Mapoly0075s0051



Description

HSA // Myb-like DNA-binding domain

Reference DB

Database ID Description
KOG KOG3227 Calcium-responsive transcription coactivator
OrthoMCL OG5_156505
PFAM PF07529 HSA
PFAM PF13921 Myb-like DNA-binding domain
PANTHER PTHR10799 SWI/SNF-RELATED MATRIX-ASSOCIATED ACTIN-DEPENDENT REGULATOR OF CHROMATIN SUBFAMILY-RELATED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB14 transcription factor, MYB Mapoly0075s0051.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0075s0051.1 scaffold_75:641575..665394  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0075s0051.2 scaffold_75:641575..665517  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0075s0051.3 scaffold_75:641575..665517  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0075s0051.4 scaffold_75:641575..665517  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0075s0051.5 scaffold_75:641575..665517  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0075s0051.6 scaffold_75:641574..665394  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0075s0051.7 scaffold_75:641574..665394  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0075s0051.8 scaffold_75:641574..665394  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0075s0051.9 scaffold_75:641574..665394  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0075s0051.10 scaffold_75:641575..665394  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0075s0051.11 scaffold_75:641575..665394  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0075s0051.1  

Gene structure:

mRNA scaffold_75:641575..665394  ( - strand )
three_prime_UTR scaffold_75:641575..641992  ( - strand )
CDS scaffold_75:641993..642115  ( - strand )
CDS scaffold_75:642627..642743  ( - strand )
CDS scaffold_75:643068..645041  ( - strand )
CDS scaffold_75:645209..645641  ( - strand )
CDS scaffold_75:645847..646056  ( - strand )
CDS scaffold_75:646207..646289  ( - strand )
CDS scaffold_75:646477..646593  ( - strand )
CDS scaffold_75:646841..646981  ( - strand )
CDS scaffold_75:647150..647230  ( - strand )
CDS scaffold_75:647484..647540  ( - strand )
CDS scaffold_75:647979..648205  ( - strand )
CDS scaffold_75:648571..648631  ( - strand )
CDS scaffold_75:648986..649024  ( - strand )
CDS scaffold_75:649169..649927  ( - strand )
CDS scaffold_75:650089..650172  ( - strand )
CDS scaffold_75:650380..650574  ( - strand )
CDS scaffold_75:657671..657955  ( - strand )
CDS scaffold_75:661720..661842  ( - strand )
CDS scaffold_75:662002..663628  ( - strand )
CDS scaffold_75:663929..664020  ( - strand )
CDS scaffold_75:664281..664335  ( - strand )
CDS scaffold_75:664437..664525  ( - strand )
five_prime_UTR scaffold_75:664526..664680  ( - strand )
five_prime_UTR scaffold_75:664916..665394  ( - strand )

Sequences:

