAAGGCGGATCTTCGCAGTCCGATGGTGGATTTAACTTGCCCGATTTAAATTCAGAAGGTTTCGAACCTTGAGTCTCCAGTCCGAACCATTGTTCGAAAGCTCATCCTCTACGCTTTGACAATTCTTCCAACAAGATGATTGAGACTGAATTAAGAAACAGTCTCAATGATTTAGTACCAACAGAGGTAATATACCATCACTGTCGCTACTGGTATGTCAAAATCCACCATGATATTCCTAGACCTGTTATTCCTTCTTTTCAGTGGGCTCTTCCAAGTAGGAAGTAACATAAACCATTTTGGGTTGATACAAGCAAACATTTGATATACGGGCTGCAAAATTTCGTAGTGCTAATATATTTTATTAGTTGCTGCTCAGCCAGCTTCTTCTTTGTATTTCTTTTGTCACTTGTTTCTGTCTACATGAACCACAAGCTTCTGGAATATTCCTTTTCAATTAGTTTTGCGTTGAATTTCTGTAAGCCTTGTAGCTGTGTAGTCAACGCTGCTTTGGTAGATGTGATCTTCTGATCTAAGATGCACAACAATACTACGAATTTCTGTAGGGGTCACAACTGTCTCATCGGTATTTCATTCAAGCATATCTCTTATAAATACCAAAAACGAAGAATATCTAGGCCTAGACTGCATTCGAAGTATTTAGATAAGAATATTATATATCCAGAGGTGTGAAAATATAAGTTTATTTATGTATTCATTTATTCATACTTGTAGAAAATTATTCTTGAGTGCAGCATGTTCTTAGTATTATTCATGAGATGAAGTCTGAATGCAATGTGGGGTTGTATGCAAGGGACTCTTGTAATATGTATCGTATGGGGAGGAGAAACTTATTTCCGTTGTCCCAAAAATGACATGCAACGAAACTTCTTTGCTTATCTTCGGTTTCCCATTGTTCTTGTCAGGGTGTGCTGCTATTTTTATTATTTTTTTAACCCTGTGAGCCCGTCCTAGTTTCCGGTCCTCGCCTATTATCAATATTATTGTTAGTGTGCATTGTGGATTGATGAACACTTTGTGGTAGGGTTTTTAATTCATTTTCTGGTATTATTGCAGCCGTATCTTGTATTCTGCTTTTGCTGTTAAATTTCTCCATCCACGGTGTGGTTCTCTTCAGGTTGTACATGTGCAAAGTTCTGCTTCTTGTCATATCTAAAGTACATAACAGTTAAGTCATGTATATCTTCATTTGAATTCAAGCTATAGCTTGCATTTTAAAGTACCTTAACGCCGGATTTGCTTCGTAAGGCTATCACCTTATATTTTCCAAAACACTAGCCGATCACAATACCTTGTCCGAGCGTAGTGTATATATGTTTCATGATGCAAAAGATGGCTATGAAATTATAAGAGCGTATGAAACTTGTAATCAAGATTAGAAGCAAGATATGCTATTTAGCGGAAATACTGCTACCTTTCAGTACCTATAAATTACAGATTTTATGACTGATCCAAAAATGCTTCCTATTCACATTTAGTTCATAACACTACTTTGTTCTTTCTTTCATCTAAGACAAAGATTGGAAGAAACTCTACAGGCAGTGAGCAGTCTAAATCAGGAGTAATGTATAACCGTTGGATGAGCTGGTCCAACAATGTGCTACATAAATGGTCAAATGAAAATTCTTCATATTGTTAAGGGCAGGAGGTGGAAGGCTGATAAACGTAAATTCACAAACTTTGAAACTTCATTTGATTTTTTTCGTGATTTAATCTTTTGAGACGTCCATAAGTTGTCTCACTCCAGCTCTCTATGTGCAGATGAGACCCCATTGCAAAGCTCAGTTTCCAATGGCTTACTTATAGCGAGAAACTATCGAGTTCCACCAGTCTCATACGCAGGTATCCACAGACATCTGACGCTCCAGCATTTGGGTATGTCAAAACACAGCTGCAGTATTCATTTTCCATCAGTTTGCAGGGGAAGCTCAAGGGCTAAATATGATAACTTTGCCACAACTGGTGTTTCTTCTGCAGGTCCAGATCAAGGGTATCTCCTCGATCGGAAGAATGGAAGTAGTTCAGCACTCAGCAATCAGCGATCTATGCAGTCCACCCGTGAATATAGCAATTGGAACGACCTCACCCACCGCGCTTCTGGCCGAGGTGGTCAAACGGCAGCAGCCACCAACATAGGCCACCATCAGTCAGTATCGATCACAACAGCTGCTTCCAAGCCCTTTGATAAGACTGCTTTGTATGAATTTTCTCCAGGTACGGATTTCCATGGTCAGAACAAACAGCAGTACCGCGGGCCCTTGATATTACCACCGAAGCAGCAGCAGCTGCAGTCAGCACCACCGGTGGATGCCCTGTCCCTCACCCTTTGCACATCTACAGGCTCTACCGGTCTTAGCTCAGAATATCCATTTTGCTTTATCAAACGTCATATTAAGCTTCCCATCCCCCAAACTTAATCGTGTACCCTCTTTCCTCAATATCATTATCTCCGACTGAATATTATAGTTTCGTGTTTCAAACGCCTCATCATTGATATAAAACTCGCCTTTTTGCATCGGCAAACCATGATAATTATGGGGTAATAACGAATGTGCGTTTAAATTGTAGATTCATTTCTACCAAGAAAGTTGATCAGAAATATATGTGAACGATTTTGTGAGCTGCTTTTGTCGACCTTAACATTTCAACTGTAAATTAGTTGCAACTCTTATGTCGAGTTTGTCAGCAGCGTGTTAGCAGCAAAGGGCAGTGGCGAATGCCATTCTCTGAGCATGGGCTGAGATGCTGTTTGCATACGCCCTATTTCGATCAGTTGATCAAATTGAACCAAATTTTCTAACCGCATCAAACCTGAAGAAGGTTCAGTTTTATGTTTCTTAACTTCAAGCTGATTTTGTAAAATTATGCTCTTGTGCAAGCAAAATAGGTGTGCTGTCTGCAGACTCCTTGGTTTTTATTTAGAAGTTTCGGCTTATGTTCGACCTATGCTTCGGCTTATGCTATGACTAGTGTTTCGACTTATGCCTTTCGACTGTCCCAAATCCACATGATTCAGAGCTCGTAAACTGTAAGTATGATATTGACTGAATAGATGAGGTTTTATTTCATTTCTTTACTGTTGAGTTGCTCCATGATGGCGATTTATACAACCTCAAATCACTCTAGTTATCTGATCGTTGTCATACTTTGAAGAACCGATTGACCGATTTATCTTCGATTAAGCTCGAGAACCGTCGCAGCGAAGGGTTAAGAGAATTTTTACTTAGAATATCCTTGTCAATATTTTCCATAAAATTACAGTTGATCTCTTACCGTGAGACTTACCATAATCCTTAATTGACATTTCAAACAGAATAAACGGAATGCTTCAACAGATTTCACCAGGAGAGATTGTGTGCATTCATAAGGTGATGCAGCCAAAGCAGAAAACTGTTACAATAGATAGAACAGAAAAATGGGTATCCTTTCACGAAATGAGGTAAGGAGGCCATCCCTGCAGAAACGGGAAGATTAGGAAGAAAAGCACGAAGAACAAACTTTGCTTCTTCATGTAAAGAGATTAAAGTTGAATCTAATTTTTCCTATAACAACCACGGATATTAACCTGTTGACTTTGTGGATACAAAATCTTTTTGTATCCACGACGTCAGTTATTAAGTCAGTTGTCATAGAAAATTGTTATACTTGTATTTCTTAATAGCTTC

