Mapoly0074s0026



Description

ZINC FINGER CW-TYPE COILED-COIL DOMAIN PROTEIN 3.

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0008270 Zinc ion binding
OrthoMCL OG5_156549
PFAM PF02362 B3 DNA binding domain
PFAM PF07496 CW-type Zinc Finger
PANTHER PTHR23336 ZINC FINGER CW-TYPE COILED-COIL DOMAIN PROTEIN 3.
PANTHER PTHR23336:SF10

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpB3-5 transcription factor, B3 Mapoly0074s0026.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0074s0026.1 scaffold_74:369713..382679  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0074s0026.1  

Gene structure:

mRNA scaffold_74:369713..382679  ( - strand )
three_prime_UTR scaffold_74:369713..370483  ( - strand )
three_prime_UTR scaffold_74:371081..371237  ( - strand )
CDS scaffold_74:371238..371258  ( - strand )
CDS scaffold_74:371448..372325  ( - strand )
CDS scaffold_74:373940..374013  ( - strand )
CDS scaffold_74:374196..374309  ( - strand )
CDS scaffold_74:374462..374511  ( - strand )
CDS scaffold_74:374629..375039  ( - strand )
CDS scaffold_74:375546..375622  ( - strand )
CDS scaffold_74:376295..376469  ( - strand )
CDS scaffold_74:376752..376848  ( - strand )
CDS scaffold_74:376969..377939  ( - strand )
CDS scaffold_74:378465..378566  ( - strand )
CDS scaffold_74:378834..378915  ( - strand )
CDS scaffold_74:380814..380956  ( - strand )
five_prime_UTR scaffold_74:380957..382679  ( - strand )

Sequences:

Gene

>Mapoly0074s0026.1
GTGAATGCGGGACAGCAGCGCCGGGGCTCGGCTGCGGGCTGCGGGCTGGTGGCTGGTGGCTGGTGGCTGGGGCTGGAGGAGTCGTCCGAATTTGTGTCCTCCCTCTGGCGCAGCAGTGGGGCAGCGAGGGCAGCGGGGGCAGCAGGGGCGATAAAGAGCGTGGGGAGTTCGTTTCGGGAAAAGTACAGAAGTCGGCCTCCGGGTTTTCGGCAGTGGGCGAGCCAGTGAGGAAAGACATGTTATGAGAGAGAGAGAGAGAGAGAGGAGGGAGAGAGAGAGAGCTGAAGAGGTTCGGCGGGAGCGCCAGGCATGGCCATGCATGCACGCCCTGCTACGTGCGCTTGCCATGGCGCGGATCAGTCGCTGTCGATGGGAGATGATGAGCGTCCAGCGTCCGGCGACGGAGGTCCGTCGGTTCGCTCGATGGCGCTCGGTGGTGGCCATGGCATGGGCCGGTCGGTCGGCCAGTCAAGCACGCCGCAGCAGCAGCGGCAGCGGCAGCAGCGGTCTCACTCAATCACTGCTGCTCGTCGTCGCTCAGTAGCTCACTAGTAGCTCACGCACTCGGTCGGGCGGGCAGGCAGGCAGGCAAGCAGGCGGGCGCTCGCTTACTCAGAGCCAGCTTCGAGCTTGTCTGCTAGCAACGCGAGCTCGATCCGCTGGCCCATGCACGAGGAGGGGGAGCGTGCATGAGTCGTTCAGCTCAGCTCGCTTCATTTCTCATCCTCTGCCCCCCGCGGCTGGCCTCGAGTGGGGAAGTATTTCTCCTCGCCCTTCCTTCGCCCTCTCGCAAGCGCCTCTCTGTGCATGGGCCTCTGATACGTGACGATTCACAAATCCCTTCTCGTCCCCGGGCCTATGTGCCCTTTTCCCCTCTCTTCCGTTCCACGCACGGTTCGTGTCGTGGACTAGTTCTTCGGACCCCACGCATCATCCTGTGCAATTTGGGGAATTCTTTTTTCTATGGCTCGGAACAGCGGCCGAGGTTTCCGACCGAGTACGCTTTAGGGGCAGTCGGAAGAACTTGGAGGTGACTCCAAATGTTTTGTCGGCTTGTTTATTCATTTCTGAGCTCATTTACTCCTCCGGACCTCTGTTAGTCGCCTCCCGTCTGCATCACGAGCTCGTAATTGAGCTACATTCATGCCTACACCAGTGACCGCATCCGGTCGACATAAGTGAACTTGACGGCAAGGCGTTTTCTTCGCGATCTCATCCACCAGATTGTGTCAGCCGGCTCGTGATCTACACTGTTAGTGTCAAGCCTCGGCAGCATGGCCGAGTTGAGGTTGATGGTGACGGGAGTCCTTAGATTGGCCCAGCGACCGGTTGCTTGTCAATTCCAGACGAGCACACTGCGGCCGCGCGGTTTCTACTCAGCATGCTTGTGATTTTCTCTCCGGAGTGAGGTCTTAGGGTTATCACACGGGTCACAACATCGACCTTCTCTTCAATCCAGACGTCAGGCAGGCGTTAAGATTTAGGTCGGCAGGGGCTGATGAGCACACCGTATCAACCGATCAAGGACTTGCAGATCTGAGCAGCTTACAGCCATTTGTAGCTCTCACAGGCTGAATTTCAAGCGAAGACCATAGGCTGGGAAGAGCAGGAGATCTTCGTGTGTGATGGAATGGATTTTTATAGCTTGAGCGGAGGATGGATCTTGGATGAATTACTGATGAATACTAATGACTGGTGAGCGGTTTACTCGTCGTTTTTGAAAATGGATACTCGCATGGAGCGGGCCGGACCCGTTCCGCGAAAGGTCTGCATGAATGTCAAATGTGGTACAAGTAGCTCCAACAGTTGGAAACCGGGCTGGCAGCTGCGCTCGGGTCGAGCTTGCGAACTATGTGAACCATGCGGGTACGAACTTTATTTTGTACCTCCTCTTCTTTCTGTTTTCCGATTGGCTCTCAATGATAGAATCGGATCCTTCTAATCACGAATTCATTTCTGCCATCTAAAATTATATGCTCACACTCAGTTCTTTGTAGTAGTCAGTTGTTGTGAAGGGATCTTGTGAATTCAACTCCACATAAACTACTTACGTATGGAATAAGGTAATGAGCGAGTTGATCGAACTTCAATTTACTTCCCCTCCGTGAATTAATATTCAGACGTCATCCTTAAAGTTTATTTTGGCCAAGTATATTTTCAATTACGAGTGGCGGCCACAGACGGCAATGAAGGCAGACTGAATCCCCCCTTTAAACGGGCGATATTCATCTTCACTTCAACTAGAATGACTTAAGCACCAACTCATCAAGTACCGGGTGTTGTTAACTGATATATGAACGACTTTCTATAGAAGCATCAAATGGTTTTTTTTGGTGTGTGTAGAACCACCTCGTCTGAAGGTCACTACTTATGCTTACTACAGTTGACATGCTTTGCTACAAAATTCGCTTCACATCTGACCCGCCCTTTTTCCCTTTTAGAGAGAAAAGGTTTATGACAGATATTCCTGTCCCCGTTGTATGACTTCGAGACAAACTGAAAATCATGTTTCTCGTTAGTTTCACTCGTATTTAGATTATTCTGCTTCTGGAAAAGTCGCAGTTGCCAGAGTGCAGGTTGTATCCATGAACTTGCGCTTTTAGGGAGGACAGTTGATGCAGTGCCGAATGAACCAAGTTTAGTAGAATTGTAGCGTCGTGTGATGTCGATGAAGGTTCGTGGAGTAGTGTCAAGAATCCAGACTTTATTGCTCACCTTGTACAGATGATGGTTATACCGTATGATATGTCATCTGCATGTAATTGAGGTGTCGCCCTTGCTATGCAATCTTCATCAACCAATAATGGATGCTATGTCTGTCCAAATTTTTAATCAAAGACTTAAAGATAATGCTTCACACAGAGTAACACACACACTACAAAATCCCTGATTTGTGACCTCAATCACTACTTCTTTTTACGGCAAGTCATGTTTTTAATTCCACGAGGGTGTTTTATCACAGTTGGCTGATTTGGAAGTAGTCTCTCCTGCGTTTTGGCATCTTCCTGTGTTATATGTGGCTTCTTTTCTCTTCTTTGTCTTGGGAGTTCTCTGTGCCGCTTTCTTTGCGAAGGTATTTACGTTCTGCGGTAGTGGCCCCAGTTCCCCTACTACTCGAAGTAGTTGTATCGTCTATCACTTCGAATTTGCCTGGAGACCATCTTTTACTGTAGTAGTCTACTACTGAACGCATCTTCTCGGTTACAACATAGATTGAGCTGTGGATGTCAACCCACATTACCAGCCAGTATATGTATGATACGTTAGGTTCATGCAGTTACTGTAAAGAGGTGATTTTTGCTATGTTTATTCAGTTACTTTTGGAAACGTGACAGTAGGTAGGGCTGTAATTTGGTTAGCAGTAAATTAGGGATATGTTAAACTCTTGTATCGGGTCTCGCATTGCATATTGGCTTCTCTGTTGCGGTTTGTGATCCTCATCCTCACATTCCGCATCCCACATGATTCTGTATGGAACTTTCCGGCCCGTTCTCTCATTGTGTTTCAATGAAGTTCTCAGTACATCGACAACTCTGGATGGAATGAAACATTGTGTTAACTCTCTCGTTCCGGGTAATTTCGTGTCAAGAAGTTTTTATTTGCTCTTTTCAATTCTATGTTCTCAAAACACAGATAGCAACGCAACGGTTCTTCAATCTACCTTTTTCATATACCACTCAAACCAACTTCATCCCCTTAGTATAGGTAGTCTATGAATTCTTTTCTCACGCGTTTCCATTTCCTTCTTTCCTTTTTTACCGCAGGTCTGTGTTCGACCAAGGGCGTTTTTGCGAGACTTTTCACTCCGATGATGCAGGTTGGAGAACATGCAATGCTTGCAAGAAGGTGGGGCACCCTATATTGATATTAGTTTTTCTGGTGTCTCTTGTTGTAGAGTTGACAACAGAGTTGACAGTTGACAACAGAGTTGTTGCCTGAGTTCGGAACGGTCCATACTATTCCAAGTTTGAACACATGATTAAATAATCAAGAAGCGAAACAGTCTTGTGACATCTGACATCTCACCAGGTCTCTGACCGTCTTGTGTGTTTTACAGCAATTTTTAAGTCCTAAGCGTTATTCTGACATAACCTGGCTTGCTCCGTTGTGCAGCGTGTACATTGTGGATGCATCGCCTCGTTGTACTCATTTGTTCTCCTGGATGCTGGTGGGGTGGAGTGCTTTTCTTGTGCTACCAAAACTGCACCTGCATTGGTATGTACAATATGCTCCAATACACCTCAAACCGAAAGAAACTTCAAGGTTGCATTTTTTTGAACCTTGGCTTCTTGGTGGTAGTCGTCGACCTCATTGAAGAGGTCGGAAGCCCTTTGAAGAATTAGCTACGAGAATATCTACAATATGGCCATAATATCGGGAAATGAAGGCTCTGACTTAATGGGGGTTACTTGTGTGAGAATAGGCACGATGAATGTACAGGTGAAAGTTTTATGGACTTATCTTATGCTTCCACTCTGTCCAGATCGCTCACTTATTTGCGTCAATTAGCTAATACTTAAGTCTAAGTTTAAGTTTGAAAATCAAAACCTGTTCATATAGCACAAACTTTTCTCACATCCAAGTCAAAGGTTAATGTACACTTTTGGCAAGAAAATTTGTTACCACGAGATGATTTTATTACAGGTTGTATACTGATGCTATCGTGGGTGCCAGCATGGATCAGATCTCTAATGTTTGACTTTTATTGATATTTTGCACTTTCTTGCCACCGTCCAACAGCCCTTGAAGCATTTACAGCACTCAGTAGTTCCTCCTGCCCCACAGCCTCAAAGAGTGGATCCTCTAGCTGCTAGAGGCTGGAGTGAAACCTTTGGAGCCAGAGCAGCAAGGAACATTGAAGTGGGGACGACCTGGCAGCCTTATTCTTCAGCTTGGTACCCCCCAAACACTGCGGGATTTCCGATAGTGAGACTTCAGGCTGAACTTGATCGACCTGTCGAAGGAAGCCATGCCGAGCCAACTCTTAAAGGGTTGGTAATCAGAAATGAAGACGCTTACCCGGAAAGCAAATTTCCGCCCACAAAGGATTCCTCTGCGTCTGCCGAGCATCCACGGGGAGACTCACCTGATGGAGAGCTACACGCGGTGGAGAGTAGCCCAACATGCTTCTCTAGAGATCCGGGTGCTGTCGGACCAGATAATGTACAAGGTGATTGTGATGGAGAGTCATTGCGAGTTGGTGTTGCGACGTCAATTGGTTTGGAGAATATAATCGGAAGTTCCGGTAAAGTTGGTGTTGATGTGACTCGAGTAATTACGGGAAAGAGTTTGTTTCCGACTCAGGACCTACTTAATGCTGGACCTTCCACAGGATTAAGCATGTCTATCGGAACATCTGCCAGGAAGGAAGGTGCGGGCGAGGGAAGCCAACAAGGAGGTATATTGGGACCAGCTGGTGCGCTTACTACGCCAGCTGGTGCTGGATCGTCTGGTGTAAGTGCGGAGTCAAGGGATCTGGCCTCTAAATTTACCGGATTGAGTCCATATCGTTCCCGACACAGACAACTTCTACCTCGACCATACCATGCAGGGACAGCTTCTCCGAATTCTAATGCTGAAGTGAAAAGCAACGAAGCCGGATCAGTGCGAGTTGCTCGCCCACCAGGTCAAGGAAGGGGCCGCAACCAGTTGCTACCTCGGTACTGGCCGCGTATAACCGACCAAGAGCTTCAGCAGATAACTTCGGGAGAGTATCCTTTTAACAAAATTCTTTCCAAAGAAACAATTACAGGTTGTGATTCACCAGTTTACTTTCGACTATGTTAGTTCGCTTTACTTCTCTCTTCTCGTTAGTCTTAACCTGTTGTCAGTTCAAACGCGACCATCACACCCTTGTTCGAGAAGATGCTGAGTGCAAGTGATGCTGGTCGTATCGGGAGGCTGGTCCTTCCAAAAGCTTGTGCAGAGGTACAATACTAACGCGCGTTGAGAGTGCATATATCTTATCTCTGAGCCAATATATTGCGACAATTTTGGAAGAGCTGTTTTCTTTTTAGGCCATGGATCAGCCTATGACAGGCAAATATCATTGATTACGATATTTCTTATATTCAGTGATTGTTAGCCTTGTACTTGTCTGCAGTATGTTACTTGGGGGAGACATAAATATTTATGATGATTGATCTTCGTACATTCTATGTGCTTGCTCGGAAGAGAAACTGATAAGTTTTCCGGTTTCATGTCGTCCAGGCTTACTTTCCTGCAATCTCACAACCAGAAGGTCTGCCTATGAAAATTCAAGACATTACAGGAAAGGAGTGGCTATTTCAGTTCCGTTTCTGGCCCAATAACAACAGCAGGATGTATGTCTTGGAAGGTGTCACCCCCTGCATACAATCAATGCAGCTGCTCGCGGGCGATACTGGTAAACACTCTCTTGCACGGAATGCTACTTTCCAGGCTTTTTTCCACATCAGGGATTATTTAGATTGGACTGATGCGGGCTAGGTGATGAGGTTACATGTCTCTTCTGTAATATAAGGATTTACCGATTATTTCTACAGACGTCCCCGTCGCTAGCGAAAAGTATCTATCTTGGAATTGGGGGTAGTCCTGCGGCGTTTTGACCTCGAAAGTCATTATCTGTGGATGATTGATTCTGATGTTTCATATTTAAAAACTACGGAGTCATAATCATTGTTTTCTAACTACGTGGTTGAGAAGAACACGTTTAACTTTGGCTACCTTTTGGCTACCAATTTTAATTATCACTGAGATCTGTGAACTGCCATTGGGCATCTCCTTAGACTCTGCATCTTCCTAGATTTTCGTTTCAGGTCAAACATTTCCACGGGCCTACATATTTAGTGAACCATTAGTTTTCTGCATTATCACGTCATAAATTATAAATGCATCCTTGTTGCCTGGTATCCATATGGATAAATTCATCAAAATTTTGTCTCTTTTGAGCTGATTCTTAATGCCTGATTTGATCAATAATAAATGAAATCAAGCGCGACTCTGGATCTAGAGAAGTGGGAATCTTGAAGGAGGAGCGATCTTATTTAGTCAGTTGTGGCTTTGATGTCTTATGCAGTCACGTTCAGTAGACTAGATCCAGAAGGAAAACTTGTCATGGGTTATCGACGAGCTCCAGCTTTGCTTACTTCTCAGGTCTGAATCAGCTTTTATTTTATGCTAGCTCTTTTTTTCCATTTTGTGCATGTGAATTATTTAAAAGTTAGAGATGATGTATTGTGTAGTGCTATCTTCATGTTACGGCTGAATTTTTGTTTTGGAGGCAGATTAGGTTTCCGTATTCCTTCTTTTGATGTTATTATTCTATACCGGCAATTGCAGCTTACATTGAAAAACAAGCGCGAATGCGTTAAGTTTTTGTTGCTAAACAGTATCTGGCTTAATAATGAACATTTTATCGAATGGAAGAAAATAAGGCATCTTGGAACGTTAGTTAGAAACCTTTTTTGTCAGATTTCTAACTTTGTCTTGTATTTATCAAATTTAAGAATCATAACATCTGGAATTCTATTCTGTCAGTTTCATGCATGCAGCATCTGACTTCTTTTTGTATACAAGCCTTGTAAGTCACTTGATTTCTCCAGGTGGTTACTGTATGAGTAGAATTTTGATGGTAGGAAGAGCTGGCTTGTGTGCTTCAGGATCCTAAGACGGCCACGAGGGGCACCTCCGCTAATGTGTCTAAGGGTTTAAGTTGTGGAAGTATTGACGGCCTTTATGCCAGTACTGGAGCATCGTTGCTTTCTGTCAGTGCAAACGCAGAAGCACGAAATAAGTCAGGCCAGAGCGATGTGTCAGACTCAGGGTATGGATGGTCTAAAGCTGAGAAAGGCATGGGAAAGGAAGGCTCAATGCTCGAAGCCTTGTCGCAGGTGGATAGAAAGCAGCGAGGGCGTCCTCTTGGTGGGAAGAGTAAGAGGCTTCGCTTAGAAAATGAAGACTCTTTAGAACTGAAGAACAGTTGGGAAGAAGCTCAAGAATTACTGAGACCACCCCCATCTGTGGTGCCAAGTATTGTGACCATTGAGGGTCATGAGTTTGAAGAATATGAGGTAAAGAAGGTTTCTATTGTGATTTATCATATGGCTCTTAAAACATTTGGTAATTTTCTTTCCCTTTTTGAAATCTGGAACTGTGACATTAATCTTATAAACAATTGGTTTTCGCAGGAACCACCAATTTTTACCAAGCGGACAATCTTCACCTCAAGACAGTCTGGGTAAGCCCTGCATACATATGTCATTTCTTTAAAATTTGATCAACTTTCCTGAATCTAATCATGTTTCCTCTTGCCTCATTTCCTCTTCCTAGGGCTCGCTATCTGTTCTTGTCGATTGAGGAATGTGAGGGTGCTCCTTGCAAGTGATGCAGGGAACAGGACCAGTGGGCCCAGTGTGACGAGTGTGGTAGCTGGAGAAGAGTCCCCCCAGAGGTCCTAGTAACAGCGAGATGGACTTGTACTGATAATACTTGGGATCATAAAAGGTATATCAGGACTTCCTGCCCTCCTTGATGTGTTGTTTTCTCTTTGAGAGTTCGTGTATATTTAGAAGGGTTTGTCGTTTTGTTGTTCATATAGCTCCCCACCTCTTTCATGTGTTCATTTTATGTTTTACGTAACTGGATCTTTTGTTGCTTGGACTTATTGGGTTGTGGTCTCTCAACAGGGCGATGTGCAGTGCACCCCAGGAGCTGAGCAATGATGATGTTGATCACCTTTTGGGGCTTATTCCGGGGGAAGGCAGGTTTCTGAAATTGTACCGCCGCTTTTTTGTTGGTCATACCAATTCATAGTTGCTGTTATAGGAGTTGGAACCAGTAGGCATAGTACTTTAACTTGACGGGAAATTCATATGAGCATTCATATGATCATTTTAAGGCTTACATTGTTAACAGCTCTGTCAGGTGAACGTTTGTGAACATGTGTTCTTTAAATTTGTTGTTTTTATCCTCCTGTGTGGTTTAGGACCTGTGTAAAGAGCCCATTTTTTTCAACTAGGAGTGTGGTGTGGGGATTTTCCGGCTATTGTCGCCGATTTTGGGTTGAGGTTGTAAGCGTTCTGTGATCAGTTTGGTTTGATTTTGAAAGTCATTGTAAAATAGACCATTTGCTTCGTGTCCAGAATCTGTAGTTTGAGATAATACTAGTATATGTATTGACCCTGGGAACTTTATGTATAATTTACTGAAGCTTTATAATTATGGAGCGGCTTGTTATCCCTCAGTTTAGGCTAATTATCTCTCACCCTACTATACTAGGGTGAAGGATAATTAGCCAAGTAACCCAAGTGGTTGGACGAGTTTTCGATCGGGCCCTTGGCCGGTGACAAAAGCCTGAACGAAGAATCCGAACATGGAGAACATTTCGAGCCTTCCGTTCTTCAACTCCTTCACCTTCAGCTCGGCGAAGGTGTCGGGGTCCTCAGCCAAGTTCAGGGGGTCGAATTGACCTCCGGGGTAGATCGGGTCGCTCACCTTTCCCACTCTGTATATCTCGATGGCTCCCATGAGCACGACCTGGCAGGCCCAGATGGCCAGAATGCTCTGCGCACGGACGAGGCCAGAGTTGCCGAGGTAGTCCAGACCTCCCTCGGAGAAGATCTGCGATCCGGCCTTGAACCAGACTGCCTCGCCGAACTTCACTCCGTTTTTGGCCAGCAACTCGGGGGTCACACTTCCCAAAGCTCCCAACATGGCCCATAGGGCGTGGATCAACTCCAGCTCCCGGTTCTTGGCGAAGGTCTCGGGGTCGGCAGAGAGTCCGGCGGTGTCCCAACCGTAGTCAAGTCACCGGGGAACTCACCGGTCAAGTACGATGGGGTGGCACCGGAGAAGTGGCCCAAGTACAGACTTGGTTCGGTCCGGAAGGGCCCGATCGAGAACTTGTCCGACCACTTGGGTGACTTGGTTAATTATCCCTCACCCTAGTATAGTAGGGTGAGAGATAATTAGCCTAAACTGAGGGATAACTAGCCGCTCCCTATAATTAATGCCTTCTATATAACACTAGCATTTCGTTCTTTGTCTCCATGCTTCTTTCCATCCATAATCCATTGTCGTCCTTGAGACTTAGATATGCTTTGGGGCCTTGCATGTAAACTCCTGCGGTTGATCCTTTACTGTTTTATCTATCTCACACTGGCCTATTCTGATTTTCAGCTCGTGTTTTTCCGGAAGCAACTGGTTGTCTGACTGACTAGGATTGTAGACTTCAATAGCATTCTTGATCCTTTGAATCACGTCAGAACGTGTGTTTATCTCATGAGCTTATATCCTCTTTCTAAGTGCTCGTCCTACTAGCTGCTGTGGTGCAAATTTATTCAATGTTCGGTTTTGTTGTTTTCGTTCTGTACAGAATTTGCGATTCCAGAAAAGAACGATACTAAAGCGGTAGGTTCTGGGCCTATGGTGGTGGAGACTTCAGCTGGTTTGGATGCTTTGGCGATTGCAGCAGCTATGGGGGAAACTGGTAGAGTTTCAACCTCACCATCGTCTCCTGCACGAACCACTAAGCATCCGCGGCACCGGCCTGGCTGTACTTGTATTGTTTGCATACAACCACCAAGTGGGAAAGGTCCTAAACACAAACAGAACTGCCTGTGCAATGTTTGTGTCACCGTTAAAAGACGGTTCAAAACTTTAATGCTGCGTCGCAAAAAGCGGCTGTCTGAGCGTGAAGCAGAAGGTTACGTAAGGAGGAAACGCAAAGATGATGTCGAGGTCAGCAGCAGTTCGAAACTGGTCACTGATGCTGGTTCGTTAGCGGATGGTGGCTCTAGGCATGAAAGTTCGGGTGGTGGAACCGTTGTGGAGGGACCAAGAAGAGACGATGCCTTGGTTGCAGATATTAGCAACAGTTCAGGCTTAACAGCATTTGGATTATCCTTCCCGAGCACAAACGCAGGGGAAGATGCTCTTGTGAGCAAAGGACAAATTGATCTTAATAGCCAGCCAGAGCGGGAGGAGGAACCTACGAAACTGGGTAGAGTAAGCATGAAACAGCTGTTACAGGATGCAAGTCAGCCTCTTGATACATATTTGAAGCAGCAAGGAATGACCAGTCTTTTCGGTAGTCAGGCAGCCGAGACTTCAGGTGCAGTAGGACACTGCGGAGGCAATAGTGAGAAGAAGAGTGATGAGCAGAGTAGCAGCCAGTGTCAAGATCACTCGAATGAAGAAGCTTCTCAGACTTCCGCCAGGATTCAAGGAGACAGTGCTGGTATCCCTAATCAGGCAGGTGCTCAAACCCAAGCTCGAATGCAAGGTTTATGCAGTTGGATCTAGCTGACTCACAACAATCCTCCCTTTACTGCAAGTTTAAGACAGCAGATATTATGATGTCTCGTGGACCTTTGCCTGGCCCCGCTTCCAGGGCCCTGGTGAACTCCATGAATTGAGACTAAGGGCCAACTTGACGTGCAGGTCTCCAATCAAATATCATGAGTATTCTGGTGACTCTATACATTCCAGTACATCTAAAGAAGACCCCTTGTTAGCTGAGCTTGGTGCAACAGCACCTGCAAAGATGTTTGCCACGGGTTCTGGAAGAGGACGGCAGATCTGCAGTGGCTGTCATCAGCCTATTGGTTGAGCTGCTAAGGTTTTTTCTTTAACCCACGTATAAACTATACGATGTGATGCTGTTGTTCCTTTTTGATGATTGGGTTGAGTTCTTGGTCGATGGTTCATCCTTAATCTGTGACTGCTTACTCAGCACCTTAGATTCCTAGGTGGGTTTGGTGATCTAAAGCTGCAGTGGTGCCGCTCGCCTCTTTAGCTGGATTTTGGTAATGCAAGAGGATAACCCTGGTTTGTAGCTGAGAGGTTAAAAGGTTATCTTCACTGGTTTATTGGGGGAGTCTACGTATTCATGCCGTTGTGCATGTAATACGCTGAGAACTCAAGCAAACTCATCTAGTCATCTGTTTAAATCTATCCGCACTAATGGGAAGGCGAAACCGATGGCGATTGTATAATATAGATACGTTCAAGCCAAACTTTTGTACTTCAATAGAAGTCGTACATCAAGTTGTACATCCTTCAGATCTTGCTTTCTTAAAATATCAAATAAGTGATTTTAGGAAGTACGCAGAGTTGAAGTACGTATAATAGAGCCATTTTTTTCTACGTCCGAATGACACTTCGGTACCGTTTTTGAAATATTCTGAGGATTAAGTCTTAGCTCTCTATGACCCAGGTTTGCAGGCGCTGTGGAACACGCATCACCTTGGGTAAGAAGAGAATATCAAGGGGCCTACCCTCCACAGAAGTCTGAATAAGTGCTCATGACTACCTCCTGATGGGATGCCGACGAAAGGAGGAAAGGGTTGATGCTGAAGAACTCTCCGCTGTTGTAACAGGTTTCTGGAGAGGTTTGCTTTGTTGATGGAGTTTCTCCTCCCGACGTGTTCTAGAATTCATCTTGGTCTTCAAGATATCTGTAATGATTGTATTTGTATTGTGGGTTACTCACTTGTTCCCTTCACAACTCGGGTAGTTTTATTATTGAAGAAGCTGGAAAGTCAACTATCAATGTTGTAGGAAGAGATTAGGTCGACGAACACGAGTCCGTCATGTAGATGATAAATTGACTTAGGAATTCTAATTGTGACTACTGTAATTAATTTTGTAGCCTACATTGGTCATCAGATCTTCATTGTCAAGCTTTTGCCTGGTACCTATTTTTTAAAATATATTGTTACTCATTCTTGAGGAGCCCTTTGAAGCTCTTCCATCGTTCACTTCAACTGCTAAGGCTTCACCGAAATTTATAGATCAAGCGTTTTGAAGCTCACATGTGTCTTTGAACGTGATAGTTTGATGTGCTTTTTAGCTCGCGCGGATATATCTTTCGTTGAGTAGTTGTTGGCGAATAGGAAACGATGTAAGTTGGCTCGAATCATGGTCAGGAATAGCTGCACTGATTTTTGAGAAAATCATTCACTACCTGTCAATTGAATATGACTTT

