Mapoly0072s0050



Description

ABA responsive element binding factor

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
KEGGORTH K14432 ABA responsive element binding factor
KOG KOG4196 BZIP transcription factor MafK
OrthoMCL OG5_144915
PFAM PF00170 BZIP transcription factor
PANTHER PTHR22952 CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED
PANTHER PTHR22952:SF103

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpABI5B bZIP transcription factor Mapoly0072s0050.1 Public
MpBZIP12 transcription factor, bZIP Mapoly0072s0050.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0072s0050.1 scaffold_72:470865..473435  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0072s0050.2 scaffold_72:470865..473435  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0072s0050.1  

Gene structure:

mRNA scaffold_72:470865..473435  ( - strand )
three_prime_UTR scaffold_72:470865..471001  ( - strand )
CDS scaffold_72:471002..471112  ( - strand )
CDS scaffold_72:471236..471331  ( - strand )
CDS scaffold_72:471467..472726  ( - strand )
five_prime_UTR scaffold_72:472727..473435  ( - strand )

Sequences:

Gene

>Mapoly0072s0050.1
TCGTTCCACGGACTTCCGCCTCTCCTCCCCTTCCTCCCCTCCGCTTCTCAAGCTCTCTGTCTCTCTCCCTCTCTCTCCCGCCGGGGGGAACGTAGGCGCGGCTCAGTCGGCTCGGCTTGGCGGGCGCGCGGGCGAGCGGGCAGGCAGGCAAGCAGGAGGGCGTGATCGAGGTCAGGGGGCCGAAGGGGCCGAAAGGGCCGAGACGGGTGAGAAGAGTCGGAGGGCCCCCGGGAAAGGCTAAACTAAACTATGGGCTCGACAATTGCGTCCCGAGCGATGCAGAAGCTGCTGCTGGCAAGCCCTAAGTATAAGAGCGCGCACGCTGCTGCCAGCGGACGTTGTGCCCGGTGTCAAAGCGGCGTCGCATCTGCTGCGCAGGTGCAGTTTTAGTCGTCGAGCGCTCGCTCGAGAGAGCCCTGTCGTCGTCGTCGTCGTCGTCGTCGCATCCATCCCACCTCAAGCCTTTTTCACGACTCGACCGGAGGTTTCGTCAGCTCTTGCGCTGGCAGGGTTCGACGCCCGGAAGCGGGCACGCGATCGTGCAGCCAGGAAGGCGCAGGCTCTGCAGGCTCAACCTGCTTCGTCCGGGTTCCAGGACCTCGATCCGACAAGAGCCTACCCTTTCCAGCAGCAGCAGCAGCAGCAGCAGCATCATCATCAACAACATCATCATATTCAGCAGCAGCAGCAGCGCGACGAGGGCGCCAAAATGGGGTCCAATTCCCAAGCCCAGGGGCAGTCGAGAGCGATGCCGCAAAACCCGAGTGCGCAAAACGGAGGGCCGATTGTGCCCTCCGGGGAAGGGACCTCGTCCGGGAGCGCACTGACTAGGTTTGGCTCGCTGCCTCGACAGGCGTCCATCTACTCGTTGACTCTCGACGAACTGCATTCGCTCGACCCCGGGAAGAATTTCGGATCGATGAACATGAACGAATTTCTCAAGAATATCTGGACTGTAGAGGAGAGTCAGGCTATGGCATCCGCTATGGCTGGGATCGGGAGTGGCAGTAATTTAGCTGGGGAGTCTCCTGCGGAGGGATCCGGGGGAGCTTTAACAGGTGCAAATGGAACTGGGTTATCTCGGCAGACCAGCTTGACCAGGCAAAGCTCTCTCACGCTTCCTCGTACTCTCAGTAGAAAGACTGTCGAGGAGGTTTGGAGGGATATTCACAAACCGATCGAAGGATCGAACGGAGTTCAAACAAATGGCACTGGTCCTACTCAGACTCGGGAAGCCACTTTCGGTGAAATGACTCTCGAAGATTTCCTCGTAAAAGCTGGTGTCGTTAGAGAAGACGGGCCGGATGGCCCAACGTCGTCTTCGTTTGGATCTTTTAACAACTTCATCTCACCTTCGGCGACCAACGATCGAGATGGCACTGGACCTTCAGTTCCGACGCTTTCTCTGGGCACGTCCACTCTGACCCCGGGATCCATGGATTCTATGGCAATGGACACGTACAAACCTGCCCCTGCTCAAGCCGAATGGATGAGGAGCATGGCTGTGACAGCACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAATATGCACATGCAGCCCATCAGCAGCAGATGCAAGCTGCTCATGCTGCCGAGCAGTACGGTAATCACAGGCAGCGAGTGGCCAATGGTAGCGGTATGGTTGTATCGTCCATGCCAAATGGTTATGCCGGGATGGCACCCGGAATGCAGGGTCTCGTTCCCCAAGGGATGATGGGGGTTATTGGTCTGCAGTTAGCCCCCACTTCTCCCAGTAGTCCAATGTCCGATGGCGTAGGGCACAGCCATGGGAACGGGCTGAGCCTATCTCCTGCAGGAAATTATGGAGTCGACGGAGCAATGCGAGGGAGGCGAAAAGGAGGTGATGGTCCACAAGAAAAAACCGTGGAAAGGCGCCAACGACGAATGATTAAAAACAGAGAGTCTGCGGCAAGGTCAAGGGCCCGGAAGCAGGTAATTTACGCATCCTCAACATGCAGGATATTTTGTACACCATGCATTCGTGGTCGTGTCGATATGTCGATTTTTTTTGCTGCTGATTCCACCGTAGCACTCTCTCCAACCTGTGAATACTGTTTGTTTGTGAAGGCCTACACTGTGGAGCTAGAGGCGGAAGTAACTCAGCTGAAAGAAGAAAATAACAGGTTGAAGAGGCAGCAAATTGCGTGGAGGCTGGTAAGACTGGTAAATTTCTTGGCGTTCTAGATTCTTTAATTGTCAACAGGGTTCTATCGAAGAGGACGTAATTTTAGGCTGGTGACGTCGTCGCTGATGGTACAATTTTCGTTTCGTTTTGTTTTTAAACAGGAGGAGATGACCGAGGGCAGAAAGAAGCAGATGATGACGCATCATGCTGTACAAAAGGTCCCTGTAAGCGAAGGAATTACCTTGAGGAGAACAAGAACGGGTCCTTGGTGACTACGTTCTTACGAATTAGGAACTTAGGAGTAGGAAGAGAAGTAGGTAGACAAGCTTGTAACCCTTCTTTGGGAAAGACATGTAACATACGTTCTGTACAGGAGTAAACGTGCCAGCCATCTGATTGGGATTGTTGA