Gene

>Mapoly0075s0051.1
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTATGAATTTAGGGTTCGCAGAGAGATAGGAAAAGGCTTTGTTTGCAAAATATGTGAGTGCTATATTTTCGCTTGCGAAGAGTGAGTTTGATCGATCGAAAAGCACTGACCCTTTCTAACGCGATAAATTCGCTAGAAACAATACTGTTTTTTTTGGGGTATTTGTTTTCGTATTATTTTTCCCCGACGTTTTTCTCGCTTGGTTACGACTCTGTGGATTTGTGCAATTTGGCAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGGTTGGGCGTTGTATCACTGTACTATGGAACACTCGGCAATTTCAATTGCTTTACTTGCATTTCACTTAGAAAGTAACCTCTTGGTCTTTGGTTGGTCACAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGTATGTTTACTGTATTGTAGCTTGCTTAGTTTTTTGAACGAAGAAGTTTCAAATGTTTAGATTTTTAAAAAATATAATTAAGTGCATGTATTTAGCTCAACTTGCAAATTACAGAGAGGTAGATCTTGATGGTTTAGTGTCATCACTAGTGTTTTAAGTTGCACAGGCTGTTCAAAAGTGGAATCTGAATACGTTGTTTTCTGTATCCATTTTGTTTGCTTTTCTTTCTGCTTATGTTCTCAATAAGCTTATTCGTGCAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGGTTCTTACATGACTTGGATTGCTTATGAAGATGGAAATTTTTAAGAGCACTAGAAGAGTGTAGAACTTTCACTATTGACTGCCTATGTATTTTCGACGTTGACTGTTGAGGTGTATTTGTGAATTGATCTGTTCAAAAGTGTTCATTCGAGCCCAAGTTACTGTCAAATCAAAGGGCCTCGTTGTACCGTTCAGGTTATGTCTACGTGTAGTTTTTGCAGACGATGGTTGTGAAGAAAACAAGTGTTGCCTATACATTGTGCATAAGACAGAATTGACCTCACATATGTCTTTTTGGCAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGGTACTGTGGATGTGTTCTTCCTCATGAGTTTATACATTGAAGGTCTAACTAGTGTTCATGGTTCAAGCTCGGCGCTTTCTGGTTTCTTCTCAATTGTCAAGTTATGATTTCAGTACAAGTCTCAACTACTAATGAGTTCAGATTTGATATATTTCCCAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGTGCATTTCTTCCTTTGATTGTGTTATAGTAGTCTCTCTCGTTTTGGAACTGGGATGGTTCATGTACGCTTTTGCGTTAAGCATGCGCAAGAACTTTCTCTTATCCCACAAGTTTGATGTTAACTAGTCATTGATACTACATAGTCACATACATTTTCTGACTACCAAGCTATCGATTTACATTTTTCTTCCATTGGCAAGTTAGCGTCGCGTACTCTCAACCTCCATCGAACTCCAGTGTATGAAAGATCTTTTCTTTGGGCTGCATCTAGGTTGCATCCAGTCGTTGTATTCACAACAGAATTTAATGGAGTGGAACATATTTCAACCATAGTCCCGCTAATCGCATTGAGAACTTTACTTGATATTGCTGGGCAAATATTGTATTGTATATCAAAACAATTAGTAAAAGAAAATTAACAGGGGAACTCTAGAGTTCTAAGACAACAGCTCTCCCTATCAAGATCATTTGCGCATGATCATGTACGTCAATACTCCTAGTGTTTTGTTAAAGTGTCCAGAACTGTAAGTCATTAAAGTTTCTCATTCTCATTACCATTGTTTCAGTCCTGTACTAGACACGGACTCTGTCAAAATCGTTGAACGTATTCACTTGAAAATAGTCACTGTATTTAGCTGTTTAACGCCAGCCTTAGCTGGTTTCATCCACCGGATATCGGTGGCCGTATTTTTCTCGCCCGAGCCTATCGACCCCCCGGCTATGTAACAATTGTGGTCATGAATCCAGCGTTGCTAGTGGAGTCCAAGAGTTGTGTTTTACCCTACTCCTGGAACGAGTAGGAGATGAGTAGTAATTGCTTGTGAACCATGCGGTTGATCATGCACGTGATAGCTCCTAGTGTTTTGGTAAAGTTTATGGAACTGTATATCCTAAGCTTATCTTATCATATTTACCATTGTTTCAGTCTCCTGTACTACACGGGATGGTTGAACATCGTTGAACGTATTCGCTTGAAAGTACACACTTCAACAGTTTCACACCAGACAGTTCTGCTTTTATCCATTGTAATATTGATGGCTTTGATTGTCGCGCCCGAGCCATATCAGACACGGTCAGAGCCATGTAGCCAATGTGCTCATGATTTTAGCGTTGCTAGTGGAGTCCAAGCGTTGGAATTTACACAATTCTTGGAAAGAGAAGAAGAAGAGTATTCCTTGCGTGTTAACCTTGCGGTTGATCATGTACATCGTAGCTCCCAGTGTTTTGGTAAAGTTTCTGGTACTGCTAAAAAGTTTCTCATTTTTATTACCATTGTTACAATCCTGCTGTACCAGAGACCGGATGGGGGAAAATCGTTGAACGCACTCGCTTGAAGGTAGGCACGTCAAGTGTTTTATGCCAGACACCGTTGCTTTTATCCATTGGATATCGATGCTCGTAATCCTTGCACCCAAGCCTTATAGACCTGGTCACGACCATGCAGCTGATGTGGTCATGATTCTAGGGTAGCTAGTGGAGTCCAAGAGTTGTGTTTCATGCAACTTTGGGAAGGGAGAAAATTACTTGATGGGACCCCTGCGGAACACAAAAGACTTGCTGATACACAACACGATTCATTTTACCAGATGGGACCACCCTACGGCCATGCAGCATTGGGTGACGTATCGGGTGACGGCAGCCCACCGTCACCCAATACGAGTTCTGGGTTAGGTACAACCAGTGGGTGGATCAATCAGAAACTTTGACTCCAGTCCTTTGAAAGAAACAGCCCCTAACTTAAGTCCCTCAAGTCCTCACGAAGTTAAGCGGTAACGGTACACAACATAAATTTGACAGTAACAGTAACTACATTCCTTCTGATAGACATACGCATGGGGACTTCGATCTCGTTTGCAACGTTATGATACCAACATAACAGCATCATGGTCTTGAGTTTGATGATTGCAACGCAATTTTCTGAAAGAAGCTACATCCAAAGATGTCGAAAGTTTACACTGCAAGTTAGCTTACTTAGTGTATCGGTTGTGAATCCTTTCAAACACAGTTTCTACTTGTATGCAAGCGACGCTCCCATCGCATCCGTCAGAGGCTTCATCAAGAGATCATTCCTTGCACAGACGAGACCCTCAATCTGGAATCTCTGCTTTGCGTGTAAGTTCAGTAAAGTTCCTGGAGCCCCTGGGTCCCAAGCTTTCGTCTGGGGATGCTGGAAGATTCTGCCATGGCTACACAAAGCTTGATTATCGTTCCTACTACTGTCAGGCTCACTGAATTGATCGTGAACAAAGTTCAGTGATGACGCTAAGGAATCACTGAATTGTGACGGGTTTTGCTGCACCTCAAGATAGTTATACGCTCTTTTCATACAGGGATTACAAGCACTGTGCCCTTTTGGCGTGGTTGATTGACCTCTTATAAGTAACCCAAAGTGAATCGATTTCCACGCAATGCAAATTCTTCATTCTGTCATATTGAGCCAGCCTATTCCTAGACTGGTTCTTCGTTCTTATTCGACGTGGTGGAAGGACGTAGGTATTCCATCTGGTAAAATGAATCGTGTTGGGTCCCAGCAAAAGCATTTGCTGGTACCCAACACTCCGGTGGTGCAGGCTTTACTCCGGTGGAAGTAACGGCCGTATACACTTCTCATCCCATGATGCATCTCACGGATAGAAGTGCAGAACTGTATCTACATCGGTCCTCTTCTAATGCAGATTACACTGGAACAGCTACGAGAGACTTTCTCTCCCTCACACACAACTCGACTTCTAACTTTCGTTTTTATTGACCTTTGTTTATGCATATCGTAGAGGTATTACCCTTCAGTTGTAAATATAGAGTTTTCCTTATCAGTTTTGATCAGGTTGTGTCTGCGAGATATCTTCTAATATTTGGTCAATAGCGCACAGAAAAACAAAAAAAAACATGTGAATATTGTTGAGCTTCACTCGTGTGTTTCAAATTAACCTCTGGGTAGCTAAGTTAAGTTTAGTTAGCTCACCGCCTGGAGTGGGGTATTTAACCCCAGATCTTCTCGACTGTAATCACTCTCTTCACATGTTAACTATATGCGCTGTATTGCACGCGCTCACTTTGACTGCACAACTATGTTGTGATTTCACCGTAGATGCTTAGAGTCACTGCGATCAGGTCTTCAAAATCGGACCCGCTCAGATCTTGCTGTACAGATTCACATCAACCGTGTACTGGAGATAGACAAACGATCCAAGGACGCATGGAAGCATATCGCTTTTGAGACAATTAGGTCTGAGGTCAGAAGCCCATATTCTAAGGGGTCAGTCCTACAAGGGCGAGTGGAAGGGGTTGAAAGGTCTGAAAACAGTAAGCACATCTAATTATAAGGCAGATAATGGATGGAGAAGAATTCTTGTGTGATGTGGTTTTAGTTCATTGCCACGCAAAAGGTAAAATCAGCTACATACCCCGTGAGACATCTACCAGCCAATCAAAGACACCACATGTTTGACAGTCTAATATTCGTGGATACATCTTGTTGATGTTTGTAGGTTAATCCTCGTAGTTTCATAGTATATCTTTCTGACTTATGGTGAACTAATAAATACATGTTATGGTGCTTTCCTCTAAATTCGTCTTTTTACTCAACACAGTGCTATCTTGCTCTTATGTATTATTGCTCTACCATGCGTTTCTATGTGGGCAATGCCTGTTTTTTTTACGTGGATGTGTTGGAGAACACATTTTGTAACTCACAAATTAAATTTAAGCTATACCATGTTCGGATTTAAGAATATAATGCATGGTTGTATTGTTCTGATCGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGTATTCTTTCTTGATATACATAGTGATCTATTTTGTTTCAATTTGATTCAGCTCAACATCCCCATCCATAGTAACGGAAATTGATTCCATTTTACATGGTGGACTTAACATATTGACTAGATTGTATTTCCTTCATATTGGGAGTAATTACAATTCGTTCTCACAAGTTTGATTATTTTCGTGTTCAGCATTACATTGATCACTCTTATAGTCAACTTCATGAATCCGTACTAAGAGCAATCAATGCAACTTTCTTCCACCTAAGTACTCGAGTCATCCGGTGATATATTGAATCCTTCTGTTATTGAGTGTGGTTGTTTGTGGTCTGGTTTGGTCAAGTATTGTGAGCTTCTTGTTGCTTCATTTTGATTTTTAATAAAAAAATGTCTTATATTAAACTTCTGATCGATCACTTGTTTGTTTGAATGTAGAATATAGTTTAACTTGACTAAATAAAGATATGGCTGTATATGTTGTAGGAAATTTTGAACACTATATTGGCCTTTCAATCATGTTATGTGAAGGATTGGAATTCATCAAAGTCGCTTATTTTAATTCGCTATAATTCATAGTTTAGGCAAAAACAGTGTTTAGTGTCGGTGGTGGTCATATTGATACTTGTGGAATATTTTAGTATTGTGTGATCGTTATCGTGGTCTGTTTGTTATTCTGAATTTTTGGTTGAACTTGGTCAGATTCGGTTGGATGAATCTTTACAGAAATTGTAGAAAGGTAGTGTAAAAAGGTCGGTTAGATTCATCTAACCTGAAGACATTGGAGGTAAGGTCTGGATATGAGATTAACCTTCCCTTGATGGAATTAATATGAGATGTTGACTGAGGTGTTGTTTTTTTTAGATATTGAGATCTTGGTTCATACCTTTTTCTTGCTAGAATGTCCCGCTCTTCCTTCCTATCTTCTATAGTTGACTAGTTGTTACAATTCTCATATACAACTTTGCTGTAAAGTGCTTGGTAGATCATATCACAATATTGAAACTGATAGAATGGATTGATCAATATGTCTTATGGTGAATGTCATAATATTCGTCATGATCATGACTGGTATGATGATTCAGTAGTAATCAGTAGTAATCGTGCGGAAATTGTCGCGGTAGGATTCGTTTACATTTTCGCGTTTGTAGGTGTATTTCTAGACCCCATGTATCCAACTCGAACCAGAATGTTATGATGGGTATTTGTTTGGTATTTATAATGACTTTATGTGTTGAATTTGGTGGTCCTAGAAAACAAAATTTAATTCAACCTATTTTTGTTCAATGATAATTAACTCCCAATATTATGGTAGGAAAAACTGCGCGTGTAGATATAGGTATTTTATTATTCCTTCTTGGATTTAAGTTAGTTAAATATACCAATTTGACATTTACATTCATGTAATCCTCCCATCAAAAACAGACACAAGATCATGTCGTGTCATCGATGCAGTAATCCATGCAGCCAGATATACGAGATAAACACAAATTGTAGAGTGCTGCAATAATTCATCCTTCGAGCATTCTTTATTCTAGAGAGCTGCAAGAATTCTCTGCTTTTGGGCTGATTATACAATCCTTATATTGAATTATTACTTCTCATTTGGAATACACTGTGTGCACTACATGGAATTCCAGTCGAGTTTTGCGTGAGATAAGCTAATAGCAAACCTGGAGGTTGACTATGTTCTGAGTTTGAAGATCATATATATATATCACTCTCTCTCGACTTTTATATTGCGAGTTGTACAAATTTTGTTTTCAATACGATAAAAAACTGTATTTTCAGATATAACTAGATCCAACTACTAAAACACACAAGTTTACCACCCTTATATCTGCGCATACCAATACTTCCTAGAAGTCCAACTTAGAAGTAAAGAAGATTGTAATTTTTAGAATTCCAACTTATAAATAAAGAAGATTGTAATACCTCTATGTAGACAAAATCATATTTGTGCTCTAGTTATCTTTCAAATTTAACATACTTGATATAAAAAAGGGATGTTAAATTCACCCCGAGTTGTTAAATTCACCCCGTCACTTTTCATGGCAACAAGACATGTCAGAAATTATTGTTTCTTCTCGTCGCGTCGAGGATTGGTTTCGGACTCTCTTTCTCATTTTCTTTTTCTCCACTGTGCACAAGCTGCTTTCTGTGGTGATTCTTGATATGCATATGGAGGAAATAACGGAATCGGCTGCTGCATGGTTTATTGTCCGAAAGTATCGTGCTGGATCTTAGAGCTGAATCTGCCCTTGGATGTGACCCTGATCAAATTTAAAAGAGATACTGACTAAATTCAGAAGAGAGATGCAACGTGTGAGAACTTGGGTGATGAATTTAACAATCACCAATATAAATATATCAATATATAAATTTCATCAAGTCCAACGATGTACCGAGAGTGTAAACCTCTCTCTTCTCTCTTCGTTTCTCTTGTGTACATATGACAATAAGCACTTGGTTTAGTAGGTATGGAGAAACACTCTCTTGTACTGCATTTTTCATTTTGATTCACGCGCATAATTATATTTTTATTAACTAGATAAGATCTAATTTTTTACATAAATGAAATCTATCCTCCCATAATGATGATGTGGTTTTCTTCTCCACCTTAACTTTCCAACTTTCTCAAAGCTACTTTGAAGACTTAAGTTTATATTAGTGAATGGAATAGTAAGCTTTCAGTTACAATTTCATTGATGCCGGTCACTCTTGTAAGAGACCTATCATGTCGACAATTAAATAGTTCCTACTATTTATCTCATTTTCATCTCCTTGTTTTTATGTGTATGCAATAAAATGTAGTCATGGTTTGTTTACCCTAGCTGGCATTTGTGATCATTGATTCTCTTGCATGTTACATCTCAACGATCTAAACCTTTAAAGTAACGTAGTTAGACTAGAACACAGTATCCTACTCAGATTTGGAAAAGACTGGCTGAAAGATAGAATTGTAATGGTTGCAAATGGGAATGGTATGTAGTAAATTCAGTAGATATTAGTCATCGAGATTGAGTGCAAAGCATTATATCCTTTGGGTATCTTGAAATAAGTGATGTTCTTGGGGAGTTCAACTCCTTCTTCGAGTCCGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGAAGCACATGAACATCAGAGTGATCCCGTGGCATACTGTCGATAGATTCATCTATACATTTTTCACATAAAAATCTGGATGATAAGCATTATATCCTGCTCTAGCTGGTGCAACACATCAACAACAGAGTGATCCCGTGGCATACTGTCGATAGATTCATGTATACATTTTTCACATAAAAATCTAGATGCAAAGCATTATATACTTTGGGGATCTTGAAATAAGTGATGTTACTGGGGAGTTCAACAGCTTCTTCGAGTCGGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGCAGCACATCAACAACATATAGATTTTTCACATAAAAATCTGGATGCATGGGAATAGAATGATGACTTTATAATAATCTTTTCCATTAGATTCTTGATTTGAAAAAATGATTCATAGGGAATGGTTCTTGGAAATCTGACTATAATATTTTTTTTGGAAATCTGACTAATATTTCAGAAAACTCTACCGTCACTAGGAGTGACACGGTAGAGTTTTCTGAAGAACTGTTTGTTCACTTGCTGAACAAACAGTTAGCACTAAACAACATCAGTGAGCACTAAACAACAGGCTTTTTCTTGCATGATACTAGATATTGCATACTATTGACTGCGGTTGAAACTAATCCCAACAATTTTTTTTGGTTTGAAATTCAACCATACTTTAAATATTCGCTAATTTACTGTTCGGTCCCTCTCGCTCCTCTCGCTCCCCTTCCCTTCGATTCCTGTCCGTAGCACCCCTCGCCTCTTTCCTCTTGTGGGTGGAGTGAGTGGGGGCGCCAGGCGAGCACGAGACAGGATCAGACCAGAGTGGGTGCGGTGTTCCTGTCAGAAGGTTTCTTCCTTTCCACTGCTCTGTTCTTCTCTGCTCCTCCCTCTGCTCCGTTCCGTCATCCTCTTCATCTTCTTCCTCTTCCTCTCCTTCTCCTGCCGCTGCTGCATCTTGAAAATCCGTCCGGAGTAAGGTCGCGAGTTAGGCTGCGCGTAGTTTTATATGTGGACGGTGGGGGAAGTTTTTCCAGCTCGAACGGAGATCCTCGCGGGGCTTCTTGAGCTTCATTTCGATCACTGGTGAGCGTCTAGCTCTGTACTGACCACTTTCCTGTGATGTTGATGATAATGATGATTATCACTCAAGTCTGTGTCTGTCGCTGGGTCGTTTGTCTGAGTTCCCTGCGGTCACTCTTGACTCCATAAGGTGCCAGTGCGGGGGTGTGCACTCAGTATAGTATAGGATGCTGCGATGATTGGGAAAAGAAACGAAGAGTGGAAATGGAAAAGCTTGGCTCGAAATCTCCCTGGCGCCGTTGCCTCTGCTCTGATTTCTTTCTCGAATCAACTGTGTGTATTCTTGATATGTTCGTCTCTTAGAACATCTTTTCTGAGAGCATCCCGTCTGTTTGCTGAGTTTCTTCCTATGTTGGCATCATGGCTTAGGATTCTGTGATTTCTCTTCCTCCGATCCTATTCTTGTATTATAGCTTTTAATCTTCCCTGGCTCGCTCGCTCTCTCCCTCCTTGTTTTGTGATGCTAGTTTTGCTAGGGGTGTGTAGATTAATGATGTTGTTAAGTTCTTAGTTTGCACAATATTGCAGTATTTTCATCCTTGGTTTTGGAGTAGTACATTTACATTCTTCATTACAATTGTGCTTAAATTACCATTAACAACTAGACTGAGTATCCAATTCTTCTGTTTTGTGTTTGGGATTGAAGTAATTGTTAATTTTCTTGACAATTGATAGGGATTGTAATATTGAGTCCCATAGTGAATTGCATAAGATCCATAGTGAATTATAAATGAATATATATACTGTTCAAGATACAGTCAATATACGTATTTGTAAATCACCATGGGTCGATTGAGATGCAATGCTTTTAATGCATTTACAAAATTAAATATTTCTCAAATTTCACCTCAATTTTCTATCAAGTTTTTATTTGCTGATGGTATCAATTGATTATGTCATTTCTTACCATAGACAGTATCAAAGTAATGGGTTATATCTTATGGTTTTCTTATCTTTAGCGATCAAATTTTTTTTTAAACTTCTCAATACTTATAGATGCTTTGTTGAACATATTTAATCGTGGTGAATGAATATGTACGCTTCAAAATGTAGGCTTCGCAACTAACGGATAATATTTTGTTTCAGACCAATCTTTGAAATCTCTGCTTTGTATATGAAATCTGCTTATATTTTATATAGGGGAATGTTAAAACAACCACATAAATTGTTCACATGATTTGTCAAAAACAATTTTTTTCGCATAAAAGCTCAAATATCAGCTGCGAGTGTGTTTTTGACTTCCCCCTCCTTCCTGTGCAAAAAACACCTTCAGAGTTGTTATCTCACAGGGATCATTGCAATAGTTTCAGTCAGTAGTCAATAGTCATTGTTCTTGAAGTGTGTACGTAGAAGTTTGATTGTGTCTTCTGCATATATGCAGCAATATGTAACAAAAATATGCTTGGAGATGATACTTGGGCTTGTGTGCGAAATATCAATTTTTGACAGGAGACTCGTCCGTGGTAGTTTTAACATTGGATGTGATCGTTTAACATTCCCCTTTGTATATTGCTTAACCCATTATGTTGGAACTTTTTCCAACATAATTGTTTGATAGTTTGAACAGATAGGCGAAATTGAAATCCTTTTTTCCCTTGGTTGAAGATTTTATTTTTACTCTCTCTGATCTCTATGCTTCTCATTCAAAGGTCTGGGTATATGAAAGGTAATCCGTTTAGGATTTATATGGATATATCTGAATGAATGCCTCCACGGGGTAGTATTTAGATAACAATCTTGTAATTTACATAATAACATTGTAATCATCATGTTTTCATTGGTTTGGTAATATCAATAATATAGCTAATAATAGTTTGATAGCAAGAACATGAAGTAATGCGACATCAGATGCTACTGGTATTTGTATATCGGTGCGGAAATTGTATGTGATGTATGACGTATCTCATATTACAGTAGCCTCCCGTTTGAACGGGAGGCTACTGTAATATGCATCAATAGTACGCATCATTTTCCCCAAAAAATAGTTCCAAAAAATAGGGTTCAGATTTATTTAGTTCAACGTGTCATATATTTTCATTTGGCGCAAGTTTTGAAGATTCTTGCGTTTGAAACCTGATTTTTGGTATATATTTTCGGCATTAGAAGGCTGTATTTGGGTAGTAAGCCATAAAACATAAGCGAGTATCTTCCGTATTGTATAAGTTTTTAGCACCATATTGGTAGTCTAAGGCTTCCAGCAATCCATGATTGGATTTGTTGAATTAAGCTCTCTCTTCGTGAAGCATCACCTTTTGCAACCCTCGGCGATTTGTGATTGACTGAGACATCAGCCATTACCATGATTCCTTAAACTCTGTTTCTGAAATGGGTAAACTCAATGCAATACTTTTCGCTTTGGCGACGGCGGAATAGATAGATTGGACGTATTCTGTATTAACAGAATGGTAAGCATGTCTTTTAGCTTGGTGAAACAACCAACACAGGATTGAAAAGTGTTATCTTTAGCTTCATAGATATCAAGACAGATCGCTTTAGGGTTTGCTCACACATTTCTGATAGCTGCTTCACTAGCATCGGGCCAGAGCCCTTTTACTGGGAGTATCGTGGTAAGTTTTCAAATGATCGATAAGAGCTGGTTGGTGTTTCCAGGTTGTTTACCCTAGTGATAACTATCTGAGATAAATTAAGTATGGAGTTTTCATCATCCTCATCAGATTTTGTTGTTTCGAGCTTTTTCAAGTGCTCTTGTATTAGTCCCGTCACCACTTCAGCTGGCTAGCTTCAAATATTTGCCGAAGCCATACAGTAAGACAGAAAAATATGCAACTCCACTATCTCTTCTAGTTACTTAATTGGGTCAAGTGGCCTCCATTCCTCGGATTTTTAACCGAGAATCATCTCATATGCAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGTATGTTTGGATTATATGCGACCTCATCCATGCTTGTAAGTCCTTATCATTTGGTTGCAAGTTTGGTTATGGTGAAGAGTCCATACTCCTGGTGGTTATGGTGAACAATGGCAGTATAACAGTACAATCATTAATGCTCAAGTTGAATATTGAACTGCATGTAATCTCCTGATAACCTGCTCCTTTGGTTGGTTTTTTTGGGTTCAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGTAAGCTTTCCGTGGGCTTTATCATTCTTCTCGACATTGATCAGTTATATGCTGAAGTTGTTACTTGGTGTTCATGATTTCCAAATTCGAGCAATGTCTTGGATCCGCACGAAGGTGTTCATTTAAACATCACTCGATGTTTCTTTTTTTGTTTATTGTAGGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAGTACGTCAAATGGGCTTCTTATCTACTAGTCTTTGTCTATCAGTGTATCATATTTCTCCGTGTGGAATCTCTGCTACACTTACAACGATAGGACTCCTTGACAACACTACTTCATGCTACTAATGTGTTTGGCTTTATGTTCAGCAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGGTTGGTTTTGTCTTGGAGACTGCCCTAACATTTCGACATGGTTGCATGAAGTATCTGCTTGATTGTTGGGGATCTCTTTCCAAGCCCCTTTACAATTATCAGTAAATTTCTGATGTGGTTGGGAAGAGTAGGTACTAGAGTATAATAAGCTGCCTCTGGTCGTGACTAAAATACAGTTTTGGTCAATACGTGATTCTCTTACAATGTTGCCATCTACTATTCTCTTGAAACCATCCACTCTTTGCAGTGGCTCTCATGGATGCATTATCTTCTGGCCTTCTGTGTACCATCCCCAACTTGAGTCTCCTAGTTTTTTTGTTAGTCTTCAAAATTGCTTGATATTGTTGTGTTCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGTATGTTTTGTCACTTAGTTTCACACTTTACGCGGAGTTCAAGTTTGTGTCGTATACTTGGTGGTTTGCATGTTGTCCATTTATAACTGGAGAGAGGATCTATTCTGGACTTGACCACTCATTTCACTATTTACTATTATTGAAGTGATTGTGGAGGATTATCATGGGGTTGATACTGATCTTTCGTTCACTTGAGTCTTCACTGTCGAAATCATGATTTAGATGTTTTGGTATGATCAAACTGAATGTAGTCAACGCATCTTCGTCTTCTGAGATTAAATTTGCGATGGATGATGCGAGTTACATACATGCAGTATATCCTGAAAAGAACGCTAGAATTGATTGTGTGACTTCCCGTTGTGCAGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTAGAGTTTCATAGAGGTGGTCTTTATTGTGTGCTAAAATCTTATAACGTATAAATATGTGATCAGACCTAGCATGGTTGTTGCTTGATTTAGCTATGTTGTTAAAGAAATCATACACTGTCCAAAAGTTCTAGCGAGAGCATGCATCAAGTACAAAGCATTAGATTCAACCTTTAACCCATTTTATTTTCATTTTCTCGCAAGGCGCAGATAATTGAAAATTTTACCTTTGTATTTTTTCAAAGTAGCAAGAGTTCACAACCTTTAGGCTGAATCCGTTCTTTGAATTGATCGTAAATGATGAAGTGTGAAGTGCATAGGGGTTAGAATTTATTGCCTAATCGAAGACAAGTAATTTCTTTTTTCCTGTTTGTGTTTTTGGGATTACTTACAGTTATTCTCCTTTATATTGCTGAGTTTTAGAATTGTCTGTTCCAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGTTTGTTTTAATGCTCGAATATTCAGGGGAATAACACACTCAGCTGAGATCTTGATAGTTGTCTCAGTTTAGTCGTCCTTTTGTTGCTGTTAACTTGAGCATGTGGTTTGCAAGTTAGAGTGTTCAAAGGAAGGTCGTCGTAGGTTGATCTAGAAATCTGGGAGATGATCGCGAAGACAATGTCTGCAAACTTCATCAGAATCAAGTCAGAAATAGAGGAGCTAATTTTCTCGAGCAATATTTCCATTTTCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGTACGTCGTGCGTAATGAACCATGTTGACCTCCTTGGACGAATGGACGGAATGACCTTGAAGTAGTCAACCAGAACTTATTCAGAAGGCTTTCTCTGTTTTGGTGCTGATCAATTTCTTCGATGTCGACATGTCTTTATGAAATGCAATGGCCATCGTTGATCAACAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGTGAGGTCCTATATGCTTCTCTAAGCATTTGGGTGGTTTCTTGAGCAAAGGACGCAGCTATGTTTTGAGGTCCCTTCTTGTCTTTCTAACCGCCGAGTACAATTGGCTGGTTCCGTGAGCTCAGCACCTCGCTATCTGTTGTATCTTTCTTGTTTCTCCTTCAACGTGAAGATGATGGTTCAGATTTAATCCGGTCATGTTCTTCACAATTCTTATTTCTTGCTGAGTTTGTCTTTACGTCATACAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGGTAAGGAGTTTAGAAGAAACCGTCAGTAGGAAGCTGTCTAGTGATATTGATTCACACCTTGATTATTGTTATATTTACCTGATAAATTCTGTTGTTTCCGCTTTTGAGAATTGTGTTTAAAGTACACAGTCTGAACCTCATTTTCTTTTGCCTTCGATGGACAAACTTATTTCTATGTTTTTGACAGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACGTAAGTAAAAGACAGAACTAGCTAAGACAAAAGTTTCTGCAAGTCTGGGGTTGTTTATTTTATTACAATTACATGATGTGCAAGTTGACTTTTGGAAAAACTTTTCGAGATCAATCGCTCACTCTGTGTCTTAACGTCTGTTGAATATAGTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGTGAGCTTTCCAATTCTGTTATTCTGTTTTTCTTCTCTTGACCAGCTTGCCGCCAAAGCTGCGTGGTGAACTTTCATTTCTTGTAAAGAGACATCGAGAACTGATTCATTTGGACAATATAAAGCAAAAGGCAGTATGAGTAGTGGTCGGAGTCGGTGATGGCAGTCTTTGCCACCTCATATTCTGAGTTTTCACGGGATTACAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGGTAACTATCTAGTCTGAACGCCCTTGAGGATAACCACGAGGACGTATTCGATGCTTAAGTAAATGATAACCTCTTGCATATTTTACTCATTCATGTGGCCGTTATCCCAACCCTGTTGTATTATAGGAGTATCTGAAATTTGATTCTTTCTTTCATGACCTTTACAGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGGTAATTACATGCCAAACGTAGTAAGCTCTAGCTTCACAGCTTGTGTGGTCAAACCGCCTGGATGTTCTCTGTATGTAGGTAGTCCCATTTGTCAAAAACACGCAACAAATCTGCCGAGGAAAGTAGAACAACAATGCAATATTTACGTATTCTTGTTAGAAATTAGACACGTTTTACATTTATATTTTTTCAAGGAAAGTTGATCTCATGATTTCAAGCTTGCTTCGTTGTTTTTAACCCACATTCATCTTGAATTGAATACATTTTCTGGTTTAAGTGCTAAAACTTGGTGGGAAAAATCTAATTTGTTCTTCCTGGGAACAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

