Mapoly0072s0102



Description

RAV-like factor

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
KEGGORTH K09287 RAV-like factor
OrthoMCL OG5_153242
PFAM PF00847 AP2 domain
PFAM PF02362 B3 DNA binding domain
PANTHER PTHR31140 FAMILY NOT NAMED
PANTHER PTHR31140:SF4

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpAP2B3-1 transcription factor, AP2-B3 Mapoly0072s0102.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0072s0102.1 scaffold_72:982843..988382  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0072s0102.1  

Gene structure:

mRNA scaffold_72:982843..988382  ( - strand )
three_prime_UTR scaffold_72:982843..983415  ( - strand )
CDS scaffold_72:983416..986862  ( - strand )
CDS scaffold_72:987474..987521  ( - strand )
five_prime_UTR scaffold_72:987522..988382  ( - strand )

Sequences:

Gene

>Mapoly0072s0102.1
GCTCGCATCCGCGCACTGTCCGATGAGCTATATGAGGGAGCTGGGTTCGCGAGAGCTCTGCTCAGTAGTGCAGCCTGCTAAGCTTGTCTGTCTCGCTTTCCTTAGCTTGCTTCCGAGGGACGTTCTCACGCCTCAAAGCACTTGCTTCTTCCGCTTCCACAACCACAACCCAACCCCTCCTCTATCGGTCAATCCACCATCTCCTTCTTCTGTCTGCGCATGCCTGCCTGCCTGGGTGCCTGCGTGTCTGTCTGTCTGTCTGAGAGATGGATAGGTAAATATGTATGAGGCATCGCATCGCATCGCATCGAGGGAGCGTGAGATAGATAGAGAGGGAGAGTGAGCGGGATAGTTAGATAGAGAGTCGCGAGCCGCCGTGCCTTCGCTCGCCTCGCCTCGCCTCGCCTCGCCTTGCCTTGTCCGGTCCGGTCTCGGGCCATCTTCTCCTTCTTCAGTGTTAGAGGATGTCTTCACATATTTATTCATTCATTCATTCAGAACTCGCAACTACTTCCTTTCTGTCTGTAGCAGGCAGCCTACGAGAGAGAGACTGAGTGAGCGAGAGACTGAGAGAGCGAGCGAGCGAGAGCGCGAGCGAGAGAGAGATGGGCCAGCGTCCTCGTTCTGATTCAATCATTGATACCGACACCAATCCTTGTGATTTCTGCCCTTGTCTCCACTAGCAGCTCCGTCATCTGTAGATCTCGTATAACGCGCGAGGGACCGACATAGAGCCCAATGAAAGAAGCCTGGGGGTTCTCTGGGAGAGAAGATCGAGTAATGCGAAAGGGATGGGAGGGTTGTCCATGAGCAATACCTCCTCATCTTCTCATCGTGTATTTAGACTACCATCGACACAATATGATGACCGCCGCAACTTCTCGCGTTACGTGTCTCCGTCTCCACTCCGTAAGTAGACTTCTCCATTCGTTATCTCCACCATTTTTCTCCCTCCCTCCCTCCTCACTCTCACTCTCACTCTCTCCCCCTCTCTCCCTCCCTCCTTCACTCTCTCTCTCTATCTATCTACTAGCTTCCGACGTCTGAACGATCAATCTTACGTCACAACATCATTCATATGCTGTCCACAGAGGAAAGCACTGATTGATATGGCTTGCCAATGGTCGACGACTGCGAAAAATTTCAGAAGCTTATGATTCACACGCATTCAAGTTGAGTGTTCGAAGTCAAACCACGCTAGAGTCGCCTGCCTGGATCGTCAGATGTTTAGCGTTGCAAGCAAATCAAGCAGTCTCAGAAGTCTAGCTTGCCGCTATGCGTAGTGCCCATTCTCCACCCTTGCCAGCCGCTCCCGATGTCATTTCTTATCGATACGTTTGCCGCCTCTGCTCGTCTTCTCAATCTTCTGCTCCTTCTTCTGAGAGACACACCGCGTGCTTGAAAATTTAACGACCAGGAGTCTCGTGCTTGTCTCGCGTTGCTTTGCCTCGCCTCGCCTGTATGTAGCCTGATGGTGCTGATTGTGGGTGCCTCTCGTCCTCCTCCTCGTCCTCCTACAGGATCCTAAGGAAATTGCGGACTTGTGGTCCAATGCTGTATTACGAAGCCAACGCTCACCACTTTCGACCCCCGGCAAGGGCGGTCCCGATGTTACTTTGAGACTGCGCGCCGTGTGGGATCAACAATCATCCACATCGAACACGACCGATGCGAGCTTGCAGCAGCAGATGACAAGCCCGAGACTGAACCGACATGGTCTTACGTTAAATCACGAAGCTGCTCCGGGCGCCAGGACCACGCAGTCGTCCACCAGGTCTTGCGACAACAGCTCTTCTTCCAGCCCCCCCGAACAGCAGCAGCAGCAGCAACAGCAACACCAGCAGCAACAACATCACCACCATGAGCACATGAAGAGCCTCAACGCCAGCATCAACATCAACACCGCCGTCAACTCATCGTCCTCGGACGACAAGGAACTAGTCACCGTGGAGCGCAAGACGGCCAAGCTCGAGATTGGCGAGCACCACCACCATCTCCACCACCTCCACAACCTCCACCACCACCACTTCCATCAGCAGCAGATGGTAAAAAGCAGTCAACCCATCAAAGTCGAATGGGCTGAACGAGGAGCAGCAGCAGCAGCAGCAGCCGGGGCGGGTTCGGGGATCAATCTGGCCAATTTCTCTCAGAGCCACAAGCTCGAGGTGTCCGGGGACGTGAAGGATGAGGGCGCCGCGTCCGAGGAGTGTTCGAGCTCTCCGTGCTCGAGCTCAGACAAGCGCATGAACCTGGAGCTGGGCGCCTGCTCGCAGGATGACGCAGCGGCAGCAGCCTTGGTAGGAGTAGCAGCAGCAGCAGCAGCGTCGGCGGCAGCGGGAGAGAGGGGAGGCGAGCGAGGGCCCCCTTCGTGGGCGGGCACAGCGTGGGGTCCCGGGTGCGTGACCAATCCTCGCAGCAGCAGCTGCCTGAACGAGCGAGCTGCGAGCGAGAGGAGCTTCTCGGGAGTGTCGGGGGATGCGGTCACGGGGCCGCCCGAGGAGAGCTCGGACGGGGGCGAGGACAGCCGCGGAGGCGTGCTGAAGGAGGGCGTGAACAAGCTGCCATCGTCGCAGTACCGCGGAGTGGTGCCGCAGCCGAATGGCAGATGGGGCGCTCAGATTTACGAGAAGCACCAGCGCGTGTGGCTGGGCACGTTCAATCGCGAGGAGGATGCGGCTCGCGCCTACGACCGCGCGGCCATGAAATTCCGCGGGCGCGATGCCATGACCAATTTTCGCCCCGTGCAGGAGACGGATCCTGAGGCCGTGTTCCTGCGCCAGTACTCCAAGGAGCAGATTGTCGAGATGCTGCGCCGGCACACGTACGAGGAGGAGCTCGAGCAGAGCAAGCGCCTGGCGAGCATGCGCGTCACCTCGCCGCAGACGCCCGCGGGCATGGTGCCCAATCCGCCGAACGAGAGCGACGACCCGCCCTCGCTGCCGCCCAAGCCGACCATGCAGCGCGAGCATCTGTTCGAGAAGGCCGTGACGCCGAGCGATGTGGGCAAGCTGAACCGGCTGGTGATTCCCAAGCAGCACGCCGAGCGCTGCTTCCCGCTGGACCTGGCCTTGAATGCGCCGTGCCAGACCCTCTCGTTCGAGGATGTGTCGGGCAAGCATTGGCGATTTCGCTACTCGTACTGGAATAGCTCGCAGAGCTACGTGTTCACCAAAGGCTGGAGCCGTTTCGTCAAGGAAAAAAAGCTCGAGGCCGGCGATACGGTGTCGTTCGAGCGCGGGCCCAACCAGGAGCTCTACATTGACTTCCGCCGGCGCCTCAACAATCAGGTCGCTCAGATGCTGCCGGGCCCGTCGACCTCGGCCTCCGATTTCGCTCGCAATCGCCCCTGGGTGCCGCGATTGCCCAACCCGGCTGGCGGCCTGAATCCGGCCGTGTGGCACCAGCTCAGCTTGCAGAACCTTCAATCGTCGCTCGAATCGAGGGAGCAGCTGCAAATGCTCTACGCGCGCCAGGCTTTCCCGCAGCACATGCACTCGCAGCAGCTCTCGAGTTTTTCGAGCCTCCAGCAGCAGCAGCAGCAGCAGCAGAGGCAACAGCAGCAGCACATGGAAAGTGGAGTGTCCCTCCCGCATCAGACGAGGACGGGGGACGACTTTTTCTCGCTGCTGGAGCTCGGGCGACGCACCGACGGCGGAGTGGCAGCCATGGACCGAACTGTCGTCGGTGCCTCGACTACGGTCGTCAAGCCGCAGCAGCTGCTCGCGGAAGGGCCTGTTTCGACGCCGTCGGCAGCCCCTGCCGGCGCGAGCGGGGGCACGAGGCTGTTCGGGGTGGACTTGGAGAAGACGTCGTCGTCGTCCGCTCAGAGAAGCACCGAGCGCGAATCCGCTGTGGTCTCGGGGCTGAACGACTGGAAGTCGCAGACGTACGCGCAGCAGCTGCAATCTTTGAGCAGGGCGTCGTCGTATCATCAAGGAGAGTCGAGCTTCCAGCAGCAGCAGCAGCAGCACTTGCCCACTGCGCGCATCCTGCCGTCGTTCCAAGGATCTTTGCATGGGCAGTCGCCCGCTCCGGTGCTGATGGCGGCTAGCGCCAAGCAGCAGCAGCAGCAGCAGCAGGAGCAATCGTCATTCATGGGATTGTCAATTGTGCGAGGCCGAGCGGGCGAGCAATCGCCGGGCACGCGGCTCGCGGCCTCGCATTCGAATTTGCAGCTCGCGTCGTCGACCAACATGAACAGCGGCAGCGCAGCTCGCGCTGCCGGGGCCGGGGCCGAGCTGCAGGAGGCCGGGGCGAGGACGGTGGTGGCGCTGGGGCTGGCCGGGCCGCAGCAATTCGCAGGCGACAGCCGCAAGCGCAAGGTGGGAATTCTCGAGAGTCTGAAGAACTCGGGTCCGGCCGATTCGTACGCGAGGGACGGGGCGCCCGACACCTCGCTCTCGCTGGCTCAACATTCCGAGTCCACGACGCAGGTCTCGTTCACCACGGAGTCCTCGCATTTCTCGAGCAGCACGCAACCCAGCGGCAGTACCTCGACCGCCGAGGACCGGGAGCAGAAGTCTCCCAAGCGACATTGCTCGCCGGTGCAAGGCGCTCCCACAGGCAGCAGCAAAGCTTGCGCCGCGGGCCTGCCCTTGACCTCGACGACCACCGACACTCGCGGCTGCCGAGTCGATCAGAAGCAGCAGCAGCAGCAGCCCCCGCAGCCCGTCGCCAGTGCCAACACCACCAGCGGACCTCCCGGGGCCGTCGTCAAATGCCATCTGCAGTGGTCGCCCGAGAAATTTCTCAACATCAGCCTGGCCAATTTCCATTCCGTGGAGGGGCTCAAGCGCGAGCTGCTGCAGTTCACGCATTTGGACTTCGCCCAGGGCCTGGACATTGTCTACAAGGACAAGGACGGCGACATCATGCTGCTGTCGGAGCATTCCTGGGGCCTGTTCAAGGAAAATGTGCAGGAGATGTGGATCCGGAAAACCGAGCAGCCGCAGCAGCAGCGTGCGTGAATTCGAATTGAATGTCACGGCGCGTCGTCATCGACATCGCATTGAATTTCTCGATCGGACATCACAGACCGATCAATCACGAGCAATTCCGCGCGAGGGCGGATAGGAAGCAAGCAAGCAATCAAGCATTCAAGTCGTATTAGGAGGAGGACAAGACTCATTCTTTTGTCTGTGGACGGGTGCGCGCAAATGTGAAGAGGCTACGTCGGTACCGGTGGCACTCTTACGTCTGACAGGCCCTCGATCAGATCACACACCCCAGATCTCGAGGTGTAATTTGTATAGAAACCCAGTATGGTGTAGATCTACCAAAGGCATCTAAAAGGTCCATATGACATTTTAACTGATAAGTCCCAAACTGGTAGAAATTTTGTCGAGGACGAACATATAGATAGACCGGGCATCTCTCGACCCACTTTTACGATTGCACATGCTCCAGCCTCGGGAAGACAGACCGAGAATGTACGCCTGCCCGCCCGCCCGCCCGCTCGACTTTCCCGAGATACCATGTATATGTTCGATCCCAACACATGTATATCATTTTTTGAAAACGTTTATCAATCAATCTACCCC