mRNA

>Mapoly0072s0050.1
TCGTTCCACGGACTTCCGCCTCTCCTCCCCTTCCTCCCCTCCGCTTCTCAAGCTCTCTGTCTCTCTCCCTCTCTCTCCCGCCGGGGGGAACGTAGGCGCGGCTCAGTCGGCTCGGCTTGGCGGGCGCGCGGGCGAGCGGGCAGGCAGGCAAGCAGGAGGGCGTGATCGAGGTCAGGGGGCCGAAGGGGCCGAAAGGGCCGAGACGGGTGAGAAGAGTCGGAGGGCCCCCGGGAAAGGCTAAACTAAACTATGGGCTCGACAATTGCGTCCCGAGCGATGCAGAAGCTGCTGCTGGCAAGCCCTAAGTATAAGAGCGCGCACGCTGCTGCCAGCGGACGTTGTGCCCGGTGTCAAAGCGGCGTCGCATCTGCTGCGCAGGTGCAGTTTTAGTCGTCGAGCGCTCGCTCGAGAGAGCCCTGTCGTCGTCGTCGTCGTCGTCGTCGCATCCATCCCACCTCAAGCCTTTTTCACGACTCGACCGGAGGTTTCGTCAGCTCTTGCGCTGGCAGGGTTCGACGCCCGGAAGCGGGCACGCGATCGTGCAGCCAGGAAGGCGCAGGCTCTGCAGGCTCAACCTGCTTCGTCCGGGTTCCAGGACCTCGATCCGACAAGAGCCTACCCTTTCCAGCAGCAGCAGCAGCAGCAGCAGCATCATCATCAACAACATCATCATATTCAGCAGCAGCAGCAGCGCGACGAGGGCGCCAAAATGGGGTCCAATTCCCAAGCCCAGGGGCAGTCGAGAGCGATGCCGCAAAACCCGAGTGCGCAAAACGGAGGGCCGATTGTGCCCTCCGGGGAAGGGACCTCGTCCGGGAGCGCACTGACTAGGTTTGGCTCGCTGCCTCGACAGGCGTCCATCTACTCGTTGACTCTCGACGAACTGCATTCGCTCGACCCCGGGAAGAATTTCGGATCGATGAACATGAACGAATTTCTCAAGAATATCTGGACTGTAGAGGAGAGTCAGGCTATGGCATCCGCTATGGCTGGGATCGGGAGTGGCAGTAATTTAGCTGGGGAGTCTCCTGCGGAGGGATCCGGGGGAGCTTTAACAGGTGCAAATGGAACTGGGTTATCTCGGCAGACCAGCTTGACCAGGCAAAGCTCTCTCACGCTTCCTCGTACTCTCAGTAGAAAGACTGTCGAGGAGGTTTGGAGGGATATTCACAAACCGATCGAAGGATCGAACGGAGTTCAAACAAATGGCACTGGTCCTACTCAGACTCGGGAAGCCACTTTCGGTGAAATGACTCTCGAAGATTTCCTCGTAAAAGCTGGTGTCGTTAGAGAAGACGGGCCGGATGGCCCAACGTCGTCTTCGTTTGGATCTTTTAACAACTTCATCTCACCTTCGGCGACCAACGATCGAGATGGCACTGGACCTTCAGTTCCGACGCTTTCTCTGGGCACGTCCACTCTGACCCCGGGATCCATGGATTCTATGGCAATGGACACGTACAAACCTGCCCCTGCTCAAGCCGAATGGATGAGGAGCATGGCTGTGACAGCACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAATATGCACATGCAGCCCATCAGCAGCAGATGCAAGCTGCTCATGCTGCCGAGCAGTACGGTAATCACAGGCAGCGAGTGGCCAATGGTAGCGGTATGGTTGTATCGTCCATGCCAAATGGTTATGCCGGGATGGCACCCGGAATGCAGGGTCTCGTTCCCCAAGGGATGATGGGGGTTATTGGTCTGCAGTTAGCCCCCACTTCTCCCAGTAGTCCAATGTCCGATGGCGTAGGGCACAGCCATGGGAACGGGCTGAGCCTATCTCCTGCAGGAAATTATGGAGTCGACGGAGCAATGCGAGGGAGGCGAAAAGGAGGTGATGGTCCACAAGAAAAAACCGTGGAAAGGCGCCAACGACGAATGATTAAAAACAGAGAGTCTGCGGCAAGGTCAAGGGCCCGGAAGCAGGCCTACACTGTGGAGCTAGAGGCGGAAGTAACTCAGCTGAAAGAAGAAAATAACAGGTTGAAGAGGCAGCAAATTGCGTGGAGGCTGGTAAGACTGGAGGAGATGACCGAGGGCAGAAAGAAGCAGATGATGACGCATCATGCTGTACAAAAGGTCCCTGTAAGCGAAGGAATTACCTTGAGGAGAACAAGAACGGGTCCTTGGTGACTACGTTCTTACGAATTAGGAACTTAGGAGTAGGAAGAGAAGTAGGTAGACAAGCTTGTAACCCTTCTTTGGGAAAGACATGTAACATACGTTCTGTACAGGAGTAAACGTGCCAGCCATCTGATTGGGATTGTTGA

