Mapoly0073s0051



Description

STEROL REGULATORY ELEMENT-BINDING PROTEIN

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_166963
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR12565 STEROL REGULATORY ELEMENT-BINDING PROTEIN
PANTHER PTHR12565:SF74

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH40 transcription factor, bHLH Mapoly0073s0051.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0073s0051.1 scaffold_73:563896..565827  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0073s0051.1  

Gene structure:

mRNA scaffold_73:563896..565827  ( - strand )
CDS scaffold_73:563896..564023  ( - strand )
CDS scaffold_73:564210..565827  ( - strand )

Sequences:

Gene

>Mapoly0073s0051.1
ATGGACACCATCCAAGGCATGGACGCTGGGGACTTACTGTTTTCCGCCCCACTGTCATCCGCTCTGGACTCTTCCAAGTTCTGGAGCGGCATCAAAATGGAAAGCCCGTTTCACGGCGACTCGACCACCATGATCAACAACAACGCCAACTCCAACAATGGGTCGTGCGTTGCCAGCTATATTCAAGCGATGGAGGGCCAGGCGAAGTTCCCCGCCAATCAGCCCTTGAAGTACAGTCCCGCAGATGCTCTGGGATTAATGGACATGGATCAGGCCAAATGCGGTTTTTCCACCGTGACCTCCACTCAGCGCAATCAGTTCGTGCGGCCCTTGGACGATGCTATCGAGACCTTCGGCTTGGACGCGGACATGGAGCTCATAAATAGGATGCCATTCGGAAGCTGGAATCAGGCTCGCCTCAGCGGCGAATTGCCGGCTCAGAGCAAGCCCGGCATGTGCCGCTACCCGTCGGAAATTTCCGACGACAGCTCGCTCGACGGGGGTCTCCCGGCCAGCAGCACCGTGAGCTCCACGAGCGATGGGCTCGCCTCGAGAGAAGACCTCGACGACGACGTATACGTCGAGGGCGGCTCCACCAACGCGGAGCTGCCGTCGCTGTCAAATATTACTCTGAACTCCCCGCGTCTGCTCCAGCAGCGCAGCAAGATTGGCATGGCATCGCCCGGCTCCGAAGGCAGCGCCCAATCTGCAGATCAGGCCGGCAGTGACAGCAGAGATTGCTCGCTCAGAGAAATGGAGAACCAGCTCGTTGATCGGACCGTAATGGAGGCGAATGCGGCCGCCGACCTGACCTCGTTACAAAATACGGCGCTGGAAAATCCGGACATTGCAGTGCTCGTGCCGCAGGATGTGAAGGAGAACGAAAGGCCGCCGCCGACATCGGGCATGGATTTGAAGTGGAAGCACGAGGCTCCGGTTCTAGACGTGAGCGAGAATTGGAACAGCAAGAAATTGAAGTCGAGCCCGCCGTCGTCGCCGACCGCCTCGCCAGGTCTCGCAGTCCCGTTTCTGGCCCCGCCTCTCGCCGCGAGCCTGAATGGCATGAATGTGAATCCCTCCAGCGCGCCGTTCCTCATGAGCAGCAACGTCCGCAGCATTTATCAGATGCAGCAGCCGGTTCTCGCAGGGCTGGGGGCGCCGGCCGATTTGACCAAGGTCGCAGGACCCAGCGCCAAGGGCGGGCTCATGGCAAACATGGCTCCGCATCACTTGCTGTTCGGGCCCAATTTTCCTGCCATTGCGAATCTGGACCCTGCCGCCATCGAGAACTCGAGACCCAAACGGCGCAACGTGAAAATCTCCAAGGATCCGCAAAGTGTGGCTGCTCGGCATCGGAGGGAACGAATTAGCGACCGGATTCGGGTGCTGCAAAGACTGGTTCCAGGAGGGACGAAGATGGACACGGCTTCCATGCTGGACGAGGCGATATCTTACGTCAAGTACCTGAAGCTCCAAGTCCAGACTCTCGAGTCGTGCGGCAATGCAGGTTTCGACCCACGCATGCCGTATCCGGCTTACTACATGCCGGTGCGCTCTGCTCAAGGGGACTGCTCCACCATGTCTCAAATCTCGCCGGGTGGGGGTTCTGCGGACCTCGGTATATACGGGGCTGGACTCGGACAATCGACCATGAAGTTCCCGCAATTCTGTCACTGAAGTGTTTGGAGCTCGAGCTCGAGCTGAGGGTTGAGCTTGTGCACTGTTATACGACTCGAGGAGGCCGATGCCGAAGACGACGCTTGTTTTGATTTTCTGGCCCCATTTGCTTTGTTTCGTCTTTCAGGATCTCTCTCGCTCGCTCTCTCGTCACGCGACGGCGAGATCCAGAGTGCTGAACAGTCGGAGCAAGTTTGGCTGCTGCTTATGATGATGATGGAGGAGACGAGGATGGTGACGGTAGTTCCTTTGTAG