mRNA

>Mapoly0072s0102.1
GCTCGCATCCGCGCACTGTCCGATGAGCTATATGAGGGAGCTGGGTTCGCGAGAGCTCTGCTCAGTAGTGCAGCCTGCTAAGCTTGTCTGTCTCGCTTTCCTTAGCTTGCTTCCGAGGGACGTTCTCACGCCTCAAAGCACTTGCTTCTTCCGCTTCCACAACCACAACCCAACCCCTCCTCTATCGGTCAATCCACCATCTCCTTCTTCTGTCTGCGCATGCCTGCCTGCCTGGGTGCCTGCGTGTCTGTCTGTCTGTCTGAGAGATGGATAGGTAAATATGTATGAGGCATCGCATCGCATCGCATCGAGGGAGCGTGAGATAGATAGAGAGGGAGAGTGAGCGGGATAGTTAGATAGAGAGTCGCGAGCCGCCGTGCCTTCGCTCGCCTCGCCTCGCCTCGCCTCGCCTTGCCTTGTCCGGTCCGGTCTCGGGCCATCTTCTCCTTCTTCAGTGTTAGAGGATGTCTTCACATATTTATTCATTCATTCATTCAGAACTCGCAACTACTTCCTTTCTGTCTGTAGCAGGCAGCCTACGAGAGAGAGACTGAGTGAGCGAGAGACTGAGAGAGCGAGCGAGCGAGAGCGCGAGCGAGAGAGAGATGGGCCAGCGTCCTCGTTCTGATTCAATCATTGATACCGACACCAATCCTTGTGATTTCTGCCCTTGTCTCCACTAGCAGCTCCGTCATCTGTAGATCTCGTATAACGCGCGAGGGACCGACATAGAGCCCAATGAAAGAAGCCTGGGGGTTCTCTGGGAGAGAAGATCGAGTAATGCGAAAGGGATGGGAGGGTTGTCCATGAGCAATACCTCCTCATCTTCTCATCGTGTATTTAGACTACCATCGACACAATATGATGACCGCCGCAACTTCTCGCGTTACGTGTCTCCGTCTCCACTCCGATCCTAAGGAAATTGCGGACTTGTGGTCCAATGCTGTATTACGAAGCCAACGCTCACCACTTTCGACCCCCGGCAAGGGCGGTCCCGATGTTACTTTGAGACTGCGCGCCGTGTGGGATCAACAATCATCCACATCGAACACGACCGATGCGAGCTTGCAGCAGCAGATGACAAGCCCGAGACTGAACCGACATGGTCTTACGTTAAATCACGAAGCTGCTCCGGGCGCCAGGACCACGCAGTCGTCCACCAGGTCTTGCGACAACAGCTCTTCTTCCAGCCCCCCCGAACAGCAGCAGCAGCAGCAACAGCAACACCAGCAGCAACAACATCACCACCATGAGCACATGAAGAGCCTCAACGCCAGCATCAACATCAACACCGCCGTCAACTCATCGTCCTCGGACGACAAGGAACTAGTCACCGTGGAGCGCAAGACGGCCAAGCTCGAGATTGGCGAGCACCACCACCATCTCCACCACCTCCACAACCTCCACCACCACCACTTCCATCAGCAGCAGATGGTAAAAAGCAGTCAACCCATCAAAGTCGAATGGGCTGAACGAGGAGCAGCAGCAGCAGCAGCAGCCGGGGCGGGTTCGGGGATCAATCTGGCCAATTTCTCTCAGAGCCACAAGCTCGAGGTGTCCGGGGACGTGAAGGATGAGGGCGCCGCGTCCGAGGAGTGTTCGAGCTCTCCGTGCTCGAGCTCAGACAAGCGCATGAACCTGGAGCTGGGCGCCTGCTCGCAGGATGACGCAGCGGCAGCAGCCTTGGTAGGAGTAGCAGCAGCAGCAGCAGCGTCGGCGGCAGCGGGAGAGAGGGGAGGCGAGCGAGGGCCCCCTTCGTGGGCGGGCACAGCGTGGGGTCCCGGGTGCGTGACCAATCCTCGCAGCAGCAGCTGCCTGAACGAGCGAGCTGCGAGCGAGAGGAGCTTCTCGGGAGTGTCGGGGGATGCGGTCACGGGGCCGCCCGAGGAGAGCTCGGACGGGGGCGAGGACAGCCGCGGAGGCGTGCTGAAGGAGGGCGTGAACAAGCTGCCATCGTCGCAGTACCGCGGAGTGGTGCCGCAGCCGAATGGCAGATGGGGCGCTCAGATTTACGAGAAGCACCAGCGCGTGTGGCTGGGCACGTTCAATCGCGAGGAGGATGCGGCTCGCGCCTACGACCGCGCGGCCATGAAATTCCGCGGGCGCGATGCCATGACCAATTTTCGCCCCGTGCAGGAGACGGATCCTGAGGCCGTGTTCCTGCGCCAGTACTCCAAGGAGCAGATTGTCGAGATGCTGCGCCGGCACACGTACGAGGAGGAGCTCGAGCAGAGCAAGCGCCTGGCGAGCATGCGCGTCACCTCGCCGCAGACGCCCGCGGGCATGGTGCCCAATCCGCCGAACGAGAGCGACGACCCGCCCTCGCTGCCGCCCAAGCCGACCATGCAGCGCGAGCATCTGTTCGAGAAGGCCGTGACGCCGAGCGATGTGGGCAAGCTGAACCGGCTGGTGATTCCCAAGCAGCACGCCGAGCGCTGCTTCCCGCTGGACCTGGCCTTGAATGCGCCGTGCCAGACCCTCTCGTTCGAGGATGTGTCGGGCAAGCATTGGCGATTTCGCTACTCGTACTGGAATAGCTCGCAGAGCTACGTGTTCACCAAAGGCTGGAGCCGTTTCGTCAAGGAAAAAAAGCTCGAGGCCGGCGATACGGTGTCGTTCGAGCGCGGGCCCAACCAGGAGCTCTACATTGACTTCCGCCGGCGCCTCAACAATCAGGTCGCTCAGATGCTGCCGGGCCCGTCGACCTCGGCCTCCGATTTCGCTCGCAATCGCCCCTGGGTGCCGCGATTGCCCAACCCGGCTGGCGGCCTGAATCCGGCCGTGTGGCACCAGCTCAGCTTGCAGAACCTTCAATCGTCGCTCGAATCGAGGGAGCAGCTGCAAATGCTCTACGCGCGCCAGGCTTTCCCGCAGCACATGCACTCGCAGCAGCTCTCGAGTTTTTCGAGCCTCCAGCAGCAGCAGCAGCAGCAGCAGAGGCAACAGCAGCAGCACATGGAAAGTGGAGTGTCCCTCCCGCATCAGACGAGGACGGGGGACGACTTTTTCTCGCTGCTGGAGCTCGGGCGACGCACCGACGGCGGAGTGGCAGCCATGGACCGAACTGTCGTCGGTGCCTCGACTACGGTCGTCAAGCCGCAGCAGCTGCTCGCGGAAGGGCCTGTTTCGACGCCGTCGGCAGCCCCTGCCGGCGCGAGCGGGGGCACGAGGCTGTTCGGGGTGGACTTGGAGAAGACGTCGTCGTCGTCCGCTCAGAGAAGCACCGAGCGCGAATCCGCTGTGGTCTCGGGGCTGAACGACTGGAAGTCGCAGACGTACGCGCAGCAGCTGCAATCTTTGAGCAGGGCGTCGTCGTATCATCAAGGAGAGTCGAGCTTCCAGCAGCAGCAGCAGCAGCACTTGCCCACTGCGCGCATCCTGCCGTCGTTCCAAGGATCTTTGCATGGGCAGTCGCCCGCTCCGGTGCTGATGGCGGCTAGCGCCAAGCAGCAGCAGCAGCAGCAGCAGGAGCAATCGTCATTCATGGGATTGTCAATTGTGCGAGGCCGAGCGGGCGAGCAATCGCCGGGCACGCGGCTCGCGGCCTCGCATTCGAATTTGCAGCTCGCGTCGTCGACCAACATGAACAGCGGCAGCGCAGCTCGCGCTGCCGGGGCCGGGGCCGAGCTGCAGGAGGCCGGGGCGAGGACGGTGGTGGCGCTGGGGCTGGCCGGGCCGCAGCAATTCGCAGGCGACAGCCGCAAGCGCAAGGTGGGAATTCTCGAGAGTCTGAAGAACTCGGGTCCGGCCGATTCGTACGCGAGGGACGGGGCGCCCGACACCTCGCTCTCGCTGGCTCAACATTCCGAGTCCACGACGCAGGTCTCGTTCACCACGGAGTCCTCGCATTTCTCGAGCAGCACGCAACCCAGCGGCAGTACCTCGACCGCCGAGGACCGGGAGCAGAAGTCTCCCAAGCGACATTGCTCGCCGGTGCAAGGCGCTCCCACAGGCAGCAGCAAAGCTTGCGCCGCGGGCCTGCCCTTGACCTCGACGACCACCGACACTCGCGGCTGCCGAGTCGATCAGAAGCAGCAGCAGCAGCAGCCCCCGCAGCCCGTCGCCAGTGCCAACACCACCAGCGGACCTCCCGGGGCCGTCGTCAAATGCCATCTGCAGTGGTCGCCCGAGAAATTTCTCAACATCAGCCTGGCCAATTTCCATTCCGTGGAGGGGCTCAAGCGCGAGCTGCTGCAGTTCACGCATTTGGACTTCGCCCAGGGCCTGGACATTGTCTACAAGGACAAGGACGGCGACATCATGCTGCTGTCGGAGCATTCCTGGGGCCTGTTCAAGGAAAATGTGCAGGAGATGTGGATCCGGAAAACCGAGCAGCCGCAGCAGCAGCGTGCGTGAATTCGAATTGAATGTCACGGCGCGTCGTCATCGACATCGCATTGAATTTCTCGATCGGACATCACAGACCGATCAATCACGAGCAATTCCGCGCGAGGGCGGATAGGAAGCAAGCAAGCAATCAAGCATTCAAGTCGTATTAGGAGGAGGACAAGACTCATTCTTTTGTCTGTGGACGGGTGCGCGCAAATGTGAAGAGGCTACGTCGGTACCGGTGGCACTCTTACGTCTGACAGGCCCTCGATCAGATCACACACCCCAGATCTCGAGGTGTAATTTGTATAGAAACCCAGTATGGTGTAGATCTACCAAAGGCATCTAAAAGGTCCATATGACATTTTAACTGATAAGTCCCAAACTGGTAGAAATTTTGTCGAGGACGAACATATAGATAGACCGGGCATCTCTCGACCCACTTTTACGATTGCACATGCTCCAGCCTCGGGAAGACAGACCGAGAATGTACGCCTGCCCGCCCGCCCGCCCGCTCGACTTTCCCGAGATACCATGTATATGTTCGATCCCAACACATGTATATCATTTTTTGAAAACGTTTATCAATCAATCTACCCC