CDS

>Mapoly0072s0050.1
ATGGGGTCCAATTCCCAAGCCCAGGGGCAGTCGAGAGCGATGCCGCAAAACCCGAGTGCGCAAAACGGAGGGCCGATTGTGCCCTCCGGGGAAGGGACCTCGTCCGGGAGCGCACTGACTAGGTTTGGCTCGCTGCCTCGACAGGCGTCCATCTACTCGTTGACTCTCGACGAACTGCATTCGCTCGACCCCGGGAAGAATTTCGGATCGATGAACATGAACGAATTTCTCAAGAATATCTGGACTGTAGAGGAGAGTCAGGCTATGGCATCCGCTATGGCTGGGATCGGGAGTGGCAGTAATTTAGCTGGGGAGTCTCCTGCGGAGGGATCCGGGGGAGCTTTAACAGGTGCAAATGGAACTGGGTTATCTCGGCAGACCAGCTTGACCAGGCAAAGCTCTCTCACGCTTCCTCGTACTCTCAGTAGAAAGACTGTCGAGGAGGTTTGGAGGGATATTCACAAACCGATCGAAGGATCGAACGGAGTTCAAACAAATGGCACTGGTCCTACTCAGACTCGGGAAGCCACTTTCGGTGAAATGACTCTCGAAGATTTCCTCGTAAAAGCTGGTGTCGTTAGAGAAGACGGGCCGGATGGCCCAACGTCGTCTTCGTTTGGATCTTTTAACAACTTCATCTCACCTTCGGCGACCAACGATCGAGATGGCACTGGACCTTCAGTTCCGACGCTTTCTCTGGGCACGTCCACTCTGACCCCGGGATCCATGGATTCTATGGCAATGGACACGTACAAACCTGCCCCTGCTCAAGCCGAATGGATGAGGAGCATGGCTGTGACAGCACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAATATGCACATGCAGCCCATCAGCAGCAGATGCAAGCTGCTCATGCTGCCGAGCAGTACGGTAATCACAGGCAGCGAGTGGCCAATGGTAGCGGTATGGTTGTATCGTCCATGCCAAATGGTTATGCCGGGATGGCACCCGGAATGCAGGGTCTCGTTCCCCAAGGGATGATGGGGGTTATTGGTCTGCAGTTAGCCCCCACTTCTCCCAGTAGTCCAATGTCCGATGGCGTAGGGCACAGCCATGGGAACGGGCTGAGCCTATCTCCTGCAGGAAATTATGGAGTCGACGGAGCAATGCGAGGGAGGCGAAAAGGAGGTGATGGTCCACAAGAAAAAACCGTGGAAAGGCGCCAACGACGAATGATTAAAAACAGAGAGTCTGCGGCAAGGTCAAGGGCCCGGAAGCAGGCCTACACTGTGGAGCTAGAGGCGGAAGTAACTCAGCTGAAAGAAGAAAATAACAGGTTGAAGAGGCAGCAAATTGCGTGGAGGCTGGTAAGACTGGAGGAGATGACCGAGGGCAGAAAGAAGCAGATGATGACGCATCATGCTGTACAAAAGGTCCCTGTAAGCGAAGGAATTACCTTGAGGAGAACAAGAACGGGTCCTTGGTGA

Protein

>Mapoly0072s0050.1
MGSNSQAQGQSRAMPQNPSAQNGGPIVPSGEGTSSGSALTRFGSLPRQASIYSLTLDELHSLDPGKNFGSMNMNEFLKNIWTVEESQAMASAMAGIGSGSNLAGESPAEGSGGALTGANGTGLSRQTSLTRQSSLTLPRTLSRKTVEEVWRDIHKPIEGSNGVQTNGTGPTQTREATFGEMTLEDFLVKAGVVREDGPDGPTSSSFGSFNNFISPSATNDRDGTGPSVPTLSLGTSTLTPGSMDSMAMDTYKPAPAQAEWMRSMAVTAQQQQQQQQQQQQQQQQYAHAAHQQQMQAAHAAEQYGNHRQRVANGSGMVVSSMPNGYAGMAPGMQGLVPQGMMGVIGLQLAPTSPSSPMSDGVGHSHGNGLSLSPAGNYGVDGAMRGRRKGGDGPQEKTVERRQRRMIKNRESAARSRARKQAYTVELEAEVTQLKEENNRLKRQQIAWRLVRLEEMTEGRKKQMMTHHAVQKVPVSEGITLRRTRTGPW