mRNA

>Mapoly0074s0026.1
GTGAATGCGGGACAGCAGCGCCGGGGCTCGGCTGCGGGCTGCGGGCTGGTGGCTGGTGGCTGGTGGCTGGGGCTGGAGGAGTCGTCCGAATTTGTGTCCTCCCTCTGGCGCAGCAGTGGGGCAGCGAGGGCAGCGGGGGCAGCAGGGGCGATAAAGAGCGTGGGGAGTTCGTTTCGGGAAAAGTACAGAAGTCGGCCTCCGGGTTTTCGGCAGTGGGCGAGCCAGTGAGGAAAGACATGTTATGAGAGAGAGAGAGAGAGAGAGGAGGGAGAGAGAGAGAGCTGAAGAGGTTCGGCGGGAGCGCCAGGCATGGCCATGCATGCACGCCCTGCTACGTGCGCTTGCCATGGCGCGGATCAGTCGCTGTCGATGGGAGATGATGAGCGTCCAGCGTCCGGCGACGGAGGTCCGTCGGTTCGCTCGATGGCGCTCGGTGGTGGCCATGGCATGGGCCGGTCGGTCGGCCAGTCAAGCACGCCGCAGCAGCAGCGGCAGCGGCAGCAGCGGTCTCACTCAATCACTGCTGCTCGTCGTCGCTCAGTAGCTCACTAGTAGCTCACGCACTCGGTCGGGCGGGCAGGCAGGCAGGCAAGCAGGCGGGCGCTCGCTTACTCAGAGCCAGCTTCGAGCTTGTCTGCTAGCAACGCGAGCTCGATCCGCTGGCCCATGCACGAGGAGGGGGAGCGTGCATGAGTCGTTCAGCTCAGCTCGCTTCATTTCTCATCCTCTGCCCCCCGCGGCTGGCCTCGAGTGGGGAAGTATTTCTCCTCGCCCTTCCTTCGCCCTCTCGCAAGCGCCTCTCTGTGCATGGGCCTCTGATACGTGACGATTCACAAATCCCTTCTCGTCCCCGGGCCTATGTGCCCTTTTCCCCTCTCTTCCGTTCCACGCACGGTTCGTGTCGTGGACTAGTTCTTCGGACCCCACGCATCATCCTGTGCAATTTGGGGAATTCTTTTTTCTATGGCTCGGAACAGCGGCCGAGGTTTCCGACCGAGTACGCTTTAGGGGCAGTCGGAAGAACTTGGAGGTGACTCCAAATGTTTTGTCGGCTTGTTTATTCATTTCTGAGCTCATTTACTCCTCCGGACCTCTGTTAGTCGCCTCCCGTCTGCATCACGAGCTCGTAATTGAGCTACATTCATGCCTACACCAGTGACCGCATCCGGTCGACATAAGTGAACTTGACGGCAAGGCGTTTTCTTCGCGATCTCATCCACCAGATTGTGTCAGCCGGCTCGTGATCTACACTGTTAGTGTCAAGCCTCGGCAGCATGGCCGAGTTGAGGTTGATGGTGACGGGAGTCCTTAGATTGGCCCAGCGACCGGTTGCTTGTCAATTCCAGACGAGCACACTGCGGCCGCGCGGTTTCTACTCAGCATGCTTGTGATTTTCTCTCCGGAGTGAGGTCTTAGGGTTATCACACGGGTCACAACATCGACCTTCTCTTCAATCCAGACGTCAGGCAGGCGTTAAGATTTAGGTCGGCAGGGGCTGATGAGCACACCGTATCAACCGATCAAGGACTTGCAGATCTGAGCAGCTTACAGCCATTTGTAGCTCTCACAGGCTGAATTTCAAGCGAAGACCATAGGCTGGGAAGAGCAGGAGATCTTCGTGTGTGATGGAATGGATTTTTATAGCTTGAGCGGAGGATGGATCTTGGATGAATTACTGATGAATACTAATGACTGGTGAGCGGTTTACTCGTCGTTTTTGAAAATGGATACTCGCATGGAGCGGGCCGGACCCGTTCCGCGAAAGGTCTGCATGAATGTCAAATGTGGTACAAGTAGCTCCAACAGTTGGAAACCGGGCTGGCAGCTGCGCTCGGGTCGAGCTTGCGAACTATGTGAACCATGCGGGTCTGTGTTCGACCAAGGGCGTTTTTGCGAGACTTTTCACTCCGATGATGCAGGTTGGAGAACATGCAATGCTTGCAAGAAGCGTGTACATTGTGGATGCATCGCCTCGTTGTACTCATTTGTTCTCCTGGATGCTGGTGGGGTGGAGTGCTTTTCTTGTGCTACCAAAACTGCACCTGCATTGCCCTTGAAGCATTTACAGCACTCAGTAGTTCCTCCTGCCCCACAGCCTCAAAGAGTGGATCCTCTAGCTGCTAGAGGCTGGAGTGAAACCTTTGGAGCCAGAGCAGCAAGGAACATTGAAGTGGGGACGACCTGGCAGCCTTATTCTTCAGCTTGGTACCCCCCAAACACTGCGGGATTTCCGATAGTGAGACTTCAGGCTGAACTTGATCGACCTGTCGAAGGAAGCCATGCCGAGCCAACTCTTAAAGGGTTGGTAATCAGAAATGAAGACGCTTACCCGGAAAGCAAATTTCCGCCCACAAAGGATTCCTCTGCGTCTGCCGAGCATCCACGGGGAGACTCACCTGATGGAGAGCTACACGCGGTGGAGAGTAGCCCAACATGCTTCTCTAGAGATCCGGGTGCTGTCGGACCAGATAATGTACAAGGTGATTGTGATGGAGAGTCATTGCGAGTTGGTGTTGCGACGTCAATTGGTTTGGAGAATATAATCGGAAGTTCCGGTAAAGTTGGTGTTGATGTGACTCGAGTAATTACGGGAAAGAGTTTGTTTCCGACTCAGGACCTACTTAATGCTGGACCTTCCACAGGATTAAGCATGTCTATCGGAACATCTGCCAGGAAGGAAGGTGCGGGCGAGGGAAGCCAACAAGGAGGTATATTGGGACCAGCTGGTGCGCTTACTACGCCAGCTGGTGCTGGATCGTCTGGTGTAAGTGCGGAGTCAAGGGATCTGGCCTCTAAATTTACCGGATTGAGTCCATATCGTTCCCGACACAGACAACTTCTACCTCGACCATACCATGCAGGGACAGCTTCTCCGAATTCTAATGCTGAAGTGAAAAGCAACGAAGCCGGATCAGTGCGAGTTGCTCGCCCACCAGGTCAAGGAAGGGGCCGCAACCAGTTGCTACCTCGGTACTGGCCGCGTATAACCGACCAAGAGCTTCAGCAGATAACTTCGGGAGATTCAAACGCGACCATCACACCCTTGTTCGAGAAGATGCTGAGTGCAAGTGATGCTGGTCGTATCGGGAGGCTGGTCCTTCCAAAAGCTTGTGCAGAGGCTTACTTTCCTGCAATCTCACAACCAGAAGGTCTGCCTATGAAAATTCAAGACATTACAGGAAAGGAGTGGCTATTTCAGTTCCGTTTCTGGCCCAATAACAACAGCAGGATGTATGTCTTGGAAGGTGTCACCCCCTGCATACAATCAATGCAGCTGCTCGCGGGCGATACTGTCACGTTCAGTAGACTAGATCCAGAAGGAAAACTTGTCATGGGTTATCGACGAGCTCCAGCTTTGCTTACTTCTCAGGATCCTAAGACGGCCACGAGGGGCACCTCCGCTAATGTGTCTAAGGGTTTAAGTTGTGGAAGTATTGACGGCCTTTATGCCAGTACTGGAGCATCGTTGCTTTCTGTCAGTGCAAACGCAGAAGCACGAAATAAGTCAGGCCAGAGCGATGTGTCAGACTCAGGGTATGGATGGTCTAAAGCTGAGAAAGGCATGGGAAAGGAAGGCTCAATGCTCGAAGCCTTGTCGCAGGTGGATAGAAAGCAGCGAGGGCGTCCTCTTGGTGGGAAGAGTAAGAGGCTTCGCTTAGAAAATGAAGACTCTTTAGAACTGAAGAACAGTTGGGAAGAAGCTCAAGAATTACTGAGACCACCCCCATCTGTGGTGCCAAGTATTGTGACCATTGAGGGTCATGAGTTTGAAGAATATGAGGAACCACCAATTTTTACCAAGCGGACAATCTTCACCTCAAGACAGTCTGGGGAACAGGACCAGTGGGCCCAGTGTGACGAGTGTGGTAGCTGGAGAAGAGTCCCCCCAGAGGTCCTAGTAACAGCGAGATGGACTTGTACTGATAATACTTGGGATCATAAAAGGGCGATGTGCAGTGCACCCCAGGAGCTGAGCAATGATGATGTTGATCACCTTTTGGGGCTTATTCCGGGGGAAGAATTTGCGATTCCAGAAAAGAACGATACTAAAGCGGTAGGTTCTGGGCCTATGGTGGTGGAGACTTCAGCTGGTTTGGATGCTTTGGCGATTGCAGCAGCTATGGGGGAAACTGGTAGAGTTTCAACCTCACCATCGTCTCCTGCACGAACCACTAAGCATCCGCGGCACCGGCCTGGCTGTACTTGTATTGTTTGCATACAACCACCAAGTGGGAAAGGTCCTAAACACAAACAGAACTGCCTGTGCAATGTTTGTGTCACCGTTAAAAGACGGTTCAAAACTTTAATGCTGCGTCGCAAAAAGCGGCTGTCTGAGCGTGAAGCAGAAGGTTACGTAAGGAGGAAACGCAAAGATGATGTCGAGGTCAGCAGCAGTTCGAAACTGGTCACTGATGCTGGTTCGTTAGCGGATGGTGGCTCTAGGCATGAAAGTTCGGGTGGTGGAACCGTTGTGGAGGGACCAAGAAGAGACGATGCCTTGGTTGCAGATATTAGCAACAGTTCAGGCTTAACAGCATTTGGATTATCCTTCCCGAGCACAAACGCAGGGGAAGATGCTCTTGTGAGCAAAGGACAAATTGATCTTAATAGCCAGCCAGAGCGGGAGGAGGAACCTACGAAACTGGGTAGAGTAAGCATGAAACAGCTGTTACAGGATGCAAGTCAGCCTCTTGATACATATTTGAAGCAGCAAGGAATGACCAGTCTTTTCGGTAGTCAGGCAGCCGAGACTTCAGGTGCAGTAGGACACTGCGGAGGCAATAGTGAGAAGAAGAGTGATGAGCAGAGTAGCAGCCAGTGTCAAGATCACTCGAATGAAGAAGCTTCTCAGACTTCCGCCAGGATTCAAGGAGACAGTGCTGGTATCCCTAATCAGGTCTCCAATCAAATATCATGAGTATTCTGGTGACTCTATACATTCCAGTACATCTAAAGAAGACCCCTTGTTAGCTGAGCTTGGTGCAACAGCACCTGCAAAGATGTTTGCCACGGGTTCTGGAAGAGGACGGCAGATCTGCAGTGGCTGTCATCAGCCTATTGGTTGAGCTGCTAAGGTTTGCAGGCGCTGTGGAACACGCATCACCTTGGGTAAGAAGAGAATATCAAGGGGCCTACCCTCCACAGAAGTCTGAATAAGTGCTCATGACTACCTCCTGATGGGATGCCGACGAAAGGAGGAAAGGGTTGATGCTGAAGAACTCTCCGCTGTTGTAACAGGTTTCTGGAGAGGTTTGCTTTGTTGATGGAGTTTCTCCTCCCGACGTGTTCTAGAATTCATCTTGGTCTTCAAGATATCTGTAATGATTGTATTTGTATTGTGGGTTACTCACTTGTTCCCTTCACAACTCGGGTAGTTTTATTATTGAAGAAGCTGGAAAGTCAACTATCAATGTTGTAGGAAGAGATTAGGTCGACGAACACGAGTCCGTCATGTAGATGATAAATTGACTTAGGAATTCTAATTGTGACTACTGTAATTAATTTTGTAGCCTACATTGGTCATCAGATCTTCATTGTCAAGCTTTTGCCTGGTACCTATTTTTTAAAATATATTGTTACTCATTCTTGAGGAGCCCTTTGAAGCTCTTCCATCGTTCACTTCAACTGCTAAGGCTTCACCGAAATTTATAGATCAAGCGTTTTGAAGCTCACATGTGTCTTTGAACGTGATAGTTTGATGTGCTTTTTAGCTCGCGCGGATATATCTTTCGTTGAGTAGTTGTTGGCGAATAGGAAACGATGTAAGTTGGCTCGAATCATGGTCAGGAATAGCTGCACTGATTTTTGAGAAAATCATTCACTACCTGTCAATTGAATATGACTTT