mRNA

>Mapoly0072s0031.2
CGTTTTAATGCGCAACGGACTCGGACTGGTCTAAAGACAGGAAGGAAGGAAGCTCTTTGCATTAAATTACCTGTCGGCAGAATTTTGAGGTTAACGAGTTCATAGCTTATAGCTTACAGCTTACAGGGCTCATTCTAGAAGGATCGGAAGGATTCCAGCTAACAGGGATGAGACGGATATATTTACGATTTTCTTCGAGTAGAGTAAGATCCAGATTCCAGATTCCGGAGCCAAATGACTTGTACGACACAACTTCAATGGCATGACAACCTGTTGAGAAAATTCGTTAACCCAGTACCTGTCGGCTGTAATGCGAATTCGCTCGGCAATAAGAGAATTATTGGGACCGTTAGACCAAATACAGGGTCATACATGTGACCGAAGAGATATTCACGAATTTTACCGAGCTCTGCAGTCCAGCAATCTTGGGATTGGATAACCTCGGACTGAGCCATGCTGGGGGTAGGGATGGGTGTGTCCAATGAGACTGCAGCGAGTGGTCTTCGTCGGTATCGTCCGAGTCTTCGGATATCGTCCAGATTATTTTTGACAGGAGAGGAAGATGGGGAGTTTGGAAGAGAGGGAGACGACGATTAGTGTGGGCGAAGCGCTTGGAGGTCAGGGTGGCTTTAGAAGGAGTTTTTTACTTCTTCCATGTGAAACGATGTTCCTTGTCGGGACACAGGAAGGAGAAGGAACCGCAAGACACCGTAATCCATGTACATGTGGTCCCGAGGCCATCCGAAAGTTCATTAAGTTCCACTCTGAGCGACTCGGGCTTTAATGTAGGTGCTGGAGATGGGCGACGGTGTTGGAACGATGTTGTCTTCTGCTGTCATAGGGTGTTCCATTCAATAGGTAAAGCAGTTTCGACAGGCGGACATTTGCTATACTCCAGGACTGTCGAAATCAGACTCATTGCTTCAGCGAAAGGTCTGCTTGGTTTGGTACGCACAGCTATGATGGAGTGATCGGAGTGTGACATGAAGTGTATCGGGGAGCTTTGCCTAGTAGATGACATCGTTATTGTGCTGGGGACTGAAGAACGCGGTTATACGACTTTCGGTGTGAAGTGTGGGTGGTGAGAAGGGCGTGATGGTTGACGTTTAGAGCTGAGCTTTCTTACCTAAGGCTGCTTCTGATCAGACAGTGACTGGTCCAGAAGTTTGGATATAAGTTTTTTGATGGCTAAAGGCAGCTGCAGCCTTCTCCAGATTTAAAGCGTACGAGTCCAGTGCAGGGATTCTGTCGAGATATATGCTCCACCCATGTTCATTGGGTGAAAGGATGCACAAACTTGGGATGTGAACTTCTCGTCACGAGCAAGTCTTTTCTCGATAATAACGCTTATATCGAAGGGTCGATGCACTGTGAGTGCGTTTTCTAACCGAGAGGAATCTGACCACAACCACCTTTGGAACCAAAGTTGAGCTGAGAAGGATTTTAGAACATATCGATTACCGCTTATTCAACTTCTCTCCTTCTGCTATCATTTCAAAGAGCTCAAAATCTCCGCACTGTGGCAGCGCGCGTCAAAGTCGTGCCGGTTGAAACAGCTCCAAGACCTGGTGATAAAACCTATGAAAATCCCGAACACAAAGTGATTCGGGAGTCAGGACGACAGAAGGTCCCATAATTCAAAGCCTTCTCCAGAGTCTTCTGAAGTCGCTGCAAAATGGCGAATCGTGCTGCCGAAGCTAGCAGCTCATACAACTTCAAGGTTCGTGGATGCATAAAGTCCACCTCTGGTCCGTGGATAGTAAGGAGACCTCCCACCAAGAATTCCGGCCGAGGCGCGACTTCTGTACTTAGAATGCCTTCTCCTAGGGAACGGGAGAACAACAAAAAGAGAGAGAGGAGAAGGAGAGCAGTCGCAGCTCGCATTTTCGCTGGCCTGAGGCAGTATGGTAACTACAGGCTACCGAAACACGCAGACCACAATGAGGTTTTGAAGGCTTTGTGTGCAGAGGCTGGATGGATCGTGGAGGAAGACGGCACAATATACCGCCAGGGACACAAAACCCCTGAACTTAAAGCTGATCTCCAGGAGAGCGAGGTCATCAACGTAAACTGCACATGTGAAATACAAGAGGCGGCTCTTGATTCCGACGGACCCGAGTCGGCGCTAGATCGCTTCAAATATGAGACGAGCACTCCTTCTTCGTCATGCGGTCAGAGCGATGAGACAACATGCTCTATAAGATCCAGAAATAGTGGTAGAAACAACTGTGATCAACCGACTGTTGCAGGAATCTGTGATTACGACTTGAATCTTAGTGGGACAGAAGGCGATTATGAAGAGCTTGACCAAGTTGCTGTGGAGAACGAAGAGAGTACAGTCATGATGTCGGGTCTTCCAGAGCCAAAGAATTTAGAGACAAGTGCGGAAGATTGCGACACGAATATCGAGTTCTTCATAAATCCAGAATCGCGACCAATGAACCTTCCTAAATCAGAAAGGTCCACTGGAGAATGCAACGCTTCATATCATCAAGAATTTCAGTTTTTCGCTGGTCTTTTCCCTGGACCTAGTGACCTACTCACTGCAGCTCTCGCCGTTGCTGATGACACACCGAGCTGCTGTGTTCGTCCAACGAGAGATCTGAATTCACCGCCTATATTTGAGGGAAGCACGTCAACTGAGTTTCCGAATGCCGTTAATTGCAGTCTGCCTCCCGCGCCGTCGATGGATAATACCTTTATTAAAAAGGAGAGCTATAATGATCAGATCTATCTGAAGAATATGGGCAGACAGGACTCGACGTGGATTCCTGCATGTAACGACCACAATGGTCGGAGTGGAGATGCCGATTCATCCCCTTCATCATCAGATACGCCTGAGCTCGAGCTCTTATCCAGCGGTGATGTGATGATTGATTCGACGAGCCCATGCAGGATGGACGCGGGCCGCGTAAGCTGTTCTGATGCTAGCGACTGCCCTTGTGCTATTTCTGATGAGACCCCATTGCAAAGCTCAGTTTCCAATGGCTTACTTATAGCGAGAAACTATCGAGTTCCACCAGTCTCATACGCAGGTCCAGATCAAGGGTATCTCCTCGATCGGAAGAATGGAAGTAGTTCAGCACTCAGCAATCAGCGATCTATGCAGTCCACCCGTGAATATAGCAATTGGAACGACCTCACCCACCGCGCTTCTGGCCGAGGTGGTCAAACGGCAGCAGCCACCAACATAGGCCACCATCAGTCAGTATCGATCACAACAGCTGCTTCCAAGCCCTTTGATAAGACTGCTTTGTATGAATTTTCTCCAGGTACGGATTTCCATGGTCAGAACAAACAGCAGTACCGCGGGCCCTTGATATTACCACCGAAGCAGCAGCAGCTGCAGTCAGCACCACCGGTGGATGCCCTGTCCCTCACCCTTTGCACATCTACAGGCTCTACCGGTCTTAGCTCAGAATATCCATTTTGCTTTATCAAACGTCATATTAAGCTTCCCATCCCCCAAACTTAATCGTGTACCCTCTTTCCTCAATATCATTATCTCCGACTGAATATTATAGTTTCGTGTTTCAAACGCCTCATCATTGATATAAAACTCGCCTTTTTGCATCGGCAAACCATGATAATTATGGGGTAATAACGAATGTGCGTTTAAATTGTAGATTCATTTCTACCAAGAAAGTTGATCAGAAATATATGTGAACGATTTTGTGAGCTGCTTTTGTCGACCTTAACATTTCAACTGTAAATTAGTTGCAACTCTTATGTCGAGTTTGTCAGCAGCGTGTTAGCAGCAAAGGGCAGTGGCGAATGCCATTCTCTGAGCATGGGCTGAGATGCTGTTTGCATACGCCCTATTTCGATCAGTTGATCAAATTGAACCAAATTTTCTAACCGCATCAAACCTGAAGAAGGTTCAGTTTTATGTTTCTTAACTTCAAGCTGATTTTGTAAAATTATGCTCTTGTGCAAGCAAAATAGGTGTGCTGTCTGCAGACTCCTTGGTTTTTATTTAGAAGTTTCGGCTTATGTTCGACCTATGCTTCGGCTTATGCTATGACTAGTGTTTCGACTTATGCCTTTCGACTGTCCCAAATCCACATGATTCAGAGCTCGTAAACTAATAAACGGAATGCTTCAACAGATTTCACCAGGAGAGATTGTGTGCATTCATAAGGTGATGCAGCCAAAGCAGAAAACTGTTACAATAGATAGAACAGAAAAATGGGTATCCTTTCACGAAATGAGGTAAGGAGGCCATCCCTGCAGAAACGGGAAGATTAGGAAGAAAAGCACGAAGAACAAACTTTGCTTCTTCATGTAAAGAGATTAAAGTTGAATCTAATTTTTCCTATAACAACCACGGATATTAACCTGTTGACTTTGTGGATACAAAATCTTTTTGTATCCACGACGTCAGTTATTAAGTCAGTTGTCATAGAAAATTGTTATACTTGTATTTCTTAATAGCTTC

CDS

>Mapoly0072s0031.2
ATGGCGAATCGTGCTGCCGAAGCTAGCAGCTCATACAACTTCAAGGTTCGTGGATGCATAAAGTCCACCTCTGGTCCGTGGATAGTAAGGAGACCTCCCACCAAGAATTCCGGCCGAGGCGCGACTTCTGTACTTAGAATGCCTTCTCCTAGGGAACGGGAGAACAACAAAAAGAGAGAGAGGAGAAGGAGAGCAGTCGCAGCTCGCATTTTCGCTGGCCTGAGGCAGTATGGTAACTACAGGCTACCGAAACACGCAGACCACAATGAGGTTTTGAAGGCTTTGTGTGCAGAGGCTGGATGGATCGTGGAGGAAGACGGCACAATATACCGCCAGGGACACAAAACCCCTGAACTTAAAGCTGATCTCCAGGAGAGCGAGGTCATCAACGTAAACTGCACATGTGAAATACAAGAGGCGGCTCTTGATTCCGACGGACCCGAGTCGGCGCTAGATCGCTTCAAATATGAGACGAGCACTCCTTCTTCGTCATGCGGTCAGAGCGATGAGACAACATGCTCTATAAGATCCAGAAATAGTGGTAGAAACAACTGTGATCAACCGACTGTTGCAGGAATCTGTGATTACGACTTGAATCTTAGTGGGACAGAAGGCGATTATGAAGAGCTTGACCAAGTTGCTGTGGAGAACGAAGAGAGTACAGTCATGATGTCGGGTCTTCCAGAGCCAAAGAATTTAGAGACAAGTGCGGAAGATTGCGACACGAATATCGAGTTCTTCATAAATCCAGAATCGCGACCAATGAACCTTCCTAAATCAGAAAGGTCCACTGGAGAATGCAACGCTTCATATCATCAAGAATTTCAGTTTTTCGCTGGTCTTTTCCCTGGACCTAGTGACCTACTCACTGCAGCTCTCGCCGTTGCTGATGACACACCGAGCTGCTGTGTTCGTCCAACGAGAGATCTGAATTCACCGCCTATATTTGAGGGAAGCACGTCAACTGAGTTTCCGAATGCCGTTAATTGCAGTCTGCCTCCCGCGCCGTCGATGGATAATACCTTTATTAAAAAGGAGAGCTATAATGATCAGATCTATCTGAAGAATATGGGCAGACAGGACTCGACGTGGATTCCTGCATGTAACGACCACAATGGTCGGAGTGGAGATGCCGATTCATCCCCTTCATCATCAGATACGCCTGAGCTCGAGCTCTTATCCAGCGGTGATGTGATGATTGATTCGACGAGCCCATGCAGGATGGACGCGGGCCGCGTAAGCTGTTCTGATGCTAGCGACTGCCCTTGTGCTATTTCTGATGAGACCCCATTGCAAAGCTCAGTTTCCAATGGCTTACTTATAGCGAGAAACTATCGAGTTCCACCAGTCTCATACGCAGGTCCAGATCAAGGGTATCTCCTCGATCGGAAGAATGGAAGTAGTTCAGCACTCAGCAATCAGCGATCTATGCAGTCCACCCGTGAATATAGCAATTGGAACGACCTCACCCACCGCGCTTCTGGCCGAGGTGGTCAAACGGCAGCAGCCACCAACATAGGCCACCATCAGTCAGTATCGATCACAACAGCTGCTTCCAAGCCCTTTGATAAGACTGCTTTGTATGAATTTTCTCCAGGTACGGATTTCCATGGTCAGAACAAACAGCAGTACCGCGGGCCCTTGATATTACCACCGAAGCAGCAGCAGCTGCAGTCAGCACCACCGGTGGATGCCCTGTCCCTCACCCTTTGCACATCTACAGGCTCTACCGGTCTTAGCTCAGAATATCCATTTTGCTTTATCAAACGTCATATTAAGCTTCCCATCCCCCAAACTTAA

Protein

>Mapoly0072s0031.2
MANRAAEASSSYNFKVRGCIKSTSGPWIVRRPPTKNSGRGATSVLRMPSPRERENNKKRERRRRAVAARIFAGLRQYGNYRLPKHADHNEVLKALCAEAGWIVEEDGTIYRQGHKTPELKADLQESEVINVNCTCEIQEAALDSDGPESALDRFKYETSTPSSSCGQSDETTCSIRSRNSGRNNCDQPTVAGICDYDLNLSGTEGDYEELDQVAVENEESTVMMSGLPEPKNLETSAEDCDTNIEFFINPESRPMNLPKSERSTGECNASYHQEFQFFAGLFPGPSDLLTAALAVADDTPSCCVRPTRDLNSPPIFEGSTSTEFPNAVNCSLPPAPSMDNTFIKKESYNDQIYLKNMGRQDSTWIPACNDHNGRSGDADSSPSSSDTPELELLSSGDVMIDSTSPCRMDAGRVSCSDASDCPCAISDETPLQSSVSNGLLIARNYRVPPVSYAGPDQGYLLDRKNGSSSALSNQRSMQSTREYSNWNDLTHRASGRGGQTAAATNIGHHQSVSITTAASKPFDKTALYEFSPGTDFHGQNKQQYRGPLILPPKQQQLQSAPPVDALSLTLCTSTGSTGLSSEYPFCFIKRHIKLPIPQT

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>