Mapoly0072s0050.2  

Gene structure:

mRNA scaffold_72:470865..473435  ( - strand )
three_prime_UTR scaffold_72:470865..471001  ( - strand )
CDS scaffold_72:471002..471112  ( - strand )
CDS scaffold_72:471245..471331  ( - strand )
CDS scaffold_72:471467..472726  ( - strand )
five_prime_UTR scaffold_72:472727..473435  ( - strand )

Sequences:

Gene

>Mapoly0072s0050.2
TCGTTCCACGGACTTCCGCCTCTCCTCCCCTTCCTCCCCTCCGCTTCTCAAGCTCTCTGTCTCTCTCCCTCTCTCTCCCGCCGGGGGGAACGTAGGCGCGGCTCAGTCGGCTCGGCTTGGCGGGCGCGCGGGCGAGCGGGCAGGCAGGCAAGCAGGAGGGCGTGATCGAGGTCAGGGGGCCGAAGGGGCCGAAAGGGCCGAGACGGGTGAGAAGAGTCGGAGGGCCCCCGGGAAAGGCTAAACTAAACTATGGGCTCGACAATTGCGTCCCGAGCGATGCAGAAGCTGCTGCTGGCAAGCCCTAAGTATAAGAGCGCGCACGCTGCTGCCAGCGGACGTTGTGCCCGGTGTCAAAGCGGCGTCGCATCTGCTGCGCAGGTGCAGTTTTAGTCGTCGAGCGCTCGCTCGAGAGAGCCCTGTCGTCGTCGTCGTCGTCGTCGTCGCATCCATCCCACCTCAAGCCTTTTTCACGACTCGACCGGAGGTTTCGTCAGCTCTTGCGCTGGCAGGGTTCGACGCCCGGAAGCGGGCACGCGATCGTGCAGCCAGGAAGGCGCAGGCTCTGCAGGCTCAACCTGCTTCGTCCGGGTTCCAGGACCTCGATCCGACAAGAGCCTACCCTTTCCAGCAGCAGCAGCAGCAGCAGCAGCATCATCATCAACAACATCATCATATTCAGCAGCAGCAGCAGCGCGACGAGGGCGCCAAAATGGGGTCCAATTCCCAAGCCCAGGGGCAGTCGAGAGCGATGCCGCAAAACCCGAGTGCGCAAAACGGAGGGCCGATTGTGCCCTCCGGGGAAGGGACCTCGTCCGGGAGCGCACTGACTAGGTTTGGCTCGCTGCCTCGACAGGCGTCCATCTACTCGTTGACTCTCGACGAACTGCATTCGCTCGACCCCGGGAAGAATTTCGGATCGATGAACATGAACGAATTTCTCAAGAATATCTGGACTGTAGAGGAGAGTCAGGCTATGGCATCCGCTATGGCTGGGATCGGGAGTGGCAGTAATTTAGCTGGGGAGTCTCCTGCGGAGGGATCCGGGGGAGCTTTAACAGGTGCAAATGGAACTGGGTTATCTCGGCAGACCAGCTTGACCAGGCAAAGCTCTCTCACGCTTCCTCGTACTCTCAGTAGAAAGACTGTCGAGGAGGTTTGGAGGGATATTCACAAACCGATCGAAGGATCGAACGGAGTTCAAACAAATGGCACTGGTCCTACTCAGACTCGGGAAGCCACTTTCGGTGAAATGACTCTCGAAGATTTCCTCGTAAAAGCTGGTGTCGTTAGAGAAGACGGGCCGGATGGCCCAACGTCGTCTTCGTTTGGATCTTTTAACAACTTCATCTCACCTTCGGCGACCAACGATCGAGATGGCACTGGACCTTCAGTTCCGACGCTTTCTCTGGGCACGTCCACTCTGACCCCGGGATCCATGGATTCTATGGCAATGGACACGTACAAACCTGCCCCTGCTCAAGCCGAATGGATGAGGAGCATGGCTGTGACAGCACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAATATGCACATGCAGCCCATCAGCAGCAGATGCAAGCTGCTCATGCTGCCGAGCAGTACGGTAATCACAGGCAGCGAGTGGCCAATGGTAGCGGTATGGTTGTATCGTCCATGCCAAATGGTTATGCCGGGATGGCACCCGGAATGCAGGGTCTCGTTCCCCAAGGGATGATGGGGGTTATTGGTCTGCAGTTAGCCCCCACTTCTCCCAGTAGTCCAATGTCCGATGGCGTAGGGCACAGCCATGGGAACGGGCTGAGCCTATCTCCTGCAGGAAATTATGGAGTCGACGGAGCAATGCGAGGGAGGCGAAAAGGAGGTGATGGTCCACAAGAAAAAACCGTGGAAAGGCGCCAACGACGAATGATTAAAAACAGAGAGTCTGCGGCAAGGTCAAGGGCCCGGAAGCAGGTAATTTACGCATCCTCAACATGCAGGATATTTTGTACACCATGCATTCGTGGTCGTGTCGATATGTCGATTTTTTTTGCTGCTGATTCCACCGTAGCACTCTCTCCAACCTGTGAATACTGTTTGTTTGTGAAGGCCTACACTGTGGAGCTAGAGGCGGAAGTAACTCAGCTGAAAGAAGAAAATAACAGGTTGAAGAGGCAGCAAATTGCGTGGAGGCTGGTAAGACTGGTAAATTTCTTGGCGTTCTAGATTCTTTAATTGTCAACAGGGTTCTATCGAAGAGGACGTAATTTTAGGCTGGTGACGTCGTCGCTGATGGTACAATTTTCGTTTCGTTTTGTTTTTAAACAGGAGGAGATGACCGAGGGCAGAAAGAAGCAGATGATGACGCATCATGCTGTACAAAAGGTCCCTGTAAGCGAAGGAATTACCTTGAGGAGAACAAGAACGGGTCCTTGGTGACTACGTTCTTACGAATTAGGAACTTAGGAGTAGGAAGAGAAGTAGGTAGACAAGCTTGTAACCCTTCTTTGGGAAAGACATGTAACATACGTTCTGTACAGGAGTAAACGTGCCAGCCATCTGATTGGGATTGTTGA