CDS

>Mapoly0072s0102.1
ATGATGACCGCCGCAACTTCTCGCGTTACGTGTCTCCGTCTCCACTCCGATCCTAAGGAAATTGCGGACTTGTGGTCCAATGCTGTATTACGAAGCCAACGCTCACCACTTTCGACCCCCGGCAAGGGCGGTCCCGATGTTACTTTGAGACTGCGCGCCGTGTGGGATCAACAATCATCCACATCGAACACGACCGATGCGAGCTTGCAGCAGCAGATGACAAGCCCGAGACTGAACCGACATGGTCTTACGTTAAATCACGAAGCTGCTCCGGGCGCCAGGACCACGCAGTCGTCCACCAGGTCTTGCGACAACAGCTCTTCTTCCAGCCCCCCCGAACAGCAGCAGCAGCAGCAACAGCAACACCAGCAGCAACAACATCACCACCATGAGCACATGAAGAGCCTCAACGCCAGCATCAACATCAACACCGCCGTCAACTCATCGTCCTCGGACGACAAGGAACTAGTCACCGTGGAGCGCAAGACGGCCAAGCTCGAGATTGGCGAGCACCACCACCATCTCCACCACCTCCACAACCTCCACCACCACCACTTCCATCAGCAGCAGATGGTAAAAAGCAGTCAACCCATCAAAGTCGAATGGGCTGAACGAGGAGCAGCAGCAGCAGCAGCAGCCGGGGCGGGTTCGGGGATCAATCTGGCCAATTTCTCTCAGAGCCACAAGCTCGAGGTGTCCGGGGACGTGAAGGATGAGGGCGCCGCGTCCGAGGAGTGTTCGAGCTCTCCGTGCTCGAGCTCAGACAAGCGCATGAACCTGGAGCTGGGCGCCTGCTCGCAGGATGACGCAGCGGCAGCAGCCTTGGTAGGAGTAGCAGCAGCAGCAGCAGCGTCGGCGGCAGCGGGAGAGAGGGGAGGCGAGCGAGGGCCCCCTTCGTGGGCGGGCACAGCGTGGGGTCCCGGGTGCGTGACCAATCCTCGCAGCAGCAGCTGCCTGAACGAGCGAGCTGCGAGCGAGAGGAGCTTCTCGGGAGTGTCGGGGGATGCGGTCACGGGGCCGCCCGAGGAGAGCTCGGACGGGGGCGAGGACAGCCGCGGAGGCGTGCTGAAGGAGGGCGTGAACAAGCTGCCATCGTCGCAGTACCGCGGAGTGGTGCCGCAGCCGAATGGCAGATGGGGCGCTCAGATTTACGAGAAGCACCAGCGCGTGTGGCTGGGCACGTTCAATCGCGAGGAGGATGCGGCTCGCGCCTACGACCGCGCGGCCATGAAATTCCGCGGGCGCGATGCCATGACCAATTTTCGCCCCGTGCAGGAGACGGATCCTGAGGCCGTGTTCCTGCGCCAGTACTCCAAGGAGCAGATTGTCGAGATGCTGCGCCGGCACACGTACGAGGAGGAGCTCGAGCAGAGCAAGCGCCTGGCGAGCATGCGCGTCACCTCGCCGCAGACGCCCGCGGGCATGGTGCCCAATCCGCCGAACGAGAGCGACGACCCGCCCTCGCTGCCGCCCAAGCCGACCATGCAGCGCGAGCATCTGTTCGAGAAGGCCGTGACGCCGAGCGATGTGGGCAAGCTGAACCGGCTGGTGATTCCCAAGCAGCACGCCGAGCGCTGCTTCCCGCTGGACCTGGCCTTGAATGCGCCGTGCCAGACCCTCTCGTTCGAGGATGTGTCGGGCAAGCATTGGCGATTTCGCTACTCGTACTGGAATAGCTCGCAGAGCTACGTGTTCACCAAAGGCTGGAGCCGTTTCGTCAAGGAAAAAAAGCTCGAGGCCGGCGATACGGTGTCGTTCGAGCGCGGGCCCAACCAGGAGCTCTACATTGACTTCCGCCGGCGCCTCAACAATCAGGTCGCTCAGATGCTGCCGGGCCCGTCGACCTCGGCCTCCGATTTCGCTCGCAATCGCCCCTGGGTGCCGCGATTGCCCAACCCGGCTGGCGGCCTGAATCCGGCCGTGTGGCACCAGCTCAGCTTGCAGAACCTTCAATCGTCGCTCGAATCGAGGGAGCAGCTGCAAATGCTCTACGCGCGCCAGGCTTTCCCGCAGCACATGCACTCGCAGCAGCTCTCGAGTTTTTCGAGCCTCCAGCAGCAGCAGCAGCAGCAGCAGAGGCAACAGCAGCAGCACATGGAAAGTGGAGTGTCCCTCCCGCATCAGACGAGGACGGGGGACGACTTTTTCTCGCTGCTGGAGCTCGGGCGACGCACCGACGGCGGAGTGGCAGCCATGGACCGAACTGTCGTCGGTGCCTCGACTACGGTCGTCAAGCCGCAGCAGCTGCTCGCGGAAGGGCCTGTTTCGACGCCGTCGGCAGCCCCTGCCGGCGCGAGCGGGGGCACGAGGCTGTTCGGGGTGGACTTGGAGAAGACGTCGTCGTCGTCCGCTCAGAGAAGCACCGAGCGCGAATCCGCTGTGGTCTCGGGGCTGAACGACTGGAAGTCGCAGACGTACGCGCAGCAGCTGCAATCTTTGAGCAGGGCGTCGTCGTATCATCAAGGAGAGTCGAGCTTCCAGCAGCAGCAGCAGCAGCACTTGCCCACTGCGCGCATCCTGCCGTCGTTCCAAGGATCTTTGCATGGGCAGTCGCCCGCTCCGGTGCTGATGGCGGCTAGCGCCAAGCAGCAGCAGCAGCAGCAGCAGGAGCAATCGTCATTCATGGGATTGTCAATTGTGCGAGGCCGAGCGGGCGAGCAATCGCCGGGCACGCGGCTCGCGGCCTCGCATTCGAATTTGCAGCTCGCGTCGTCGACCAACATGAACAGCGGCAGCGCAGCTCGCGCTGCCGGGGCCGGGGCCGAGCTGCAGGAGGCCGGGGCGAGGACGGTGGTGGCGCTGGGGCTGGCCGGGCCGCAGCAATTCGCAGGCGACAGCCGCAAGCGCAAGGTGGGAATTCTCGAGAGTCTGAAGAACTCGGGTCCGGCCGATTCGTACGCGAGGGACGGGGCGCCCGACACCTCGCTCTCGCTGGCTCAACATTCCGAGTCCACGACGCAGGTCTCGTTCACCACGGAGTCCTCGCATTTCTCGAGCAGCACGCAACCCAGCGGCAGTACCTCGACCGCCGAGGACCGGGAGCAGAAGTCTCCCAAGCGACATTGCTCGCCGGTGCAAGGCGCTCCCACAGGCAGCAGCAAAGCTTGCGCCGCGGGCCTGCCCTTGACCTCGACGACCACCGACACTCGCGGCTGCCGAGTCGATCAGAAGCAGCAGCAGCAGCAGCCCCCGCAGCCCGTCGCCAGTGCCAACACCACCAGCGGACCTCCCGGGGCCGTCGTCAAATGCCATCTGCAGTGGTCGCCCGAGAAATTTCTCAACATCAGCCTGGCCAATTTCCATTCCGTGGAGGGGCTCAAGCGCGAGCTGCTGCAGTTCACGCATTTGGACTTCGCCCAGGGCCTGGACATTGTCTACAAGGACAAGGACGGCGACATCATGCTGCTGTCGGAGCATTCCTGGGGCCTGTTCAAGGAAAATGTGCAGGAGATGTGGATCCGGAAAACCGAGCAGCCGCAGCAGCAGCGTGCGTGA

