Mapoly0074s0081



Description

CALMODULIN-BINDING TRANSCRIPTION ACTIVATOR (CAMTA)

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0005515 Protein binding
GO GO:0005634 Nucleus
KOG KOG0520 Uncharacterized conserved protein, contains IPT/TIG domain
OrthoMCL OG5_139085
PFAM PF00023 Ankyrin repeat
PFAM PF00612 IQ calmodulin-binding motif
PFAM PF01833 IPT/TIG domain
PFAM PF03859 CG-1 domain
PANTHER PTHR23335 CALMODULIN-BINDING TRANSCRIPTION ACTIVATOR (CAMTA)

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpCAMTA transcription factor, CAMTA Mapoly0074s0081.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0074s0081.1 scaffold_74:930822..940477  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0074s0081.1  

Gene structure:

mRNA scaffold_74:930822..940477  ( + strand )
five_prime_UTR scaffold_74:930822..931852  ( + strand )
CDS scaffold_74:931853..931901  ( + strand )
CDS scaffold_74:932639..932770  ( + strand )
CDS scaffold_74:933105..933220  ( + strand )
CDS scaffold_74:933486..933574  ( + strand )
CDS scaffold_74:933701..933746  ( + strand )
CDS scaffold_74:934062..934626  ( + strand )
CDS scaffold_74:934802..935217  ( + strand )
CDS scaffold_74:935371..935451  ( + strand )
CDS scaffold_74:935548..936147  ( + strand )
CDS scaffold_74:936621..937309  ( + strand )
CDS scaffold_74:937487..938093  ( + strand )
CDS scaffold_74:938197..938487  ( + strand )
CDS scaffold_74:938852..938944  ( + strand )
three_prime_UTR scaffold_74:938945..940477  ( + strand )

Sequences:

Gene

>Mapoly0074s0081.1
CTGGAAACTCTATCCAGCTGCTTTTGGCTCCGCATCCTTCGTCGCAACCCAGGCCGGAAGAAGGAACTCTCGTCGTCGTCGTCAGGGACGGCCCGGCCCGCCCGCCCGCCTTCTTCTCTCGGCGTTCTTCGTGAGTGCGCCCGCTGCCAGTGCCCTGCCAGTGCCACTGCACTGACTGCACTCACTGCCTTGCCCTGCCTCGCCTCTCGCGATCGTCGTGCCAAACCCTCGCTGCTGCTTCCTGCTGCATCCTTCTTTCCCTGCCTGGGGCGAGTTTTTGCCGTGCTGCGTCTCGTGCGTCTTCCGGACTTCCGAGCTTCCATACCTTTTTCACGGATCCTTAGGCCCACCCATAGCCTTCAACTCTGCATGTGCTTCTCGACCTTGTGTGCCCTACGCTCCGACATGCTCGGTTCCTTGACCTCCCTCTGCCGCGAGTGTCGCATATCCTCAGTGCCATCAGTGTAGTTCTTTCTCGTGCCGTATCGCTGCCCCCCCTTCCTCTCCCGGACCCCATTCGTTCATTCGTCCGCTTCTCTCCTCCGTGACGGATTTGCTTCTTCACGCGGTGTGCCATAGCTCATGTAGATTACAACCCGCTTCTCTTGCAGCGGATTTTTCCTCCCCACTCCTTGGCGAGAAAGCGCGGTATCTGAGCCTCGATGCTTTTTCCTCGAGTAGCCGCAACAAAGTAGTTCGCGTTTATTTTCCAGGTGACGATATTCTTTTTTCGCGAGTCCGCTTCATACCCCTCTACGAAGACTCTGAGCCTTGGCCTCTCTCCGCGAGTGCAAGAAGGAAATCTTCATCCGTTATCTGCCGCCTCTGCTACGACGCTGGCTGGAGTTTGTCCAGGTCATTCTCGCACCCGTGTAGCACCTTGCGTTCCCATAGGAAGCTATTTTCTACGAACGGCTTGGGGCTGATGGAAGGATAGGTAACAAGGCTATGAGAAAGCGACGGCGACCTGTCAACGACCAAAATTTCTGCAGCGAGTGTGGTGAATTAGTTGTGTTTATGTGTGCTGAGTAATGGCATCGATGACTGCTGGGCGACCCCGTAATCTCCCTCCGCAACCTGGTACGTGTTTTTACTGCTCCTTCATCCAATCTGTGATATGAACATTCGTGTTCCTGATGTTAGTTGCGAATCACTCTGTAGCCTTCATTCAGGTCTTGGGCACCTGATGTACCTCCGTCTCCAGCTGCTCCAGTTCTCCGTATTCTTAAGGGCCGTGGGAATCTGTTACTCTTGCATTTTTTGCTTCGGAGGGGCATTGCAAGTTGGAAGTTACGTTTAACAAATTACGTATTCGTTCGTGAACGGAGAGGAAAACGCACCTTGTTGAGGTTAGTTCATTGGGTACCTGTAAAGCCTTGGGAGGACCTGTGAACGCAACGTCGCCTTGAAGGTCCTTCGAGCTGAGAGTTCGGAGACGGCTAGGCTTACGTTGTTTGTCCTGAACATGATGATTTAACCAAACCCCTTCGACTAAACGTGGTCTGGCTAAGGCCAGAATGGGATGGAAAGATGCTAGTACAGTTCAAACGTAGTGTTGCTCGTCGGCCATGTAATTTGTGCCTTCGAGTTAAAGAGTGGGTATGGTTGATAGTTTACTCTCAGGTGATCGTTGTTCCATCGAGGTCCTTCGCAGGTGTTTGCCAGTAGAGGGTGGAGAAAAGTCTAACCACCCATCAGTCCTTGGCTCGGTCCCACGGGACGATTAATCGATCCTACTCAAGTTGGAGGTCTTAAGGTTCCCAGCGTTAACATTGGTATTCAACTTGTAATTGGTTCATTTTGTGGGATGTGATCAGAAGTAGATGTGAGGCAAATTATACACGAAGCTCAAACTCGTTGGCTTAGGCCAGTAGAGGTGTGCGAGATCTTGCGCAACTACAGGATACACAATTTCAAGCTCAACCCTGTTCCTCCAACACAACCGCAAAGTGAGTTTTTCCTTGTGCCCTCGTTCCCGCTTTCCGAGTTTTGCTGTATGGGAGGTTTGAGGAGTCTGTTCTAAGTGAGGATTGTTTATGTCGAAGCCCTGTCCAGATAGCAAGGCAAGTTAAATATGTGACATGAAAGCGTGAGAAAACTCTTGGGGAATGAAGTTCTGAATTCCATAGACATTCCCGTTCAACAGCATGTGACAAGTGTGATAAGCTAGCTCAATTTTACAGCTGCGCGTTGACTACGCATCCACGGCACGCTAGTCTTGAGTTATAGTTCTTGGGGAGACACCCTCAAGAGGAGGAAATTCTCACAAGCTATTTGTTGCAGGTGGCTCGCTCTTCCTTTTTGATCGGAAAGCGTTACGATACTTCCGAAAAGATGGTCACAATTGGCGTAAGAAGAAAGATGGGAAAACTGTCAGGGAGGCCCATGAGCGACTGAAGGTAAGTCCTTACGCTGTAACTGGATTTTCTGTCATTACTTTATGGATAATCTTCTAGTATACGTCTGTTTCCTCTCCACTTACACTTTCAAAGACAGAACATGTTTTGGATGCAACTTAGCTCGTGTAGTGTCGAGTGTCTTGTCTGGAGTTAAGTGATGTGTGTGTGTTTGTCTGAATCGTACTTCCCGAGTACTTCTCGTGACTCGTATTTTTCAAACGACACGAAATTGACTATGCTCCTTTTTGCCTGTTGCTGGTATCAGGCAGGAAGTGTGGATGTCCTCCACTGTTACTATGCTCATGGGGAGGACAATGTTAATTTCCAGCGTCGGTGCTACTGGATGCTCGATCCGTAAGTTTGTCATATTGCCTTGTTCATATCAGTGTTGTCTCTTCTCTTCCACCTTGTGTTCTTTGTAGGGGCAAAGGATTATCTAGTGAGGATATTGACTTAGCCTTTTTATGTAATGTTTTGCAGATCTTACGAGCACATCGTACTTGTTCACTATCGGGAAGTTACCGAGGTGAGGATAACACTGATGTGAACGACTTTCGTAGATTTCTTGTTTTCCTTCTCTTGGGACCCTCATTGTATCTGAATGACCATTTTCTTTAATGTTCTCCGTCTTCGTTGTCCACTGTGATGACCTGAATGTTCTTCTTTGTCGTGTCCCTGTGTTGGGAGTAGTGACTTATTCAGTCCAATCCTTTCTCACTAGTTTCTGAAGATTGACTGTACACAAGCTCTTCAACGACTTCTCGTTCGATGATATGGCAAAGTAAAGCAGCCCAACATGGCCGACTAATTTTCTTAATGTTTTACTGCGGTCTTTGTGCAGAACAATCGATCATGCATCATTCGGACCATGCATGATTACAACTCGACATATCATCCGCCGTTGGCCTCTCAGCATCAGCATGTGTCGCCCACTGTCTCCGTCTTGACCAACGCTAGCTTACCATCCTCCGTTGCAAGCCCAGAAACCGTGGAGGCTGCGGGCGCTTCCCTTTCTCCTGAATTAGATGAGGCGGAGTCAGCAGAGCCAGATGAATTCGAGGATCCAAGCCTCGAGATCGAAGGAGATCAATCGGGCTTACAACCTTCGTTATTAGAACAATTGGGGAATCAGCCGTTACCAGGTGCTCATAGTGCTTCGAGTTCCAATCAGTGGCCCAGTCTCGGAAGGACTGCAAAGAACCTGGGTGTTACAGATGGGCAGTTCGCTCCTCTTTTCTCTCATCAGGACAACAGAGACTTCAAGCCGTCGTTTGCTGACTTGCAGCAGCAGCGTCCGCAGAGGATGTCCAGTACATCTCAAAGCGTCAACTATCCGTTGCTACAAAATTACCCTCGTGATGTGGGTAGCATAAGACAGCAATTCGCAGACATGTTGGATAGTCCAGGTAACTTTCTTGCTGTCATGAGCGTAAGTCAGTTTTTTTTACTACAAGTGGTATGCGTTTTTATTCGGTCTTAACGAGCGTTATTCTGAAAATTTTTGTCATGTAAAGGAACCATTCGACTTCCAGTCGACAATTGAAGGATGTTGAACGTGTAACTTATTTGCCTTGTGTACAGGTCCATACCCAAGTTCTTCTCAGCGAAGCACTTCTTCTATCAATCATTCTCTTGATTTGTCCGTTTTGACATCCATGATTCAAGATGGCAACAGTGGTCATGCTGGCAACGGTGCTGAGAGGTTTGCAAGACCAGAGGTTAATTCCCCACCGGACTGGGCCGGAATGTTACGGCAGGTTACCACCCCGTCAACGAGAAGAGCTCTTCTAGAGGGCCAGGGCCTGAATCCTGGTTTAGGCCAGTCTCCACACGGAAAAGATACGCCACCTGTTCTTGGTACTCCTATTTCCCCTAAAGGCATAGTCGATGCCTTGTCTCCACGGAATCTGGGCCGTGCACCTCAGACGACCCTTGAAGCGAATTTACGTGCTGTGACTGAGAAAGAAGTCCTGAAGGAAGCAGAGGAGAAAGCCCAGGTGGGAGGCTTATCTCTGACAATCATATGCTTGAGACAGAAACTGACTGTATGAAGCAGTTTTTTGTCCATTTTTTGTTCCTTTCGCAAATTTGAATCGTTTTTTGTATCAAATTCCTGTCACTATCATTGATGCCCTCACGGTTTCTGACAGGCCCAACGCACTAGGTGGCAAACAACACAGTTAACCGAACCCTCTCCAGTGGACTCAGTCATCCATCGCAATGTGGACCTGGTAAGCGTGCTGTACGCACTGCTGTGTAATCTGGTGGGTTAATCCTAGGCGAGAATGAAATTAATTCTGACTCATATGATCGTACCTCTCTTGCAGTCCGGTGGTGCCCAGCAGATGAGTGCAAATCATTTCATCGAGCCAGATACACTGGAACATTTGGTCCGGAGTGGACATTCTAATCCAGATTCGTTCTCCACGTCTGGTTCCAACGAGAAGGGTTCATGGATGCAGCAGGCTCCTCAGCAGAATGAGCAGCCAGTGCATGCCAGCCAGCTCTATCAAAATGGAAATCTTTATGATCATCAATCGCAGCCTAATCAAGAGCGCGTTCAGCATGAAAATTTACAGCCAATAGTTCCGCCGCCGCACTCGACCGGCTTCTCATTTATGGATCACAGTGGTTTGGGTAACGGTGACCTGTTTTCTCCAACTGAACACTATCTCAAAGATGTTCAGTCTGAAGAAGGAGCACACCGAGAAGTTATAGAAAGCTACAAAAAGTTGGACAGTTTTGGGAGGTGGATGACCGCCGAAATTGCGTCTGACATAGCCCCTTATCTTATGGTTGAGCCAGGCGCGTGGGACAACATGCAGCAAATGCAGATGGGCGGAAATCTTGACCCCAGTCCTACAGAGCAGTGTTTCAACATTAGCGATTTCTCCCCGGAATGGGGCTCGTCTACCGAAGAAACCAAGGTATATTTCTGTAGTTTGCCAGCTATTCAAACTTGCAGAATTGTTGATTATTTTCGCTAGAGGACGATTGATATATGATTGATATACTGTTTTGAAGTTACTTTTCGGTTCCGGCGATTGGAACATGTCACTGACTTCACGGCTCAAATATCATATTCAGTGCTTGCAGCGCACTCGATTAAGTTGGCTAGCTGTCCTGGCTGAATCTTTACTTCGTTTCTTAGGGATGGAAAATTATTTTAACCCTGAAAGGCCTGAATGAGGAAATATGGGTTCTTTTTTGTTTCTGTGGTTGTGGTAAGACACCAAGACTTCCAGCTTGGGAGTTACGTGTTTTTGTATCTTGGTTAGTGTTTCCTGGAGATGCTCTTGGACTGGACTTGCCAAAGTTGGGGAAAGAGAACGTCTCTACCATGTAATTGATGTCGTAGGGTGCCTCCATCATAATGCGGTCATTGTTTTCTTTTTTCCAGGTGTTAATCACGGGGACTTTTGTTGGAAGCATAACTCCTACGGACCATACGTGGGCTTGCATGTTCGGTGAGATTGAGGTGCCTGCGGAGCTAGTGGAAGGAGGCGCGCTTCGTTGTAAAGCACCCAAGCATGAACCTGGAAGGGTTTCTTTTTACATTACCCGTAGTGATAGGTTTGCTTGCAGTCAGGTGCGTGAGTTCGAGTATCGCTCTGCGGGTACCACTAATGAATCAACACCAACACTCTTGACTGGAGAATCTAGTAAGATCGAAGAAACTGCGGAGGAACTGCGATACAAAGTAAGATTCGCACGCATGCTCATGGCAACTACTACATTGAGCAATTGCCGTATGAACTCCCGAACGCAGACTTTCAAGGAGAGCGAAGATGACGACTGGAGGCAGCTGGAAAGCATGCTGGAGGCAAAGAGACCTTTAGCTGAGGTCAAAGAGCAATTGATTCAGCTCATGTTCAAGCGGAAATTGCAAGAGTGGCTCAAAGAGAAGTCGCTCTTGAAAGATGGAAAGCGGGCGTCAGTCCATGACGATCAGGGTTGGGGAGTTTCACATTTTTCAGCCGCCCTTGGTTATGTATGGTCCATTAGACCTACTTTGAACGCTGAGATACCGATTAACTTCCGGGACGAAAAGGGATGGACAGCTCTGCACTGGGCAGCTTATTGTGGAAGGTATAGTAATATACGTCCAGCGCCCATTTTTGAGACAACTCATGATATTCTCAAACTGCCATTAATCTCCAAATTGTTTGACCATATTGCGATGATTTGTCAATAAAGGAATTCAATGTTTCTTTGATCCTGATGTGGTTCCAACCCCGGGCTGACTGTCGTCATGGCATGGTGCAGGGAAGAAGTGGTTTGTGCTCTTCTTGAAGCCGGCGCTTCACCGAATTGTGCAACTTACTGCAATAAAAAGTATCCTCAAGGTCAATATCCTGCCGATCTAGCCTCGGAAAGAGGCCATAACGGCATAGCTGCCTTTTTGTCAGAGAAGGCGCTCACGGCGAGATTGTGTGGGTTGAACTTGGAGGATGGTACTCAAGTGGATGAAAATGCTGCGTTGCTGGCTGCTGATAAAGCGGTTGCCCAACTGGCTAGAAGGTCTAGTATTCGGTCTAGTGTCCACGTAGAGAAAGATCATGAGGTTCTGCAAACGTCCCTACTGGCAGTGCGCAATGCAACACAAGCGGCTGCGTTGATCCAAGATGCAAACCGACAAGCTTCTTTTAGAAGAAGAATGCTGCATCTCGCAGATGATGTGGTGGACGAATATGGTCTATCTCAAGCAGAAGTGCGCTCCATGTTGGCTGCCCAGAAAATTCAAAAGGCCTACCGTGGCCATCAAAAGAACAAAAAGCTCCACCTTGCTGCTACAGCAATACAACGCAAATTCCGAGGCTGGAAGGGAAGAAAAGATTTCCAGACTTTCCGGCAGCGTATCATCAAACTACAGGTGTCCGCCAGTCCCGACCTGAGAGCTGACTACTTCTTTTCTGAATCTTCCGTTCTCTGCATATTGTTTTTATACTCAAATAATGTCATTTGTGTTTATGCAGGCTCATGTACGAGGCAGATTGGTACGTAAGCAGTTTCGGAAGATCCTGTGGTCAGTCAGTATCGTTGAAAAGGTAGTTTTGAGGTGGCTCCGCAGGCGCAATGGTCTAAGAGGCTTCCGATCCGAGTTCATCGAATTACCGACTAACAGTGATGATGACGACGACCTGATGAGAGAAGGGAGACATAGGAGCACGGCGGCCGTGGAGAAAGACGTGAGGAGGGTCCAAGAGATGGCCCGAGAGAAGAAAGCGCGAGAGCAGTACAACAGATTGCACGAGAGGATTTCCAAGGTATGTATATATACGGAAGGTGTACCTGTTTGTAGTACTACCCAGTGTGACATCCGAATTTTCACCTTGTGAGAATGCTTACATATTTGATTGATGTCAAAGAAGTGCTCTCTGTTACTGCCCATGAAATCCGTACAAATTCTAGAGCCACCTTCATCCTTTTGAGATGCACCTCTGCGCGAAGTAAATCGCAATAGATTGCTGTGTTCTTGTCCTTGAAGTCGTGGAGACCATGAATCGTTCTTCCGTAGAGTCCCCGAACTTTATATGCATAGAACATGTAGATTTTTCAGTACGAGACTGACGTTTGCCGTGCAATGACTTCTCGCTTACAAACCTTCATTGTTGTTTTTTGAATGTCCAGGGTGAGCCTTACAATAGCTCGTATCCTGACCACGGGCAAGTCTCTAGAGATTACATGGTGGGTCAAGACTCTGTGATGACAACAGTGGAGTGATGACGTCACGTAAAAATCAATGAGTCCGTCAGTGATAAAGTTGTTTATTCACATCGCTTCATGAAAGCTACAATTCTGCTGGCCCAGAGACCGGTATAATCTAGAAAAATTCATTGTATAGCAGTAGAGACCTTCTGTAACTAAGTCCTTCACATTGCCCTTGATTGGAGTAGTTAGTCATGCTCCTGATCTTTGGAAGCTTAGAAATTGTAACTCACATGTTTATGAGGTCAAGCCTGTTTGGCAGTACAAATGTAGATTTTATAAGGATCATATCTTCCTCTTCATCCAACCATCTTATCATCTCGAGTCTATGTCATGCAACCATCTTCTTGAACTGGACATCAGTGTGGTTACTGGTGAAGATGGGCCTACTACAGAAGAGGTAATTCACTGCCAAGCTCCTCAATGAGTGGTCCTCAAGACCTTCAGATATCTTATAGCAATATGCGTACTTATCTACTAGTCATACAGTTTTTTTGAGTAACGATTGTGTTTTGGACTTCTTGAATGTACATCTTCTCGTGTTAAGTCTGCTCAGGTGGCATGATTAGTCAGTAGGTTCAGGACACTGAAATACAGGTTGCAGACGCTTCAAGTAATTTTCCTGCCTGGGTCAGCTGTCACGAATTGTGTTCTGCAAACCGTGTATATTTCCTAACGTGGGTCAGAATTTGAAGTCGGCATTCTGAAAAAGTTTTATTTGGTGTTTGAAGCCGATTGTAGAACGCAGTCTACTAGCTGTCCCAGTTTTGTGTGTGCAGTCTTTAAATAGTACTAGCATTTTGATTTTTGGCCGTTTAGTGAACAATCCGTCTGGGCAGAAGACGTACCAGGGAACGATTGAGTAGTTTTGATTTTGCCAAAGTTATATTCCTTTCTAAATCTTCCCTTCTTGCATGTCGCCAATTTCTTGTTGCTTCTGTTAGCCGCCACTCGATATGCATATCACAGTAGGGTTCTTACATATCAAAATGTTATTCTAGAATATTCTTTCTCTGACCTAAGAGAAGTTTGTGCATCTGTTAGGTCTTAGGGTTTTCTTAGTATACATAACAAGTTCGTACAGCTGGAAATGGATTTGAAGTCTTCTTTGGCTACTACCATTTCGCTTTGTACGCAGACATGTCGCATTGTATCAGATCTCGTCTATTTCTCGAGATTAATCCACGAGGCTTATCGCATGGATGGTTCAAATTACGTACATCGTATTGAGTCCAGAACAGTTGTATAGTTTTGACGTTCAGTTTTACAGCTTACGGGCAGCCATGATCGCTTTAGAAACTAAACGGCAATGTTGAACGATCATTTATATTCAAGCAGTCCAGAAGGATTAATACGAGATATTGGAGGTTGACTTCTGTCTCATCCAAAACTTGGTGGATGTGAGCTTGAATGTTACCCTTTAAGATAGGTACTAGAACCGGTGGTTGTATCACCACTGGGTGTAGCAATGTTCAGGCCCATCCAGTAGTGAAATTGTAATGTGAACTTCTTCAACATCGGTTCTACGTTGGTGGTAGTTTGACCGCA