mRNA

>Mapoly0072s0050.2
TCGTTCCACGGACTTCCGCCTCTCCTCCCCTTCCTCCCCTCCGCTTCTCAAGCTCTCTGTCTCTCTCCCTCTCTCTCCCGCCGGGGGGAACGTAGGCGCGGCTCAGTCGGCTCGGCTTGGCGGGCGCGCGGGCGAGCGGGCAGGCAGGCAAGCAGGAGGGCGTGATCGAGGTCAGGGGGCCGAAGGGGCCGAAAGGGCCGAGACGGGTGAGAAGAGTCGGAGGGCCCCCGGGAAAGGCTAAACTAAACTATGGGCTCGACAATTGCGTCCCGAGCGATGCAGAAGCTGCTGCTGGCAAGCCCTAAGTATAAGAGCGCGCACGCTGCTGCCAGCGGACGTTGTGCCCGGTGTCAAAGCGGCGTCGCATCTGCTGCGCAGGTGCAGTTTTAGTCGTCGAGCGCTCGCTCGAGAGAGCCCTGTCGTCGTCGTCGTCGTCGTCGTCGCATCCATCCCACCTCAAGCCTTTTTCACGACTCGACCGGAGGTTTCGTCAGCTCTTGCGCTGGCAGGGTTCGACGCCCGGAAGCGGGCACGCGATCGTGCAGCCAGGAAGGCGCAGGCTCTGCAGGCTCAACCTGCTTCGTCCGGGTTCCAGGACCTCGATCCGACAAGAGCCTACCCTTTCCAGCAGCAGCAGCAGCAGCAGCAGCATCATCATCAACAACATCATCATATTCAGCAGCAGCAGCAGCGCGACGAGGGCGCCAAAATGGGGTCCAATTCCCAAGCCCAGGGGCAGTCGAGAGCGATGCCGCAAAACCCGAGTGCGCAAAACGGAGGGCCGATTGTGCCCTCCGGGGAAGGGACCTCGTCCGGGAGCGCACTGACTAGGTTTGGCTCGCTGCCTCGACAGGCGTCCATCTACTCGTTGACTCTCGACGAACTGCATTCGCTCGACCCCGGGAAGAATTTCGGATCGATGAACATGAACGAATTTCTCAAGAATATCTGGACTGTAGAGGAGAGTCAGGCTATGGCATCCGCTATGGCTGGGATCGGGAGTGGCAGTAATTTAGCTGGGGAGTCTCCTGCGGAGGGATCCGGGGGAGCTTTAACAGGTGCAAATGGAACTGGGTTATCTCGGCAGACCAGCTTGACCAGGCAAAGCTCTCTCACGCTTCCTCGTACTCTCAGTAGAAAGACTGTCGAGGAGGTTTGGAGGGATATTCACAAACCGATCGAAGGATCGAACGGAGTTCAAACAAATGGCACTGGTCCTACTCAGACTCGGGAAGCCACTTTCGGTGAAATGACTCTCGAAGATTTCCTCGTAAAAGCTGGTGTCGTTAGAGAAGACGGGCCGGATGGCCCAACGTCGTCTTCGTTTGGATCTTTTAACAACTTCATCTCACCTTCGGCGACCAACGATCGAGATGGCACTGGACCTTCAGTTCCGACGCTTTCTCTGGGCACGTCCACTCTGACCCCGGGATCCATGGATTCTATGGCAATGGACACGTACAAACCTGCCCCTGCTCAAGCCGAATGGATGAGGAGCATGGCTGTGACAGCACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAATATGCACATGCAGCCCATCAGCAGCAGATGCAAGCTGCTCATGCTGCCGAGCAGTACGGTAATCACAGGCAGCGAGTGGCCAATGGTAGCGGTATGGTTGTATCGTCCATGCCAAATGGTTATGCCGGGATGGCACCCGGAATGCAGGGTCTCGTTCCCCAAGGGATGATGGGGGTTATTGGTCTGCAGTTAGCCCCCACTTCTCCCAGTAGTCCAATGTCCGATGGCGTAGGGCACAGCCATGGGAACGGGCTGAGCCTATCTCCTGCAGGAAATTATGGAGTCGACGGAGCAATGCGAGGGAGGCGAAAAGGAGGTGATGGTCCACAAGAAAAAACCGTGGAAAGGCGCCAACGACGAATGATTAAAAACAGAGAGTCTGCGGCAAGGTCAAGGGCCCGGAAGCAGGCCTACACTGTGGAGCTAGAGGCGGAAGTAACTCAGCTGAAAGAAGAAAATAACAGGTTGAAGAGGCAGCAAATTGCGTGGAGGCTGGAGGAGATGACCGAGGGCAGAAAGAAGCAGATGATGACGCATCATGCTGTACAAAAGGTCCCTGTAAGCGAAGGAATTACCTTGAGGAGAACAAGAACGGGTCCTTGGTGACTACGTTCTTACGAATTAGGAACTTAGGAGTAGGAAGAGAAGTAGGTAGACAAGCTTGTAACCCTTCTTTGGGAAAGACATGTAACATACGTTCTGTACAGGAGTAAACGTGCCAGCCATCTGATTGGGATTGTTGA