Protein

>Mapoly0072s0102.1
MMTAATSRVTCLRLHSDPKEIADLWSNAVLRSQRSPLSTPGKGGPDVTLRLRAVWDQQSSTSNTTDASLQQQMTSPRLNRHGLTLNHEAAPGARTTQSSTRSCDNSSSSSPPEQQQQQQQQHQQQQHHHHEHMKSLNASININTAVNSSSSDDKELVTVERKTAKLEIGEHHHHLHHLHNLHHHHFHQQQMVKSSQPIKVEWAERGAAAAAAAGAGSGINLANFSQSHKLEVSGDVKDEGAASEECSSSPCSSSDKRMNLELGACSQDDAAAAALVGVAAAAAASAAAGERGGERGPPSWAGTAWGPGCVTNPRSSSCLNERAASERSFSGVSGDAVTGPPEESSDGGEDSRGGVLKEGVNKLPSSQYRGVVPQPNGRWGAQIYEKHQRVWLGTFNREEDAARAYDRAAMKFRGRDAMTNFRPVQETDPEAVFLRQYSKEQIVEMLRRHTYEEELEQSKRLASMRVTSPQTPAGMVPNPPNESDDPPSLPPKPTMQREHLFEKAVTPSDVGKLNRLVIPKQHAERCFPLDLALNAPCQTLSFEDVSGKHWRFRYSYWNSSQSYVFTKGWSRFVKEKKLEAGDTVSFERGPNQELYIDFRRRLNNQVAQMLPGPSTSASDFARNRPWVPRLPNPAGGLNPAVWHQLSLQNLQSSLESREQLQMLYARQAFPQHMHSQQLSSFSSLQQQQQQQQRQQQQHMESGVSLPHQTRTGDDFFSLLELGRRTDGGVAAMDRTVVGASTTVVKPQQLLAEGPVSTPSAAPAGASGGTRLFGVDLEKTSSSSAQRSTERESAVVSGLNDWKSQTYAQQLQSLSRASSYHQGESSFQQQQQQHLPTARILPSFQGSLHGQSPAPVLMAASAKQQQQQQQEQSSFMGLSIVRGRAGEQSPGTRLAASHSNLQLASSTNMNSGSAARAAGAGAELQEAGARTVVALGLAGPQQFAGDSRKRKVGILESLKNSGPADSYARDGAPDTSLSLAQHSESTTQVSFTTESSHFSSSTQPSGSTSTAEDREQKSPKRHCSPVQGAPTGSSKACAAGLPLTSTTTDTRGCRVDQKQQQQQPPQPVASANTTSGPPGAVVKCHLQWSPEKFLNISLANFHSVEGLKRELLQFTHLDFAQGLDIVYKDKDGDIMLLSEHSWGLFKENVQEMWIRKTEQPQQQRA

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>