mRNA

>Mapoly0074s0081.1
CTGGAAACTCTATCCAGCTGCTTTTGGCTCCGCATCCTTCGTCGCAACCCAGGCCGGAAGAAGGAACTCTCGTCGTCGTCGTCAGGGACGGCCCGGCCCGCCCGCCCGCCTTCTTCTCTCGGCGTTCTTCGTGAGTGCGCCCGCTGCCAGTGCCCTGCCAGTGCCACTGCACTGACTGCACTCACTGCCTTGCCCTGCCTCGCCTCTCGCGATCGTCGTGCCAAACCCTCGCTGCTGCTTCCTGCTGCATCCTTCTTTCCCTGCCTGGGGCGAGTTTTTGCCGTGCTGCGTCTCGTGCGTCTTCCGGACTTCCGAGCTTCCATACCTTTTTCACGGATCCTTAGGCCCACCCATAGCCTTCAACTCTGCATGTGCTTCTCGACCTTGTGTGCCCTACGCTCCGACATGCTCGGTTCCTTGACCTCCCTCTGCCGCGAGTGTCGCATATCCTCAGTGCCATCAGTGTAGTTCTTTCTCGTGCCGTATCGCTGCCCCCCCTTCCTCTCCCGGACCCCATTCGTTCATTCGTCCGCTTCTCTCCTCCGTGACGGATTTGCTTCTTCACGCGGTGTGCCATAGCTCATGTAGATTACAACCCGCTTCTCTTGCAGCGGATTTTTCCTCCCCACTCCTTGGCGAGAAAGCGCGGTATCTGAGCCTCGATGCTTTTTCCTCGAGTAGCCGCAACAAAGTAGTTCGCGTTTATTTTCCAGGTGACGATATTCTTTTTTCGCGAGTCCGCTTCATACCCCTCTACGAAGACTCTGAGCCTTGGCCTCTCTCCGCGAGTGCAAGAAGGAAATCTTCATCCGTTATCTGCCGCCTCTGCTACGACGCTGGCTGGAGTTTGTCCAGGTCATTCTCGCACCCGTGTAGCACCTTGCGTTCCCATAGGAAGCTATTTTCTACGAACGGCTTGGGGCTGATGGAAGGATAGGTAACAAGGCTATGAGAAAGCGACGGCGACCTGTCAACGACCAAAATTTCTGCAGCGAGTGTGGTGAATTAGTTGTGTTTATGTGTGCTGAGTAATGGCATCGATGACTGCTGGGCGACCCCGTAATCTCCCTCCGCAACCTGAAGTAGATGTGAGGCAAATTATACACGAAGCTCAAACTCGTTGGCTTAGGCCAGTAGAGGTGTGCGAGATCTTGCGCAACTACAGGATACACAATTTCAAGCTCAACCCTGTTCCTCCAACACAACCGCAAAGTGGCTCGCTCTTCCTTTTTGATCGGAAAGCGTTACGATACTTCCGAAAAGATGGTCACAATTGGCGTAAGAAGAAAGATGGGAAAACTGTCAGGGAGGCCCATGAGCGACTGAAGGCAGGAAGTGTGGATGTCCTCCACTGTTACTATGCTCATGGGGAGGACAATGTTAATTTCCAGCGTCGGTGCTACTGGATGCTCGATCCATCTTACGAGCACATCGTACTTGTTCACTATCGGGAAGTTACCGAGAACAATCGATCATGCATCATTCGGACCATGCATGATTACAACTCGACATATCATCCGCCGTTGGCCTCTCAGCATCAGCATGTGTCGCCCACTGTCTCCGTCTTGACCAACGCTAGCTTACCATCCTCCGTTGCAAGCCCAGAAACCGTGGAGGCTGCGGGCGCTTCCCTTTCTCCTGAATTAGATGAGGCGGAGTCAGCAGAGCCAGATGAATTCGAGGATCCAAGCCTCGAGATCGAAGGAGATCAATCGGGCTTACAACCTTCGTTATTAGAACAATTGGGGAATCAGCCGTTACCAGGTGCTCATAGTGCTTCGAGTTCCAATCAGTGGCCCAGTCTCGGAAGGACTGCAAAGAACCTGGGTGTTACAGATGGGCAGTTCGCTCCTCTTTTCTCTCATCAGGACAACAGAGACTTCAAGCCGTCGTTTGCTGACTTGCAGCAGCAGCGTCCGCAGAGGATGTCCAGTACATCTCAAAGCGTCAACTATCCGTTGCTACAAAATTACCCTCGTGATGTGGGTAGCATAAGACAGCAATTCGCAGACATGTTGGATAGTCCAGGTCCATACCCAAGTTCTTCTCAGCGAAGCACTTCTTCTATCAATCATTCTCTTGATTTGTCCGTTTTGACATCCATGATTCAAGATGGCAACAGTGGTCATGCTGGCAACGGTGCTGAGAGGTTTGCAAGACCAGAGGTTAATTCCCCACCGGACTGGGCCGGAATGTTACGGCAGGTTACCACCCCGTCAACGAGAAGAGCTCTTCTAGAGGGCCAGGGCCTGAATCCTGGTTTAGGCCAGTCTCCACACGGAAAAGATACGCCACCTGTTCTTGGTACTCCTATTTCCCCTAAAGGCATAGTCGATGCCTTGTCTCCACGGAATCTGGGCCGTGCACCTCAGACGACCCTTGAAGCGAATTTACGTGCTGTGACTGAGAAAGAAGTCCTGAAGGAAGCAGAGGAGAAAGCCCAGGCCCAACGCACTAGGTGGCAAACAACACAGTTAACCGAACCCTCTCCAGTGGACTCAGTCATCCATCGCAATGTGGACCTGTCCGGTGGTGCCCAGCAGATGAGTGCAAATCATTTCATCGAGCCAGATACACTGGAACATTTGGTCCGGAGTGGACATTCTAATCCAGATTCGTTCTCCACGTCTGGTTCCAACGAGAAGGGTTCATGGATGCAGCAGGCTCCTCAGCAGAATGAGCAGCCAGTGCATGCCAGCCAGCTCTATCAAAATGGAAATCTTTATGATCATCAATCGCAGCCTAATCAAGAGCGCGTTCAGCATGAAAATTTACAGCCAATAGTTCCGCCGCCGCACTCGACCGGCTTCTCATTTATGGATCACAGTGGTTTGGGTAACGGTGACCTGTTTTCTCCAACTGAACACTATCTCAAAGATGTTCAGTCTGAAGAAGGAGCACACCGAGAAGTTATAGAAAGCTACAAAAAGTTGGACAGTTTTGGGAGGTGGATGACCGCCGAAATTGCGTCTGACATAGCCCCTTATCTTATGGTTGAGCCAGGCGCGTGGGACAACATGCAGCAAATGCAGATGGGCGGAAATCTTGACCCCAGTCCTACAGAGCAGTGTTTCAACATTAGCGATTTCTCCCCGGAATGGGGCTCGTCTACCGAAGAAACCAAGGTGTTAATCACGGGGACTTTTGTTGGAAGCATAACTCCTACGGACCATACGTGGGCTTGCATGTTCGGTGAGATTGAGGTGCCTGCGGAGCTAGTGGAAGGAGGCGCGCTTCGTTGTAAAGCACCCAAGCATGAACCTGGAAGGGTTTCTTTTTACATTACCCGTAGTGATAGGTTTGCTTGCAGTCAGGTGCGTGAGTTCGAGTATCGCTCTGCGGGTACCACTAATGAATCAACACCAACACTCTTGACTGGAGAATCTAGTAAGATCGAAGAAACTGCGGAGGAACTGCGATACAAAGTAAGATTCGCACGCATGCTCATGGCAACTACTACATTGAGCAATTGCCGTATGAACTCCCGAACGCAGACTTTCAAGGAGAGCGAAGATGACGACTGGAGGCAGCTGGAAAGCATGCTGGAGGCAAAGAGACCTTTAGCTGAGGTCAAAGAGCAATTGATTCAGCTCATGTTCAAGCGGAAATTGCAAGAGTGGCTCAAAGAGAAGTCGCTCTTGAAAGATGGAAAGCGGGCGTCAGTCCATGACGATCAGGGTTGGGGAGTTTCACATTTTTCAGCCGCCCTTGGTTATGTATGGTCCATTAGACCTACTTTGAACGCTGAGATACCGATTAACTTCCGGGACGAAAAGGGATGGACAGCTCTGCACTGGGCAGCTTATTGTGGAAGGGAAGAAGTGGTTTGTGCTCTTCTTGAAGCCGGCGCTTCACCGAATTGTGCAACTTACTGCAATAAAAAGTATCCTCAAGGTCAATATCCTGCCGATCTAGCCTCGGAAAGAGGCCATAACGGCATAGCTGCCTTTTTGTCAGAGAAGGCGCTCACGGCGAGATTGTGTGGGTTGAACTTGGAGGATGGTACTCAAGTGGATGAAAATGCTGCGTTGCTGGCTGCTGATAAAGCGGTTGCCCAACTGGCTAGAAGGTCTAGTATTCGGTCTAGTGTCCACGTAGAGAAAGATCATGAGGTTCTGCAAACGTCCCTACTGGCAGTGCGCAATGCAACACAAGCGGCTGCGTTGATCCAAGATGCAAACCGACAAGCTTCTTTTAGAAGAAGAATGCTGCATCTCGCAGATGATGTGGTGGACGAATATGGTCTATCTCAAGCAGAAGTGCGCTCCATGTTGGCTGCCCAGAAAATTCAAAAGGCCTACCGTGGCCATCAAAAGAACAAAAAGCTCCACCTTGCTGCTACAGCAATACAACGCAAATTCCGAGGCTGGAAGGGAAGAAAAGATTTCCAGACTTTCCGGCAGCGTATCATCAAACTACAGGCTCATGTACGAGGCAGATTGGTACGTAAGCAGTTTCGGAAGATCCTGTGGTCAGTCAGTATCGTTGAAAAGGTAGTTTTGAGGTGGCTCCGCAGGCGCAATGGTCTAAGAGGCTTCCGATCCGAGTTCATCGAATTACCGACTAACAGTGATGATGACGACGACCTGATGAGAGAAGGGAGACATAGGAGCACGGCGGCCGTGGAGAAAGACGTGAGGAGGGTCCAAGAGATGGCCCGAGAGAAGAAAGCGCGAGAGCAGTACAACAGATTGCACGAGAGGATTTCCAAGGGTGAGCCTTACAATAGCTCGTATCCTGACCACGGGCAAGTCTCTAGAGATTACATGGTGGGTCAAGACTCTGTGATGACAACAGTGGAGTGATGACGTCACGTAAAAATCAATGAGTCCGTCAGTGATAAAGTTGTTTATTCACATCGCTTCATGAAAGCTACAATTCTGCTGGCCCAGAGACCGGTATAATCTAGAAAAATTCATTGTATAGCAGTAGAGACCTTCTGTAACTAAGTCCTTCACATTGCCCTTGATTGGAGTAGTTAGTCATGCTCCTGATCTTTGGAAGCTTAGAAATTGTAACTCACATGTTTATGAGGTCAAGCCTGTTTGGCAGTACAAATGTAGATTTTATAAGGATCATATCTTCCTCTTCATCCAACCATCTTATCATCTCGAGTCTATGTCATGCAACCATCTTCTTGAACTGGACATCAGTGTGGTTACTGGTGAAGATGGGCCTACTACAGAAGAGGTAATTCACTGCCAAGCTCCTCAATGAGTGGTCCTCAAGACCTTCAGATATCTTATAGCAATATGCGTACTTATCTACTAGTCATACAGTTTTTTTGAGTAACGATTGTGTTTTGGACTTCTTGAATGTACATCTTCTCGTGTTAAGTCTGCTCAGGTGGCATGATTAGTCAGTAGGTTCAGGACACTGAAATACAGGTTGCAGACGCTTCAAGTAATTTTCCTGCCTGGGTCAGCTGTCACGAATTGTGTTCTGCAAACCGTGTATATTTCCTAACGTGGGTCAGAATTTGAAGTCGGCATTCTGAAAAAGTTTTATTTGGTGTTTGAAGCCGATTGTAGAACGCAGTCTACTAGCTGTCCCAGTTTTGTGTGTGCAGTCTTTAAATAGTACTAGCATTTTGATTTTTGGCCGTTTAGTGAACAATCCGTCTGGGCAGAAGACGTACCAGGGAACGATTGAGTAGTTTTGATTTTGCCAAAGTTATATTCCTTTCTAAATCTTCCCTTCTTGCATGTCGCCAATTTCTTGTTGCTTCTGTTAGCCGCCACTCGATATGCATATCACAGTAGGGTTCTTACATATCAAAATGTTATTCTAGAATATTCTTTCTCTGACCTAAGAGAAGTTTGTGCATCTGTTAGGTCTTAGGGTTTTCTTAGTATACATAACAAGTTCGTACAGCTGGAAATGGATTTGAAGTCTTCTTTGGCTACTACCATTTCGCTTTGTACGCAGACATGTCGCATTGTATCAGATCTCGTCTATTTCTCGAGATTAATCCACGAGGCTTATCGCATGGATGGTTCAAATTACGTACATCGTATTGAGTCCAGAACAGTTGTATAGTTTTGACGTTCAGTTTTACAGCTTACGGGCAGCCATGATCGCTTTAGAAACTAAACGGCAATGTTGAACGATCATTTATATTCAAGCAGTCCAGAAGGATTAATACGAGATATTGGAGGTTGACTTCTGTCTCATCCAAAACTTGGTGGATGTGAGCTTGAATGTTACCCTTTAAGATAGGTACTAGAACCGGTGGTTGTATCACCACTGGGTGTAGCAATGTTCAGGCCCATCCAGTAGTGAAATTGTAATGTGAACTTCTTCAACATCGGTTCTACGTTGGTGGTAGTTTGACCGCA