CDS

>Mapoly0074s0026.1
ATGGATACTCGCATGGAGCGGGCCGGACCCGTTCCGCGAAAGGTCTGCATGAATGTCAAATGTGGTACAAGTAGCTCCAACAGTTGGAAACCGGGCTGGCAGCTGCGCTCGGGTCGAGCTTGCGAACTATGTGAACCATGCGGGTCTGTGTTCGACCAAGGGCGTTTTTGCGAGACTTTTCACTCCGATGATGCAGGTTGGAGAACATGCAATGCTTGCAAGAAGCGTGTACATTGTGGATGCATCGCCTCGTTGTACTCATTTGTTCTCCTGGATGCTGGTGGGGTGGAGTGCTTTTCTTGTGCTACCAAAACTGCACCTGCATTGCCCTTGAAGCATTTACAGCACTCAGTAGTTCCTCCTGCCCCACAGCCTCAAAGAGTGGATCCTCTAGCTGCTAGAGGCTGGAGTGAAACCTTTGGAGCCAGAGCAGCAAGGAACATTGAAGTGGGGACGACCTGGCAGCCTTATTCTTCAGCTTGGTACCCCCCAAACACTGCGGGATTTCCGATAGTGAGACTTCAGGCTGAACTTGATCGACCTGTCGAAGGAAGCCATGCCGAGCCAACTCTTAAAGGGTTGGTAATCAGAAATGAAGACGCTTACCCGGAAAGCAAATTTCCGCCCACAAAGGATTCCTCTGCGTCTGCCGAGCATCCACGGGGAGACTCACCTGATGGAGAGCTACACGCGGTGGAGAGTAGCCCAACATGCTTCTCTAGAGATCCGGGTGCTGTCGGACCAGATAATGTACAAGGTGATTGTGATGGAGAGTCATTGCGAGTTGGTGTTGCGACGTCAATTGGTTTGGAGAATATAATCGGAAGTTCCGGTAAAGTTGGTGTTGATGTGACTCGAGTAATTACGGGAAAGAGTTTGTTTCCGACTCAGGACCTACTTAATGCTGGACCTTCCACAGGATTAAGCATGTCTATCGGAACATCTGCCAGGAAGGAAGGTGCGGGCGAGGGAAGCCAACAAGGAGGTATATTGGGACCAGCTGGTGCGCTTACTACGCCAGCTGGTGCTGGATCGTCTGGTGTAAGTGCGGAGTCAAGGGATCTGGCCTCTAAATTTACCGGATTGAGTCCATATCGTTCCCGACACAGACAACTTCTACCTCGACCATACCATGCAGGGACAGCTTCTCCGAATTCTAATGCTGAAGTGAAAAGCAACGAAGCCGGATCAGTGCGAGTTGCTCGCCCACCAGGTCAAGGAAGGGGCCGCAACCAGTTGCTACCTCGGTACTGGCCGCGTATAACCGACCAAGAGCTTCAGCAGATAACTTCGGGAGATTCAAACGCGACCATCACACCCTTGTTCGAGAAGATGCTGAGTGCAAGTGATGCTGGTCGTATCGGGAGGCTGGTCCTTCCAAAAGCTTGTGCAGAGGCTTACTTTCCTGCAATCTCACAACCAGAAGGTCTGCCTATGAAAATTCAAGACATTACAGGAAAGGAGTGGCTATTTCAGTTCCGTTTCTGGCCCAATAACAACAGCAGGATGTATGTCTTGGAAGGTGTCACCCCCTGCATACAATCAATGCAGCTGCTCGCGGGCGATACTGTCACGTTCAGTAGACTAGATCCAGAAGGAAAACTTGTCATGGGTTATCGACGAGCTCCAGCTTTGCTTACTTCTCAGGATCCTAAGACGGCCACGAGGGGCACCTCCGCTAATGTGTCTAAGGGTTTAAGTTGTGGAAGTATTGACGGCCTTTATGCCAGTACTGGAGCATCGTTGCTTTCTGTCAGTGCAAACGCAGAAGCACGAAATAAGTCAGGCCAGAGCGATGTGTCAGACTCAGGGTATGGATGGTCTAAAGCTGAGAAAGGCATGGGAAAGGAAGGCTCAATGCTCGAAGCCTTGTCGCAGGTGGATAGAAAGCAGCGAGGGCGTCCTCTTGGTGGGAAGAGTAAGAGGCTTCGCTTAGAAAATGAAGACTCTTTAGAACTGAAGAACAGTTGGGAAGAAGCTCAAGAATTACTGAGACCACCCCCATCTGTGGTGCCAAGTATTGTGACCATTGAGGGTCATGAGTTTGAAGAATATGAGGAACCACCAATTTTTACCAAGCGGACAATCTTCACCTCAAGACAGTCTGGGGAACAGGACCAGTGGGCCCAGTGTGACGAGTGTGGTAGCTGGAGAAGAGTCCCCCCAGAGGTCCTAGTAACAGCGAGATGGACTTGTACTGATAATACTTGGGATCATAAAAGGGCGATGTGCAGTGCACCCCAGGAGCTGAGCAATGATGATGTTGATCACCTTTTGGGGCTTATTCCGGGGGAAGAATTTGCGATTCCAGAAAAGAACGATACTAAAGCGGTAGGTTCTGGGCCTATGGTGGTGGAGACTTCAGCTGGTTTGGATGCTTTGGCGATTGCAGCAGCTATGGGGGAAACTGGTAGAGTTTCAACCTCACCATCGTCTCCTGCACGAACCACTAAGCATCCGCGGCACCGGCCTGGCTGTACTTGTATTGTTTGCATACAACCACCAAGTGGGAAAGGTCCTAAACACAAACAGAACTGCCTGTGCAATGTTTGTGTCACCGTTAAAAGACGGTTCAAAACTTTAATGCTGCGTCGCAAAAAGCGGCTGTCTGAGCGTGAAGCAGAAGGTTACGTAAGGAGGAAACGCAAAGATGATGTCGAGGTCAGCAGCAGTTCGAAACTGGTCACTGATGCTGGTTCGTTAGCGGATGGTGGCTCTAGGCATGAAAGTTCGGGTGGTGGAACCGTTGTGGAGGGACCAAGAAGAGACGATGCCTTGGTTGCAGATATTAGCAACAGTTCAGGCTTAACAGCATTTGGATTATCCTTCCCGAGCACAAACGCAGGGGAAGATGCTCTTGTGAGCAAAGGACAAATTGATCTTAATAGCCAGCCAGAGCGGGAGGAGGAACCTACGAAACTGGGTAGAGTAAGCATGAAACAGCTGTTACAGGATGCAAGTCAGCCTCTTGATACATATTTGAAGCAGCAAGGAATGACCAGTCTTTTCGGTAGTCAGGCAGCCGAGACTTCAGGTGCAGTAGGACACTGCGGAGGCAATAGTGAGAAGAAGAGTGATGAGCAGAGTAGCAGCCAGTGTCAAGATCACTCGAATGAAGAAGCTTCTCAGACTTCCGCCAGGATTCAAGGAGACAGTGCTGGTATCCCTAATCAGGTCTCCAATCAAATATCATGA

Protein

>Mapoly0074s0026.1
MDTRMERAGPVPRKVCMNVKCGTSSSNSWKPGWQLRSGRACELCEPCGSVFDQGRFCETFHSDDAGWRTCNACKKRVHCGCIASLYSFVLLDAGGVECFSCATKTAPALPLKHLQHSVVPPAPQPQRVDPLAARGWSETFGARAARNIEVGTTWQPYSSAWYPPNTAGFPIVRLQAELDRPVEGSHAEPTLKGLVIRNEDAYPESKFPPTKDSSASAEHPRGDSPDGELHAVESSPTCFSRDPGAVGPDNVQGDCDGESLRVGVATSIGLENIIGSSGKVGVDVTRVITGKSLFPTQDLLNAGPSTGLSMSIGTSARKEGAGEGSQQGGILGPAGALTTPAGAGSSGVSAESRDLASKFTGLSPYRSRHRQLLPRPYHAGTASPNSNAEVKSNEAGSVRVARPPGQGRGRNQLLPRYWPRITDQELQQITSGDSNATITPLFEKMLSASDAGRIGRLVLPKACAEAYFPAISQPEGLPMKIQDITGKEWLFQFRFWPNNNSRMYVLEGVTPCIQSMQLLAGDTVTFSRLDPEGKLVMGYRRAPALLTSQDPKTATRGTSANVSKGLSCGSIDGLYASTGASLLSVSANAEARNKSGQSDVSDSGYGWSKAEKGMGKEGSMLEALSQVDRKQRGRPLGGKSKRLRLENEDSLELKNSWEEAQELLRPPPSVVPSIVTIEGHEFEEYEEPPIFTKRTIFTSRQSGEQDQWAQCDECGSWRRVPPEVLVTARWTCTDNTWDHKRAMCSAPQELSNDDVDHLLGLIPGEEFAIPEKNDTKAVGSGPMVVETSAGLDALAIAAAMGETGRVSTSPSSPARTTKHPRHRPGCTCIVCIQPPSGKGPKHKQNCLCNVCVTVKRRFKTLMLRRKKRLSEREAEGYVRRKRKDDVEVSSSSKLVTDAGSLADGGSRHESSGGGTVVEGPRRDDALVADISNSSGLTAFGLSFPSTNAGEDALVSKGQIDLNSQPEREEEPTKLGRVSMKQLLQDASQPLDTYLKQQGMTSLFGSQAAETSGAVGHCGGNSEKKSDEQSSSQCQDHSNEEASQTSARIQGDSAGIPNQVSNQIS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>