mRNA

>Mapoly0073s0051.1
ATGGACACCATCCAAGGCATGGACGCTGGGGACTTACTGTTTTCCGCCCCACTGTCATCCGCTCTGGACTCTTCCAAGTTCTGGAGCGGCATCAAAATGGAAAGCCCGTTTCACGGCGACTCGACCACCATGATCAACAACAACGCCAACTCCAACAATGGGTCGTGCGTTGCCAGCTATATTCAAGCGATGGAGGGCCAGGCGAAGTTCCCCGCCAATCAGCCCTTGAAGTACAGTCCCGCAGATGCTCTGGGATTAATGGACATGGATCAGGCCAAATGCGGTTTTTCCACCGTGACCTCCACTCAGCGCAATCAGTTCGTGCGGCCCTTGGACGATGCTATCGAGACCTTCGGCTTGGACGCGGACATGGAGCTCATAAATAGGATGCCATTCGGAAGCTGGAATCAGGCTCGCCTCAGCGGCGAATTGCCGGCTCAGAGCAAGCCCGGCATGTGCCGCTACCCGTCGGAAATTTCCGACGACAGCTCGCTCGACGGGGGTCTCCCGGCCAGCAGCACCGTGAGCTCCACGAGCGATGGGCTCGCCTCGAGAGAAGACCTCGACGACGACGTATACGTCGAGGGCGGCTCCACCAACGCGGAGCTGCCGTCGCTGTCAAATATTACTCTGAACTCCCCGCGTCTGCTCCAGCAGCGCAGCAAGATTGGCATGGCATCGCCCGGCTCCGAAGGCAGCGCCCAATCTGCAGATCAGGCCGGCAGTGACAGCAGAGATTGCTCGCTCAGAGAAATGGAGAACCAGCTCGTTGATCGGACCGTAATGGAGGCGAATGCGGCCGCCGACCTGACCTCGTTACAAAATACGGCGCTGGAAAATCCGGACATTGCAGTGCTCGTGCCGCAGGATGTGAAGGAGAACGAAAGGCCGCCGCCGACATCGGGCATGGATTTGAAGTGGAAGCACGAGGCTCCGGTTCTAGACGTGAGCGAGAATTGGAACAGCAAGAAATTGAAGTCGAGCCCGCCGTCGTCGCCGACCGCCTCGCCAGGTCTCGCAGTCCCGTTTCTGGCCCCGCCTCTCGCCGCGAGCCTGAATGGCATGAATGTGAATCCCTCCAGCGCGCCGTTCCTCATGAGCAGCAACGTCCGCAGCATTTATCAGATGCAGCAGCCGGTTCTCGCAGGGCTGGGGGCGCCGGCCGATTTGACCAAGGTCGCAGGACCCAGCGCCAAGGGCGGGCTCATGGCAAACATGGCTCCGCATCACTTGCTGTTCGGGCCCAATTTTCCTGCCATTGCGAATCTGGACCCTGCCGCCATCGAGAACTCGAGACCCAAACGGCGCAACGTGAAAATCTCCAAGGATCCGCAAAGTGTGGCTGCTCGGCATCGGAGGGAACGAATTAGCGACCGGATTCGGGTGCTGCAAAGACTGGTTCCAGGAGGGACGAAGATGGACACGGCTTCCATGCTGGACGAGGCGATATCTTACGTCAAGTACCTGAAGCTCCAAGTCCAGACTCTCGAGTCGTGCGGCAATGCAGGTTTCGACCCACGCATGCCGTATCCGGCTTACTACATGCCGGTGCGCTCTGCTCAAGGGGACTGCTCCACCATGTCTCAAATCTCGCCGGGTGGGGGTTCTGCGGACCTCGGATCTCTCTCGCTCGCTCTCTCGTCACGCGACGGCGAGATCCAGAGTGCTGAACAGTCGGAGCAAGTTTGGCTGCTGCTTATGATGATGATGGAGGAGACGAGGATGGTGACGGTAGTTCCTTTGTAG