CDS

>Mapoly0074s0081.1
ATGGCATCGATGACTGCTGGGCGACCCCGTAATCTCCCTCCGCAACCTGAAGTAGATGTGAGGCAAATTATACACGAAGCTCAAACTCGTTGGCTTAGGCCAGTAGAGGTGTGCGAGATCTTGCGCAACTACAGGATACACAATTTCAAGCTCAACCCTGTTCCTCCAACACAACCGCAAAGTGGCTCGCTCTTCCTTTTTGATCGGAAAGCGTTACGATACTTCCGAAAAGATGGTCACAATTGGCGTAAGAAGAAAGATGGGAAAACTGTCAGGGAGGCCCATGAGCGACTGAAGGCAGGAAGTGTGGATGTCCTCCACTGTTACTATGCTCATGGGGAGGACAATGTTAATTTCCAGCGTCGGTGCTACTGGATGCTCGATCCATCTTACGAGCACATCGTACTTGTTCACTATCGGGAAGTTACCGAGAACAATCGATCATGCATCATTCGGACCATGCATGATTACAACTCGACATATCATCCGCCGTTGGCCTCTCAGCATCAGCATGTGTCGCCCACTGTCTCCGTCTTGACCAACGCTAGCTTACCATCCTCCGTTGCAAGCCCAGAAACCGTGGAGGCTGCGGGCGCTTCCCTTTCTCCTGAATTAGATGAGGCGGAGTCAGCAGAGCCAGATGAATTCGAGGATCCAAGCCTCGAGATCGAAGGAGATCAATCGGGCTTACAACCTTCGTTATTAGAACAATTGGGGAATCAGCCGTTACCAGGTGCTCATAGTGCTTCGAGTTCCAATCAGTGGCCCAGTCTCGGAAGGACTGCAAAGAACCTGGGTGTTACAGATGGGCAGTTCGCTCCTCTTTTCTCTCATCAGGACAACAGAGACTTCAAGCCGTCGTTTGCTGACTTGCAGCAGCAGCGTCCGCAGAGGATGTCCAGTACATCTCAAAGCGTCAACTATCCGTTGCTACAAAATTACCCTCGTGATGTGGGTAGCATAAGACAGCAATTCGCAGACATGTTGGATAGTCCAGGTCCATACCCAAGTTCTTCTCAGCGAAGCACTTCTTCTATCAATCATTCTCTTGATTTGTCCGTTTTGACATCCATGATTCAAGATGGCAACAGTGGTCATGCTGGCAACGGTGCTGAGAGGTTTGCAAGACCAGAGGTTAATTCCCCACCGGACTGGGCCGGAATGTTACGGCAGGTTACCACCCCGTCAACGAGAAGAGCTCTTCTAGAGGGCCAGGGCCTGAATCCTGGTTTAGGCCAGTCTCCACACGGAAAAGATACGCCACCTGTTCTTGGTACTCCTATTTCCCCTAAAGGCATAGTCGATGCCTTGTCTCCACGGAATCTGGGCCGTGCACCTCAGACGACCCTTGAAGCGAATTTACGTGCTGTGACTGAGAAAGAAGTCCTGAAGGAAGCAGAGGAGAAAGCCCAGGCCCAACGCACTAGGTGGCAAACAACACAGTTAACCGAACCCTCTCCAGTGGACTCAGTCATCCATCGCAATGTGGACCTGTCCGGTGGTGCCCAGCAGATGAGTGCAAATCATTTCATCGAGCCAGATACACTGGAACATTTGGTCCGGAGTGGACATTCTAATCCAGATTCGTTCTCCACGTCTGGTTCCAACGAGAAGGGTTCATGGATGCAGCAGGCTCCTCAGCAGAATGAGCAGCCAGTGCATGCCAGCCAGCTCTATCAAAATGGAAATCTTTATGATCATCAATCGCAGCCTAATCAAGAGCGCGTTCAGCATGAAAATTTACAGCCAATAGTTCCGCCGCCGCACTCGACCGGCTTCTCATTTATGGATCACAGTGGTTTGGGTAACGGTGACCTGTTTTCTCCAACTGAACACTATCTCAAAGATGTTCAGTCTGAAGAAGGAGCACACCGAGAAGTTATAGAAAGCTACAAAAAGTTGGACAGTTTTGGGAGGTGGATGACCGCCGAAATTGCGTCTGACATAGCCCCTTATCTTATGGTTGAGCCAGGCGCGTGGGACAACATGCAGCAAATGCAGATGGGCGGAAATCTTGACCCCAGTCCTACAGAGCAGTGTTTCAACATTAGCGATTTCTCCCCGGAATGGGGCTCGTCTACCGAAGAAACCAAGGTGTTAATCACGGGGACTTTTGTTGGAAGCATAACTCCTACGGACCATACGTGGGCTTGCATGTTCGGTGAGATTGAGGTGCCTGCGGAGCTAGTGGAAGGAGGCGCGCTTCGTTGTAAAGCACCCAAGCATGAACCTGGAAGGGTTTCTTTTTACATTACCCGTAGTGATAGGTTTGCTTGCAGTCAGGTGCGTGAGTTCGAGTATCGCTCTGCGGGTACCACTAATGAATCAACACCAACACTCTTGACTGGAGAATCTAGTAAGATCGAAGAAACTGCGGAGGAACTGCGATACAAAGTAAGATTCGCACGCATGCTCATGGCAACTACTACATTGAGCAATTGCCGTATGAACTCCCGAACGCAGACTTTCAAGGAGAGCGAAGATGACGACTGGAGGCAGCTGGAAAGCATGCTGGAGGCAAAGAGACCTTTAGCTGAGGTCAAAGAGCAATTGATTCAGCTCATGTTCAAGCGGAAATTGCAAGAGTGGCTCAAAGAGAAGTCGCTCTTGAAAGATGGAAAGCGGGCGTCAGTCCATGACGATCAGGGTTGGGGAGTTTCACATTTTTCAGCCGCCCTTGGTTATGTATGGTCCATTAGACCTACTTTGAACGCTGAGATACCGATTAACTTCCGGGACGAAAAGGGATGGACAGCTCTGCACTGGGCAGCTTATTGTGGAAGGGAAGAAGTGGTTTGTGCTCTTCTTGAAGCCGGCGCTTCACCGAATTGTGCAACTTACTGCAATAAAAAGTATCCTCAAGGTCAATATCCTGCCGATCTAGCCTCGGAAAGAGGCCATAACGGCATAGCTGCCTTTTTGTCAGAGAAGGCGCTCACGGCGAGATTGTGTGGGTTGAACTTGGAGGATGGTACTCAAGTGGATGAAAATGCTGCGTTGCTGGCTGCTGATAAAGCGGTTGCCCAACTGGCTAGAAGGTCTAGTATTCGGTCTAGTGTCCACGTAGAGAAAGATCATGAGGTTCTGCAAACGTCCCTACTGGCAGTGCGCAATGCAACACAAGCGGCTGCGTTGATCCAAGATGCAAACCGACAAGCTTCTTTTAGAAGAAGAATGCTGCATCTCGCAGATGATGTGGTGGACGAATATGGTCTATCTCAAGCAGAAGTGCGCTCCATGTTGGCTGCCCAGAAAATTCAAAAGGCCTACCGTGGCCATCAAAAGAACAAAAAGCTCCACCTTGCTGCTACAGCAATACAACGCAAATTCCGAGGCTGGAAGGGAAGAAAAGATTTCCAGACTTTCCGGCAGCGTATCATCAAACTACAGGCTCATGTACGAGGCAGATTGGTACGTAAGCAGTTTCGGAAGATCCTGTGGTCAGTCAGTATCGTTGAAAAGGTAGTTTTGAGGTGGCTCCGCAGGCGCAATGGTCTAAGAGGCTTCCGATCCGAGTTCATCGAATTACCGACTAACAGTGATGATGACGACGACCTGATGAGAGAAGGGAGACATAGGAGCACGGCGGCCGTGGAGAAAGACGTGAGGAGGGTCCAAGAGATGGCCCGAGAGAAGAAAGCGCGAGAGCAGTACAACAGATTGCACGAGAGGATTTCCAAGGGTGAGCCTTACAATAGCTCGTATCCTGACCACGGGCAAGTCTCTAGAGATTACATGGTGGGTCAAGACTCTGTGATGACAACAGTGGAGTGA