CDS

>Mapoly0072s0050.2
ATGGGGTCCAATTCCCAAGCCCAGGGGCAGTCGAGAGCGATGCCGCAAAACCCGAGTGCGCAAAACGGAGGGCCGATTGTGCCCTCCGGGGAAGGGACCTCGTCCGGGAGCGCACTGACTAGGTTTGGCTCGCTGCCTCGACAGGCGTCCATCTACTCGTTGACTCTCGACGAACTGCATTCGCTCGACCCCGGGAAGAATTTCGGATCGATGAACATGAACGAATTTCTCAAGAATATCTGGACTGTAGAGGAGAGTCAGGCTATGGCATCCGCTATGGCTGGGATCGGGAGTGGCAGTAATTTAGCTGGGGAGTCTCCTGCGGAGGGATCCGGGGGAGCTTTAACAGGTGCAAATGGAACTGGGTTATCTCGGCAGACCAGCTTGACCAGGCAAAGCTCTCTCACGCTTCCTCGTACTCTCAGTAGAAAGACTGTCGAGGAGGTTTGGAGGGATATTCACAAACCGATCGAAGGATCGAACGGAGTTCAAACAAATGGCACTGGTCCTACTCAGACTCGGGAAGCCACTTTCGGTGAAATGACTCTCGAAGATTTCCTCGTAAAAGCTGGTGTCGTTAGAGAAGACGGGCCGGATGGCCCAACGTCGTCTTCGTTTGGATCTTTTAACAACTTCATCTCACCTTCGGCGACCAACGATCGAGATGGCACTGGACCTTCAGTTCCGACGCTTTCTCTGGGCACGTCCACTCTGACCCCGGGATCCATGGATTCTATGGCAATGGACACGTACAAACCTGCCCCTGCTCAAGCCGAATGGATGAGGAGCATGGCTGTGACAGCACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAATATGCACATGCAGCCCATCAGCAGCAGATGCAAGCTGCTCATGCTGCCGAGCAGTACGGTAATCACAGGCAGCGAGTGGCCAATGGTAGCGGTATGGTTGTATCGTCCATGCCAAATGGTTATGCCGGGATGGCACCCGGAATGCAGGGTCTCGTTCCCCAAGGGATGATGGGGGTTATTGGTCTGCAGTTAGCCCCCACTTCTCCCAGTAGTCCAATGTCCGATGGCGTAGGGCACAGCCATGGGAACGGGCTGAGCCTATCTCCTGCAGGAAATTATGGAGTCGACGGAGCAATGCGAGGGAGGCGAAAAGGAGGTGATGGTCCACAAGAAAAAACCGTGGAAAGGCGCCAACGACGAATGATTAAAAACAGAGAGTCTGCGGCAAGGTCAAGGGCCCGGAAGCAGGCCTACACTGTGGAGCTAGAGGCGGAAGTAACTCAGCTGAAAGAAGAAAATAACAGGTTGAAGAGGCAGCAAATTGCGTGGAGGCTGGAGGAGATGACCGAGGGCAGAAAGAAGCAGATGATGACGCATCATGCTGTACAAAAGGTCCCTGTAAGCGAAGGAATTACCTTGAGGAGAACAAGAACGGGTCCTTGGTGA

Protein

>Mapoly0072s0050.2
MGSNSQAQGQSRAMPQNPSAQNGGPIVPSGEGTSSGSALTRFGSLPRQASIYSLTLDELHSLDPGKNFGSMNMNEFLKNIWTVEESQAMASAMAGIGSGSNLAGESPAEGSGGALTGANGTGLSRQTSLTRQSSLTLPRTLSRKTVEEVWRDIHKPIEGSNGVQTNGTGPTQTREATFGEMTLEDFLVKAGVVREDGPDGPTSSSFGSFNNFISPSATNDRDGTGPSVPTLSLGTSTLTPGSMDSMAMDTYKPAPAQAEWMRSMAVTAQQQQQQQQQQQQQQQQYAHAAHQQQMQAAHAAEQYGNHRQRVANGSGMVVSSMPNGYAGMAPGMQGLVPQGMMGVIGLQLAPTSPSSPMSDGVGHSHGNGLSLSPAGNYGVDGAMRGRRKGGDGPQEKTVERRQRRMIKNRESAARSRARKQAYTVELEAEVTQLKEENNRLKRQQIAWRLEEMTEGRKKQMMTHHAVQKVPVSEGITLRRTRTGPW

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>