CDS

>Mapoly0073s0051.1
ATGGACACCATCCAAGGCATGGACGCTGGGGACTTACTGTTTTCCGCCCCACTGTCATCCGCTCTGGACTCTTCCAAGTTCTGGAGCGGCATCAAAATGGAAAGCCCGTTTCACGGCGACTCGACCACCATGATCAACAACAACGCCAACTCCAACAATGGGTCGTGCGTTGCCAGCTATATTCAAGCGATGGAGGGCCAGGCGAAGTTCCCCGCCAATCAGCCCTTGAAGTACAGTCCCGCAGATGCTCTGGGATTAATGGACATGGATCAGGCCAAATGCGGTTTTTCCACCGTGACCTCCACTCAGCGCAATCAGTTCGTGCGGCCCTTGGACGATGCTATCGAGACCTTCGGCTTGGACGCGGACATGGAGCTCATAAATAGGATGCCATTCGGAAGCTGGAATCAGGCTCGCCTCAGCGGCGAATTGCCGGCTCAGAGCAAGCCCGGCATGTGCCGCTACCCGTCGGAAATTTCCGACGACAGCTCGCTCGACGGGGGTCTCCCGGCCAGCAGCACCGTGAGCTCCACGAGCGATGGGCTCGCCTCGAGAGAAGACCTCGACGACGACGTATACGTCGAGGGCGGCTCCACCAACGCGGAGCTGCCGTCGCTGTCAAATATTACTCTGAACTCCCCGCGTCTGCTCCAGCAGCGCAGCAAGATTGGCATGGCATCGCCCGGCTCCGAAGGCAGCGCCCAATCTGCAGATCAGGCCGGCAGTGACAGCAGAGATTGCTCGCTCAGAGAAATGGAGAACCAGCTCGTTGATCGGACCGTAATGGAGGCGAATGCGGCCGCCGACCTGACCTCGTTACAAAATACGGCGCTGGAAAATCCGGACATTGCAGTGCTCGTGCCGCAGGATGTGAAGGAGAACGAAAGGCCGCCGCCGACATCGGGCATGGATTTGAAGTGGAAGCACGAGGCTCCGGTTCTAGACGTGAGCGAGAATTGGAACAGCAAGAAATTGAAGTCGAGCCCGCCGTCGTCGCCGACCGCCTCGCCAGGTCTCGCAGTCCCGTTTCTGGCCCCGCCTCTCGCCGCGAGCCTGAATGGCATGAATGTGAATCCCTCCAGCGCGCCGTTCCTCATGAGCAGCAACGTCCGCAGCATTTATCAGATGCAGCAGCCGGTTCTCGCAGGGCTGGGGGCGCCGGCCGATTTGACCAAGGTCGCAGGACCCAGCGCCAAGGGCGGGCTCATGGCAAACATGGCTCCGCATCACTTGCTGTTCGGGCCCAATTTTCCTGCCATTGCGAATCTGGACCCTGCCGCCATCGAGAACTCGAGACCCAAACGGCGCAACGTGAAAATCTCCAAGGATCCGCAAAGTGTGGCTGCTCGGCATCGGAGGGAACGAATTAGCGACCGGATTCGGGTGCTGCAAAGACTGGTTCCAGGAGGGACGAAGATGGACACGGCTTCCATGCTGGACGAGGCGATATCTTACGTCAAGTACCTGAAGCTCCAAGTCCAGACTCTCGAGTCGTGCGGCAATGCAGGTTTCGACCCACGCATGCCGTATCCGGCTTACTACATGCCGGTGCGCTCTGCTCAAGGGGACTGCTCCACCATGTCTCAAATCTCGCCGGGTGGGGGTTCTGCGGACCTCGGATCTCTCTCGCTCGCTCTCTCGTCACGCGACGGCGAGATCCAGAGTGCTGAACAGTCGGAGCAAGTTTGGCTGCTGCTTATGATGATGATGGAGGAGACGAGGATGGTGACGGTAGTTCCTTTGTAG

Protein

>Mapoly0073s0051.1
MDTIQGMDAGDLLFSAPLSSALDSSKFWSGIKMESPFHGDSTTMINNNANSNNGSCVASYIQAMEGQAKFPANQPLKYSPADALGLMDMDQAKCGFSTVTSTQRNQFVRPLDDAIETFGLDADMELINRMPFGSWNQARLSGELPAQSKPGMCRYPSEISDDSSLDGGLPASSTVSSTSDGLASREDLDDDVYVEGGSTNAELPSLSNITLNSPRLLQQRSKIGMASPGSEGSAQSADQAGSDSRDCSLREMENQLVDRTVMEANAAADLTSLQNTALENPDIAVLVPQDVKENERPPPTSGMDLKWKHEAPVLDVSENWNSKKLKSSPPSSPTASPGLAVPFLAPPLAASLNGMNVNPSSAPFLMSSNVRSIYQMQQPVLAGLGAPADLTKVAGPSAKGGLMANMAPHHLLFGPNFPAIANLDPAAIENSRPKRRNVKISKDPQSVAARHRRERISDRIRVLQRLVPGGTKMDTASMLDEAISYVKYLKLQVQTLESCGNAGFDPRMPYPAYYMPVRSAQGDCSTMSQISPGGGSADLGSLSLALSSRDGEIQSAEQSEQVWLLLMMMMEETRMVTVVPL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>