Protein

>Mapoly0074s0081.1
MASMTAGRPRNLPPQPEVDVRQIIHEAQTRWLRPVEVCEILRNYRIHNFKLNPVPPTQPQSGSLFLFDRKALRYFRKDGHNWRKKKDGKTVREAHERLKAGSVDVLHCYYAHGEDNVNFQRRCYWMLDPSYEHIVLVHYREVTENNRSCIIRTMHDYNSTYHPPLASQHQHVSPTVSVLTNASLPSSVASPETVEAAGASLSPELDEAESAEPDEFEDPSLEIEGDQSGLQPSLLEQLGNQPLPGAHSASSSNQWPSLGRTAKNLGVTDGQFAPLFSHQDNRDFKPSFADLQQQRPQRMSSTSQSVNYPLLQNYPRDVGSIRQQFADMLDSPGPYPSSSQRSTSSINHSLDLSVLTSMIQDGNSGHAGNGAERFARPEVNSPPDWAGMLRQVTTPSTRRALLEGQGLNPGLGQSPHGKDTPPVLGTPISPKGIVDALSPRNLGRAPQTTLEANLRAVTEKEVLKEAEEKAQAQRTRWQTTQLTEPSPVDSVIHRNVDLSGGAQQMSANHFIEPDTLEHLVRSGHSNPDSFSTSGSNEKGSWMQQAPQQNEQPVHASQLYQNGNLYDHQSQPNQERVQHENLQPIVPPPHSTGFSFMDHSGLGNGDLFSPTEHYLKDVQSEEGAHREVIESYKKLDSFGRWMTAEIASDIAPYLMVEPGAWDNMQQMQMGGNLDPSPTEQCFNISDFSPEWGSSTEETKVLITGTFVGSITPTDHTWACMFGEIEVPAELVEGGALRCKAPKHEPGRVSFYITRSDRFACSQVREFEYRSAGTTNESTPTLLTGESSKIEETAEELRYKVRFARMLMATTTLSNCRMNSRTQTFKESEDDDWRQLESMLEAKRPLAEVKEQLIQLMFKRKLQEWLKEKSLLKDGKRASVHDDQGWGVSHFSAALGYVWSIRPTLNAEIPINFRDEKGWTALHWAAYCGREEVVCALLEAGASPNCATYCNKKYPQGQYPADLASERGHNGIAAFLSEKALTARLCGLNLEDGTQVDENAALLAADKAVAQLARRSSIRSSVHVEKDHEVLQTSLLAVRNATQAAALIQDANRQASFRRRMLHLADDVVDEYGLSQAEVRSMLAAQKIQKAYRGHQKNKKLHLAATAIQRKFRGWKGRKDFQTFRQRIIKLQAHVRGRLVRKQFRKILWSVSIVEKVVLRWLRRRNGLRGFRSEFIELPTNSDDDDDLMREGRHRSTAAVEKDVRRVQEMAREKKAREQYNRLHERISKGEPYNSSYPDHGQVSRDYMVGQDSVMTTVE

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>