mRNA

>Mapoly0075s0051.1
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAACAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

CDS

>Mapoly0075s0051.1
ATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAACAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAG

Protein

>Mapoly0075s0051.1
MGAGAGAAAAIENEPSPRRAAIEKAQAELRREVAVREERRRELEFLEKGGELLDFFSAANFALPPSSPTDPLADQLLSSEGEGGHASVALTNGDSVENSVGTSLCVGRSSEGGGDLCPGEDFLSAVIEPLTPWEGKGRASRTGSTSLRSHSDVNLKRESEGSGGGRAAVKGQAYSRRNRPRSNRFGNGHTPTRDVEKAGEVGVLPSIEIKGSPAPPVIFEEVTEENETMVDKKLQVLPAPTLLYNSHASTQLGPVTTKVIEDLEATHLPTGKSFEQNSVKAVHAADDALQTGREFQIHDLAASSCGSLQRSSDLREDVCTGIVVKDELVVVGDLKKVDQTSLSPHVEKNVDSRDGGAVSQPSEQVLGNNQAASDKACGLPSMVEDESAIVMIMDESLGSRTSKNECKDKSTVVSETKGDRVIDRSTIITKHGPDSMLTPTIDDKTSVLREVSCTMQLTPKSLDTSENKSIISRKTTSTASSGAPDLIQNDKARIDDPPSDARVEVKVEEGLSEVGTRLSTVDTQVESGHDVKSICVVSLPQEEIKSESQSTPVSAGSNRAGFRTPNSNTASINKFPGVVLPWEKERDPNVRAEAERHKADLSAKARKAHEDYILEEAEIIKKSKKDTAEWAKRSPHLEPARRKSHWDYLLQEMAWMANDFMQERLWKLASATQFCRWIAEQRGQSSVLQLAGIKQRQERVARVLANAINEFWRSVEYIIHKDKRLTLSSLENQESVVAMKEDSEAVPMDVDIPSIPEGSTQRVEKLPSRSRKPLPVQNYAIRFLKESMGSDVGAQAEAPCTPERISEANSVLDPLWEDQFPEEPLFYLVPDGASRAYRILIETERSSLEIEHEQTLHDHAAAIADAEAVAEAAANADFNVSLSVGEGQPLSVLSSPMKGLRAEEDELGGQFLPNALSSIAKKKRKNILKSNASKGEGISSSGPTHRPPIAPGLDSTAVVQSPLVTGKRSLSVGPGNIVGNVGSIPTKRMRSVSSARQRVMGTASPNSFPSPGGLLQRTIFSSGALNSHQDEVRNLCDDTATRIEADATTVSVKNGLGAGCNNSFVNSKSKKKKKTKHFSGQLSSVNAVKGDGAPSVNTASSTKQTPEAEHRSVFDQLKRKGDQVNAASVELDTGGIGSSADTPETPSSQGQQPSKKAKVSKQASDLNPEAAAAAISTAATQSGSLVANTSSTSKLLRQNSNRDRNRKTKSTKVPLTQPAGIGIPWSTIEDQAIFALVHDLGPNWELVSDVLSSSSQLKGIFRKPKQCKERYKSLLDRMSVGEGGDSPEDPSTSQPHPSTLPGIPKGSARVLLQRIQGPMEEDTLKVHLEHIVRVVHKFRALKPPTEEQKLLVQPHASHLNAITQFCANGYPTPSDLCEITAAAPELGGPAYQLPGQHLPGVLAAGSGIRPATNGLPVLPSASNLHMGVPAVAPSTTAASAARDAAVYRDVHRLAAIRPFSPEDAQRVRYHRAMAAARGLSVSGPTVTAGLPMMGLPSPSDCPVPLLGSGNNNIGMMGGISRGMSLSRPGLPGMGSPGVPGIGPPPLGSVLSTGGVGIVSAGPTVGPTVVPQQVNLIRRSREQQLVRPGRSNEDQRRFIEELKHQAAQGNTQAATALSSLGSEVTREMMAVQAQPFQQLQHQNHQQQQQQQQYLAARMAKERQMQQQQKQRLLQQQLQQPQQPSSLQPQLQTQMQQQQMHGMSQQHVLPQQSHLSQQQHLLSSQQHNLQKQQSQQGPQQTGTLSSPSLQPTTIPSMQSNHQQHQTLLQPQQQAPPLGQVQQLPVQSKLQPPKQAQKHPHLQQASQVVQQQPPRGSKGVVRGNMLVQALPGSGQSSMLPGNVSAGSQPQQVAGQQIAHSMQGQRHLMPLAKPLSQTSTQVMTGQSAHMQAQQNQSMAGPVPQGSLGGSQKVVSQQPTQLGTMPSKQLQPSPLPSALPSQQQSPAPPLPTQQQQTSPPAAQQPQIGSSQQLQVQQRRPSQQAQIQSAQRRIQQRQPVASVGAPMIGVLGKNGSSTQQGQVPAQMSSQPGHVTYTQGSSMAVPMSMMSASSGASGLSSSGSPSSSGVHSTPWKPGQVVSPMSSGFYNLSRSGSPGAAQLPSIVSSSGMHLASSNGNSGMSITGSGPPHGVIVGSLSQPLQVGSGGHGLKMGLVTGSNPRGVSTTLQGGTQRSIQHHGNLPASPAIGATQQVRSPVPASSAGMMPVSALGTNTVAGVSSSGSMAYQANSSSLSGHSTAISNSMHMFSVQPRQSHAGSAAATTPAVPMKSPPTSGTSQTSAVSPSSPAPGGIQDFKREGAAGNHQDQSLEAVDKLLRKIGDVEYYKTLA

Mapoly0075s0051.2  

Gene structure:

mRNA scaffold_75:641575..665517  ( - strand )
three_prime_UTR scaffold_75:641575..642569  ( - strand )
CDS scaffold_75:642570..642743  ( - strand )
CDS scaffold_75:643068..645041  ( - strand )
CDS scaffold_75:645209..645623  ( - strand )
CDS scaffold_75:645847..646056  ( - strand )
CDS scaffold_75:646207..646289  ( - strand )
CDS scaffold_75:646477..646593  ( - strand )
CDS scaffold_75:646841..646981  ( - strand )
CDS scaffold_75:647150..647230  ( - strand )
CDS scaffold_75:647484..647540  ( - strand )
CDS scaffold_75:647979..648205  ( - strand )
CDS scaffold_75:648571..648631  ( - strand )
CDS scaffold_75:648986..649021  ( - strand )
CDS scaffold_75:649169..649927  ( - strand )
CDS scaffold_75:650089..650172  ( - strand )
CDS scaffold_75:650380..650574  ( - strand )
CDS scaffold_75:657671..657955  ( - strand )
CDS scaffold_75:661720..661842  ( - strand )
CDS scaffold_75:662002..663628  ( - strand )
CDS scaffold_75:663929..664020  ( - strand )
CDS scaffold_75:664281..664335  ( - strand )
CDS scaffold_75:664437..664525  ( - strand )
five_prime_UTR scaffold_75:664526..664680  ( - strand )
five_prime_UTR scaffold_75:664916..665517  ( - strand )

Sequences:

Gene

>Mapoly0075s0051.2
CCAGATGACCGGGACGTTGGACGGAAGTGTGGGGTCGATGTGTGAGAGACCACGGGAGGACCAGAAATGAGGGACGGACCGAGTCGGGGACATGGTACAGGGACAGCGGTTCGAGGGGATAGCGAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTATGAATTTAGGGTTCGCAGAGAGATAGGAAAAGGCTTTGTTTGCAAAATATGTGAGTGCTATATTTTCGCTTGCGAAGAGTGAGTTTGATCGATCGAAAAGCACTGACCCTTTCTAACGCGATAAATTCGCTAGAAACAATACTGTTTTTTTTGGGGTATTTGTTTTCGTATTATTTTTCCCCGACGTTTTTCTCGCTTGGTTACGACTCTGTGGATTTGTGCAATTTGGCAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGGTTGGGCGTTGTATCACTGTACTATGGAACACTCGGCAATTTCAATTGCTTTACTTGCATTTCACTTAGAAAGTAACCTCTTGGTCTTTGGTTGGTCACAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGTATGTTTACTGTATTGTAGCTTGCTTAGTTTTTTGAACGAAGAAGTTTCAAATGTTTAGATTTTTAAAAAATATAATTAAGTGCATGTATTTAGCTCAACTTGCAAATTACAGAGAGGTAGATCTTGATGGTTTAGTGTCATCACTAGTGTTTTAAGTTGCACAGGCTGTTCAAAAGTGGAATCTGAATACGTTGTTTTCTGTATCCATTTTGTTTGCTTTTCTTTCTGCTTATGTTCTCAATAAGCTTATTCGTGCAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGGTTCTTACATGACTTGGATTGCTTATGAAGATGGAAATTTTTAAGAGCACTAGAAGAGTGTAGAACTTTCACTATTGACTGCCTATGTATTTTCGACGTTGACTGTTGAGGTGTATTTGTGAATTGATCTGTTCAAAAGTGTTCATTCGAGCCCAAGTTACTGTCAAATCAAAGGGCCTCGTTGTACCGTTCAGGTTATGTCTACGTGTAGTTTTTGCAGACGATGGTTGTGAAGAAAACAAGTGTTGCCTATACATTGTGCATAAGACAGAATTGACCTCACATATGTCTTTTTGGCAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGGTACTGTGGATGTGTTCTTCCTCATGAGTTTATACATTGAAGGTCTAACTAGTGTTCATGGTTCAAGCTCGGCGCTTTCTGGTTTCTTCTCAATTGTCAAGTTATGATTTCAGTACAAGTCTCAACTACTAATGAGTTCAGATTTGATATATTTCCCAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGTGCATTTCTTCCTTTGATTGTGTTATAGTAGTCTCTCTCGTTTTGGAACTGGGATGGTTCATGTACGCTTTTGCGTTAAGCATGCGCAAGAACTTTCTCTTATCCCACAAGTTTGATGTTAACTAGTCATTGATACTACATAGTCACATACATTTTCTGACTACCAAGCTATCGATTTACATTTTTCTTCCATTGGCAAGTTAGCGTCGCGTACTCTCAACCTCCATCGAACTCCAGTGTATGAAAGATCTTTTCTTTGGGCTGCATCTAGGTTGCATCCAGTCGTTGTATTCACAACAGAATTTAATGGAGTGGAACATATTTCAACCATAGTCCCGCTAATCGCATTGAGAACTTTACTTGATATTGCTGGGCAAATATTGTATTGTATATCAAAACAATTAGTAAAAGAAAATTAACAGGGGAACTCTAGAGTTCTAAGACAACAGCTCTCCCTATCAAGATCATTTGCGCATGATCATGTACGTCAATACTCCTAGTGTTTTGTTAAAGTGTCCAGAACTGTAAGTCATTAAAGTTTCTCATTCTCATTACCATTGTTTCAGTCCTGTACTAGACACGGACTCTGTCAAAATCGTTGAACGTATTCACTTGAAAATAGTCACTGTATTTAGCTGTTTAACGCCAGCCTTAGCTGGTTTCATCCACCGGATATCGGTGGCCGTATTTTTCTCGCCCGAGCCTATCGACCCCCCGGCTATGTAACAATTGTGGTCATGAATCCAGCGTTGCTAGTGGAGTCCAAGAGTTGTGTTTTACCCTACTCCTGGAACGAGTAGGAGATGAGTAGTAATTGCTTGTGAACCATGCGGTTGATCATGCACGTGATAGCTCCTAGTGTTTTGGTAAAGTTTATGGAACTGTATATCCTAAGCTTATCTTATCATATTTACCATTGTTTCAGTCTCCTGTACTACACGGGATGGTTGAACATCGTTGAACGTATTCGCTTGAAAGTACACACTTCAACAGTTTCACACCAGACAGTTCTGCTTTTATCCATTGTAATATTGATGGCTTTGATTGTCGCGCCCGAGCCATATCAGACACGGTCAGAGCCATGTAGCCAATGTGCTCATGATTTTAGCGTTGCTAGTGGAGTCCAAGCGTTGGAATTTACACAATTCTTGGAAAGAGAAGAAGAAGAGTATTCCTTGCGTGTTAACCTTGCGGTTGATCATGTACATCGTAGCTCCCAGTGTTTTGGTAAAGTTTCTGGTACTGCTAAAAAGTTTCTCATTTTTATTACCATTGTTACAATCCTGCTGTACCAGAGACCGGATGGGGGAAAATCGTTGAACGCACTCGCTTGAAGGTAGGCACGTCAAGTGTTTTATGCCAGACACCGTTGCTTTTATCCATTGGATATCGATGCTCGTAATCCTTGCACCCAAGCCTTATAGACCTGGTCACGACCATGCAGCTGATGTGGTCATGATTCTAGGGTAGCTAGTGGAGTCCAAGAGTTGTGTTTCATGCAACTTTGGGAAGGGAGAAAATTACTTGATGGGACCCCTGCGGAACACAAAAGACTTGCTGATACACAACACGATTCATTTTACCAGATGGGACCACCCTACGGCCATGCAGCATTGGGTGACGTATCGGGTGACGGCAGCCCACCGTCACCCAATACGAGTTCTGGGTTAGGTACAACCAGTGGGTGGATCAATCAGAAACTTTGACTCCAGTCCTTTGAAAGAAACAGCCCCTAACTTAAGTCCCTCAAGTCCTCACGAAGTTAAGCGGTAACGGTACACAACATAAATTTGACAGTAACAGTAACTACATTCCTTCTGATAGACATACGCATGGGGACTTCGATCTCGTTTGCAACGTTATGATACCAACATAACAGCATCATGGTCTTGAGTTTGATGATTGCAACGCAATTTTCTGAAAGAAGCTACATCCAAAGATGTCGAAAGTTTACACTGCAAGTTAGCTTACTTAGTGTATCGGTTGTGAATCCTTTCAAACACAGTTTCTACTTGTATGCAAGCGACGCTCCCATCGCATCCGTCAGAGGCTTCATCAAGAGATCATTCCTTGCACAGACGAGACCCTCAATCTGGAATCTCTGCTTTGCGTGTAAGTTCAGTAAAGTTCCTGGAGCCCCTGGGTCCCAAGCTTTCGTCTGGGGATGCTGGAAGATTCTGCCATGGCTACACAAAGCTTGATTATCGTTCCTACTACTGTCAGGCTCACTGAATTGATCGTGAACAAAGTTCAGTGATGACGCTAAGGAATCACTGAATTGTGACGGGTTTTGCTGCACCTCAAGATAGTTATACGCTCTTTTCATACAGGGATTACAAGCACTGTGCCCTTTTGGCGTGGTTGATTGACCTCTTATAAGTAACCCAAAGTGAATCGATTTCCACGCAATGCAAATTCTTCATTCTGTCATATTGAGCCAGCCTATTCCTAGACTGGTTCTTCGTTCTTATTCGACGTGGTGGAAGGACGTAGGTATTCCATCTGGTAAAATGAATCGTGTTGGGTCCCAGCAAAAGCATTTGCTGGTACCCAACACTCCGGTGGTGCAGGCTTTACTCCGGTGGAAGTAACGGCCGTATACACTTCTCATCCCATGATGCATCTCACGGATAGAAGTGCAGAACTGTATCTACATCGGTCCTCTTCTAATGCAGATTACACTGGAACAGCTACGAGAGACTTTCTCTCCCTCACACACAACTCGACTTCTAACTTTCGTTTTTATTGACCTTTGTTTATGCATATCGTAGAGGTATTACCCTTCAGTTGTAAATATAGAGTTTTCCTTATCAGTTTTGATCAGGTTGTGTCTGCGAGATATCTTCTAATATTTGGTCAATAGCGCACAGAAAAACAAAAAAAAACATGTGAATATTGTTGAGCTTCACTCGTGTGTTTCAAATTAACCTCTGGGTAGCTAAGTTAAGTTTAGTTAGCTCACCGCCTGGAGTGGGGTATTTAACCCCAGATCTTCTCGACTGTAATCACTCTCTTCACATGTTAACTATATGCGCTGTATTGCACGCGCTCACTTTGACTGCACAACTATGTTGTGATTTCACCGTAGATGCTTAGAGTCACTGCGATCAGGTCTTCAAAATCGGACCCGCTCAGATCTTGCTGTACAGATTCACATCAACCGTGTACTGGAGATAGACAAACGATCCAAGGACGCATGGAAGCATATCGCTTTTGAGACAATTAGGTCTGAGGTCAGAAGCCCATATTCTAAGGGGTCAGTCCTACAAGGGCGAGTGGAAGGGGTTGAAAGGTCTGAAAACAGTAAGCACATCTAATTATAAGGCAGATAATGGATGGAGAAGAATTCTTGTGTGATGTGGTTTTAGTTCATTGCCACGCAAAAGGTAAAATCAGCTACATACCCCGTGAGACATCTACCAGCCAATCAAAGACACCACATGTTTGACAGTCTAATATTCGTGGATACATCTTGTTGATGTTTGTAGGTTAATCCTCGTAGTTTCATAGTATATCTTTCTGACTTATGGTGAACTAATAAATACATGTTATGGTGCTTTCCTCTAAATTCGTCTTTTTACTCAACACAGTGCTATCTTGCTCTTATGTATTATTGCTCTACCATGCGTTTCTATGTGGGCAATGCCTGTTTTTTTTACGTGGATGTGTTGGAGAACACATTTTGTAACTCACAAATTAAATTTAAGCTATACCATGTTCGGATTTAAGAATATAATGCATGGTTGTATTGTTCTGATCGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGTATTCTTTCTTGATATACATAGTGATCTATTTTGTTTCAATTTGATTCAGCTCAACATCCCCATCCATAGTAACGGAAATTGATTCCATTTTACATGGTGGACTTAACATATTGACTAGATTGTATTTCCTTCATATTGGGAGTAATTACAATTCGTTCTCACAAGTTTGATTATTTTCGTGTTCAGCATTACATTGATCACTCTTATAGTCAACTTCATGAATCCGTACTAAGAGCAATCAATGCAACTTTCTTCCACCTAAGTACTCGAGTCATCCGGTGATATATTGAATCCTTCTGTTATTGAGTGTGGTTGTTTGTGGTCTGGTTTGGTCAAGTATTGTGAGCTTCTTGTTGCTTCATTTTGATTTTTAATAAAAAAATGTCTTATATTAAACTTCTGATCGATCACTTGTTTGTTTGAATGTAGAATATAGTTTAACTTGACTAAATAAAGATATGGCTGTATATGTTGTAGGAAATTTTGAACACTATATTGGCCTTTCAATCATGTTATGTGAAGGATTGGAATTCATCAAAGTCGCTTATTTTAATTCGCTATAATTCATAGTTTAGGCAAAAACAGTGTTTAGTGTCGGTGGTGGTCATATTGATACTTGTGGAATATTTTAGTATTGTGTGATCGTTATCGTGGTCTGTTTGTTATTCTGAATTTTTGGTTGAACTTGGTCAGATTCGGTTGGATGAATCTTTACAGAAATTGTAGAAAGGTAGTGTAAAAAGGTCGGTTAGATTCATCTAACCTGAAGACATTGGAGGTAAGGTCTGGATATGAGATTAACCTTCCCTTGATGGAATTAATATGAGATGTTGACTGAGGTGTTGTTTTTTTTAGATATTGAGATCTTGGTTCATACCTTTTTCTTGCTAGAATGTCCCGCTCTTCCTTCCTATCTTCTATAGTTGACTAGTTGTTACAATTCTCATATACAACTTTGCTGTAAAGTGCTTGGTAGATCATATCACAATATTGAAACTGATAGAATGGATTGATCAATATGTCTTATGGTGAATGTCATAATATTCGTCATGATCATGACTGGTATGATGATTCAGTAGTAATCAGTAGTAATCGTGCGGAAATTGTCGCGGTAGGATTCGTTTACATTTTCGCGTTTGTAGGTGTATTTCTAGACCCCATGTATCCAACTCGAACCAGAATGTTATGATGGGTATTTGTTTGGTATTTATAATGACTTTATGTGTTGAATTTGGTGGTCCTAGAAAACAAAATTTAATTCAACCTATTTTTGTTCAATGATAATTAACTCCCAATATTATGGTAGGAAAAACTGCGCGTGTAGATATAGGTATTTTATTATTCCTTCTTGGATTTAAGTTAGTTAAATATACCAATTTGACATTTACATTCATGTAATCCTCCCATCAAAAACAGACACAAGATCATGTCGTGTCATCGATGCAGTAATCCATGCAGCCAGATATACGAGATAAACACAAATTGTAGAGTGCTGCAATAATTCATCCTTCGAGCATTCTTTATTCTAGAGAGCTGCAAGAATTCTCTGCTTTTGGGCTGATTATACAATCCTTATATTGAATTATTACTTCTCATTTGGAATACACTGTGTGCACTACATGGAATTCCAGTCGAGTTTTGCGTGAGATAAGCTAATAGCAAACCTGGAGGTTGACTATGTTCTGAGTTTGAAGATCATATATATATATCACTCTCTCTCGACTTTTATATTGCGAGTTGTACAAATTTTGTTTTCAATACGATAAAAAACTGTATTTTCAGATATAACTAGATCCAACTACTAAAACACACAAGTTTACCACCCTTATATCTGCGCATACCAATACTTCCTAGAAGTCCAACTTAGAAGTAAAGAAGATTGTAATTTTTAGAATTCCAACTTATAAATAAAGAAGATTGTAATACCTCTATGTAGACAAAATCATATTTGTGCTCTAGTTATCTTTCAAATTTAACATACTTGATATAAAAAAGGGATGTTAAATTCACCCCGAGTTGTTAAATTCACCCCGTCACTTTTCATGGCAACAAGACATGTCAGAAATTATTGTTTCTTCTCGTCGCGTCGAGGATTGGTTTCGGACTCTCTTTCTCATTTTCTTTTTCTCCACTGTGCACAAGCTGCTTTCTGTGGTGATTCTTGATATGCATATGGAGGAAATAACGGAATCGGCTGCTGCATGGTTTATTGTCCGAAAGTATCGTGCTGGATCTTAGAGCTGAATCTGCCCTTGGATGTGACCCTGATCAAATTTAAAAGAGATACTGACTAAATTCAGAAGAGAGATGCAACGTGTGAGAACTTGGGTGATGAATTTAACAATCACCAATATAAATATATCAATATATAAATTTCATCAAGTCCAACGATGTACCGAGAGTGTAAACCTCTCTCTTCTCTCTTCGTTTCTCTTGTGTACATATGACAATAAGCACTTGGTTTAGTAGGTATGGAGAAACACTCTCTTGTACTGCATTTTTCATTTTGATTCACGCGCATAATTATATTTTTATTAACTAGATAAGATCTAATTTTTTACATAAATGAAATCTATCCTCCCATAATGATGATGTGGTTTTCTTCTCCACCTTAACTTTCCAACTTTCTCAAAGCTACTTTGAAGACTTAAGTTTATATTAGTGAATGGAATAGTAAGCTTTCAGTTACAATTTCATTGATGCCGGTCACTCTTGTAAGAGACCTATCATGTCGACAATTAAATAGTTCCTACTATTTATCTCATTTTCATCTCCTTGTTTTTATGTGTATGCAATAAAATGTAGTCATGGTTTGTTTACCCTAGCTGGCATTTGTGATCATTGATTCTCTTGCATGTTACATCTCAACGATCTAAACCTTTAAAGTAACGTAGTTAGACTAGAACACAGTATCCTACTCAGATTTGGAAAAGACTGGCTGAAAGATAGAATTGTAATGGTTGCAAATGGGAATGGTATGTAGTAAATTCAGTAGATATTAGTCATCGAGATTGAGTGCAAAGCATTATATCCTTTGGGTATCTTGAAATAAGTGATGTTCTTGGGGAGTTCAACTCCTTCTTCGAGTCCGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGAAGCACATGAACATCAGAGTGATCCCGTGGCATACTGTCGATAGATTCATCTATACATTTTTCACATAAAAATCTGGATGATAAGCATTATATCCTGCTCTAGCTGGTGCAACACATCAACAACAGAGTGATCCCGTGGCATACTGTCGATAGATTCATGTATACATTTTTCACATAAAAATCTAGATGCAAAGCATTATATACTTTGGGGATCTTGAAATAAGTGATGTTACTGGGGAGTTCAACAGCTTCTTCGAGTCGGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGCAGCACATCAACAACATATAGATTTTTCACATAAAAATCTGGATGCATGGGAATAGAATGATGACTTTATAATAATCTTTTCCATTAGATTCTTGATTTGAAAAAATGATTCATAGGGAATGGTTCTTGGAAATCTGACTATAATATTTTTTTTGGAAATCTGACTAATATTTCAGAAAACTCTACCGTCACTAGGAGTGACACGGTAGAGTTTTCTGAAGAACTGTTTGTTCACTTGCTGAACAAACAGTTAGCACTAAACAACATCAGTGAGCACTAAACAACAGGCTTTTTCTTGCATGATACTAGATATTGCATACTATTGACTGCGGTTGAAACTAATCCCAACAATTTTTTTTGGTTTGAAATTCAACCATACTTTAAATATTCGCTAATTTACTGTTCGGTCCCTCTCGCTCCTCTCGCTCCCCTTCCCTTCGATTCCTGTCCGTAGCACCCCTCGCCTCTTTCCTCTTGTGGGTGGAGTGAGTGGGGGCGCCAGGCGAGCACGAGACAGGATCAGACCAGAGTGGGTGCGGTGTTCCTGTCAGAAGGTTTCTTCCTTTCCACTGCTCTGTTCTTCTCTGCTCCTCCCTCTGCTCCGTTCCGTCATCCTCTTCATCTTCTTCCTCTTCCTCTCCTTCTCCTGCCGCTGCTGCATCTTGAAAATCCGTCCGGAGTAAGGTCGCGAGTTAGGCTGCGCGTAGTTTTATATGTGGACGGTGGGGGAAGTTTTTCCAGCTCGAACGGAGATCCTCGCGGGGCTTCTTGAGCTTCATTTCGATCACTGGTGAGCGTCTAGCTCTGTACTGACCACTTTCCTGTGATGTTGATGATAATGATGATTATCACTCAAGTCTGTGTCTGTCGCTGGGTCGTTTGTCTGAGTTCCCTGCGGTCACTCTTGACTCCATAAGGTGCCAGTGCGGGGGTGTGCACTCAGTATAGTATAGGATGCTGCGATGATTGGGAAAAGAAACGAAGAGTGGAAATGGAAAAGCTTGGCTCGAAATCTCCCTGGCGCCGTTGCCTCTGCTCTGATTTCTTTCTCGAATCAACTGTGTGTATTCTTGATATGTTCGTCTCTTAGAACATCTTTTCTGAGAGCATCCCGTCTGTTTGCTGAGTTTCTTCCTATGTTGGCATCATGGCTTAGGATTCTGTGATTTCTCTTCCTCCGATCCTATTCTTGTATTATAGCTTTTAATCTTCCCTGGCTCGCTCGCTCTCTCCCTCCTTGTTTTGTGATGCTAGTTTTGCTAGGGGTGTGTAGATTAATGATGTTGTTAAGTTCTTAGTTTGCACAATATTGCAGTATTTTCATCCTTGGTTTTGGAGTAGTACATTTACATTCTTCATTACAATTGTGCTTAAATTACCATTAACAACTAGACTGAGTATCCAATTCTTCTGTTTTGTGTTTGGGATTGAAGTAATTGTTAATTTTCTTGACAATTGATAGGGATTGTAATATTGAGTCCCATAGTGAATTGCATAAGATCCATAGTGAATTATAAATGAATATATATACTGTTCAAGATACAGTCAATATACGTATTTGTAAATCACCATGGGTCGATTGAGATGCAATGCTTTTAATGCATTTACAAAATTAAATATTTCTCAAATTTCACCTCAATTTTCTATCAAGTTTTTATTTGCTGATGGTATCAATTGATTATGTCATTTCTTACCATAGACAGTATCAAAGTAATGGGTTATATCTTATGGTTTTCTTATCTTTAGCGATCAAATTTTTTTTTAAACTTCTCAATACTTATAGATGCTTTGTTGAACATATTTAATCGTGGTGAATGAATATGTACGCTTCAAAATGTAGGCTTCGCAACTAACGGATAATATTTTGTTTCAGACCAATCTTTGAAATCTCTGCTTTGTATATGAAATCTGCTTATATTTTATATAGGGGAATGTTAAAACAACCACATAAATTGTTCACATGATTTGTCAAAAACAATTTTTTTCGCATAAAAGCTCAAATATCAGCTGCGAGTGTGTTTTTGACTTCCCCCTCCTTCCTGTGCAAAAAACACCTTCAGAGTTGTTATCTCACAGGGATCATTGCAATAGTTTCAGTCAGTAGTCAATAGTCATTGTTCTTGAAGTGTGTACGTAGAAGTTTGATTGTGTCTTCTGCATATATGCAGCAATATGTAACAAAAATATGCTTGGAGATGATACTTGGGCTTGTGTGCGAAATATCAATTTTTGACAGGAGACTCGTCCGTGGTAGTTTTAACATTGGATGTGATCGTTTAACATTCCCCTTTGTATATTGCTTAACCCATTATGTTGGAACTTTTTCCAACATAATTGTTTGATAGTTTGAACAGATAGGCGAAATTGAAATCCTTTTTTCCCTTGGTTGAAGATTTTATTTTTACTCTCTCTGATCTCTATGCTTCTCATTCAAAGGTCTGGGTATATGAAAGGTAATCCGTTTAGGATTTATATGGATATATCTGAATGAATGCCTCCACGGGGTAGTATTTAGATAACAATCTTGTAATTTACATAATAACATTGTAATCATCATGTTTTCATTGGTTTGGTAATATCAATAATATAGCTAATAATAGTTTGATAGCAAGAACATGAAGTAATGCGACATCAGATGCTACTGGTATTTGTATATCGGTGCGGAAATTGTATGTGATGTATGACGTATCTCATATTACAGTAGCCTCCCGTTTGAACGGGAGGCTACTGTAATATGCATCAATAGTACGCATCATTTTCCCCAAAAAATAGTTCCAAAAAATAGGGTTCAGATTTATTTAGTTCAACGTGTCATATATTTTCATTTGGCGCAAGTTTTGAAGATTCTTGCGTTTGAAACCTGATTTTTGGTATATATTTTCGGCATTAGAAGGCTGTATTTGGGTAGTAAGCCATAAAACATAAGCGAGTATCTTCCGTATTGTATAAGTTTTTAGCACCATATTGGTAGTCTAAGGCTTCCAGCAATCCATGATTGGATTTGTTGAATTAAGCTCTCTCTTCGTGAAGCATCACCTTTTGCAACCCTCGGCGATTTGTGATTGACTGAGACATCAGCCATTACCATGATTCCTTAAACTCTGTTTCTGAAATGGGTAAACTCAATGCAATACTTTTCGCTTTGGCGACGGCGGAATAGATAGATTGGACGTATTCTGTATTAACAGAATGGTAAGCATGTCTTTTAGCTTGGTGAAACAACCAACACAGGATTGAAAAGTGTTATCTTTAGCTTCATAGATATCAAGACAGATCGCTTTAGGGTTTGCTCACACATTTCTGATAGCTGCTTCACTAGCATCGGGCCAGAGCCCTTTTACTGGGAGTATCGTGGTAAGTTTTCAAATGATCGATAAGAGCTGGTTGGTGTTTCCAGGTTGTTTACCCTAGTGATAACTATCTGAGATAAATTAAGTATGGAGTTTTCATCATCCTCATCAGATTTTGTTGTTTCGAGCTTTTTCAAGTGCTCTTGTATTAGTCCCGTCACCACTTCAGCTGGCTAGCTTCAAATATTTGCCGAAGCCATACAGTAAGACAGAAAAATATGCAACTCCACTATCTCTTCTAGTTACTTAATTGGGTCAAGTGGCCTCCATTCCTCGGATTTTTAACCGAGAATCATCTCATATGCAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGTATGTTTGGATTATATGCGACCTCATCCATGCTTGTAAGTCCTTATCATTTGGTTGCAAGTTTGGTTATGGTGAAGAGTCCATACTCCTGGTGGTTATGGTGAACAATGGCAGTATAACAGTACAATCATTAATGCTCAAGTTGAATATTGAACTGCATGTAATCTCCTGATAACCTGCTCCTTTGGTTGGTTTTTTTGGGTTCAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGTAAGCTTTCCGTGGGCTTTATCATTCTTCTCGACATTGATCAGTTATATGCTGAAGTTGTTACTTGGTGTTCATGATTTCCAAATTCGAGCAATGTCTTGGATCCGCACGAAGGTGTTCATTTAAACATCACTCGATGTTTCTTTTTTTGTTTATTGTAGGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAGTACGTCAAATGGGCTTCTTATCTACTAGTCTTTGTCTATCAGTGTATCATATTTCTCCGTGTGGAATCTCTGCTACACTTACAACGATAGGACTCCTTGACAACACTACTTCATGCTACTAATGTGTTTGGCTTTATGTTCAGCAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGGTTGGTTTTGTCTTGGAGACTGCCCTAACATTTCGACATGGTTGCATGAAGTATCTGCTTGATTGTTGGGGATCTCTTTCCAAGCCCCTTTACAATTATCAGTAAATTTCTGATGTGGTTGGGAAGAGTAGGTACTAGAGTATAATAAGCTGCCTCTGGTCGTGACTAAAATACAGTTTTGGTCAATACGTGATTCTCTTACAATGTTGCCATCTACTATTCTCTTGAAACCATCCACTCTTTGCAGTGGCTCTCATGGATGCATTATCTTCTGGCCTTCTGTGTACCATCCCCAACTTGAGTCTCCTAGTTTTTTTGTTAGTCTTCAAAATTGCTTGATATTGTTGTGTTCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGTATGTTTTGTCACTTAGTTTCACACTTTACGCGGAGTTCAAGTTTGTGTCGTATACTTGGTGGTTTGCATGTTGTCCATTTATAACTGGAGAGAGGATCTATTCTGGACTTGACCACTCATTTCACTATTTACTATTATTGAAGTGATTGTGGAGGATTATCATGGGGTTGATACTGATCTTTCGTTCACTTGAGTCTTCACTGTCGAAATCATGATTTAGATGTTTTGGTATGATCAAACTGAATGTAGTCAACGCATCTTCGTCTTCTGAGATTAAATTTGCGATGGATGATGCGAGTTACATACATGCAGTATATCCTGAAAAGAACGCTAGAATTGATTGTGTGACTTCCCGTTGTGCAGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTAGAGTTTCATAGAGGTGGTCTTTATTGTGTGCTAAAATCTTATAACGTATAAATATGTGATCAGACCTAGCATGGTTGTTGCTTGATTTAGCTATGTTGTTAAAGAAATCATACACTGTCCAAAAGTTCTAGCGAGAGCATGCATCAAGTACAAAGCATTAGATTCAACCTTTAACCCATTTTATTTTCATTTTCTCGCAAGGCGCAGATAATTGAAAATTTTACCTTTGTATTTTTTCAAAGTAGCAAGAGTTCACAACCTTTAGGCTGAATCCGTTCTTTGAATTGATCGTAAATGATGAAGTGTGAAGTGCATAGGGGTTAGAATTTATTGCCTAATCGAAGACAAGTAATTTCTTTTTTCCTGTTTGTGTTTTTGGGATTACTTACAGTTATTCTCCTTTATATTGCTGAGTTTTAGAATTGTCTGTTCCAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGTTTGTTTTAATGCTCGAATATTCAGGGGAATAACACACTCAGCTGAGATCTTGATAGTTGTCTCAGTTTAGTCGTCCTTTTGTTGCTGTTAACTTGAGCATGTGGTTTGCAAGTTAGAGTGTTCAAAGGAAGGTCGTCGTAGGTTGATCTAGAAATCTGGGAGATGATCGCGAAGACAATGTCTGCAAACTTCATCAGAATCAAGTCAGAAATAGAGGAGCTAATTTTCTCGAGCAATATTTCCATTTTCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGTACGTCGTGCGTAATGAACCATGTTGACCTCCTTGGACGAATGGACGGAATGACCTTGAAGTAGTCAACCAGAACTTATTCAGAAGGCTTTCTCTGTTTTGGTGCTGATCAATTTCTTCGATGTCGACATGTCTTTATGAAATGCAATGGCCATCGTTGATCAACAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGTGAGGTCCTATATGCTTCTCTAAGCATTTGGGTGGTTTCTTGAGCAAAGGACGCAGCTATGTTTTGAGGTCCCTTCTTGTCTTTCTAACCGCCGAGTACAATTGGCTGGTTCCGTGAGCTCAGCACCTCGCTATCTGTTGTATCTTTCTTGTTTCTCCTTCAACGTGAAGATGATGGTTCAGATTTAATCCGGTCATGTTCTTCACAATTCTTATTTCTTGCTGAGTTTGTCTTTACGTCATACAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGGTAAGGAGTTTAGAAGAAACCGTCAGTAGGAAGCTGTCTAGTGATATTGATTCACACCTTGATTATTGTTATATTTACCTGATAAATTCTGTTGTTTCCGCTTTTGAGAATTGTGTTTAAAGTACACAGTCTGAACCTCATTTTCTTTTGCCTTCGATGGACAAACTTATTTCTATGTTTTTGACAGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACGTAAGTAAAAGACAGAACTAGCTAAGACAAAAGTTTCTGCAAGTCTGGGGTTGTTTATTTTATTACAATTACATGATGTGCAAGTTGACTTTTGGAAAAACTTTTCGAGATCAATCGCTCACTCTGTGTCTTAACGTCTGTTGAATATAGTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGTGAGCTTTCCAATTCTGTTATTCTGTTTTTCTTCTCTTGACCAGCTTGCCGCCAAAGCTGCGTGGTGAACTTTCATTTCTTGTAAAGAGACATCGAGAACTGATTCATTTGGACAATATAAAGCAAAAGGCAGTATGAGTAGTGGTCGGAGTCGGTGATGGCAGTCTTTGCCACCTCATATTCTGAGTTTTCACGGGATTACAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGGTAACTATCTAGTCTGAACGCCCTTGAGGATAACCACGAGGACGTATTCGATGCTTAAGTAAATGATAACCTCTTGCATATTTTACTCATTCATGTGGCCGTTATCCCAACCCTGTTGTATTATAGGAGTATCTGAAATTTGATTCTTTCTTTCATGACCTTTACAGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGGTAATTACATGCCAAACGTAGTAAGCTCTAGCTTCACAGCTTGTGTGGTCAAACCGCCTGGATGTTCTCTGTATGTAGGTAGTCCCATTTGTCAAAAACACGCAACAAATCTGCCGAGGAAAGTAGAACAACAATGCAATATTTACGTATTCTTGTTAGAAATTAGACACGTTTTACATTTATATTTTTTCAAGGAAAGTTGATCTCATGATTTCAAGCTTGCTTCGTTGTTTTTAACCCACATTCATCTTGAATTGAATACATTTTCTGGTTTAAGTGCTAAAACTTGGTGGGAAAAATCTAATTTGTTCTTCCTGGGAACAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

mRNA

>Mapoly0075s0051.2
CCAGATGACCGGGACGTTGGACGGAAGTGTGGGGTCGATGTGTGAGAGACCACGGGAGGACCAGAAATGAGGGACGGACCGAGTCGGGGACATGGTACAGGGACAGCGGTTCGAGGGGATAGCGAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

CDS

>Mapoly0075s0051.2
ATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAA

Protein

>Mapoly0075s0051.2
MGAGAGAAAAIENEPSPRRAAIEKAQAELRREVAVREERRRELEFLEKGGELLDFFSAANFALPPSSPTDPLADQLLSSEGEGGHASVALTNGDSVENSVGTSLCVGRSSEGGGDLCPGEDFLSAVIEPLTPWEGKGRASRTGSTSLRSHSDVNLKRESEGSGGGRAAVKGQAYSRRNRPRSNRFGNGHTPTRDVEKAGEVGVLPSIEIKGSPAPPVIFEEVTEENETMVDKKLQVLPAPTLLYNSHASTQLGPVTTKVIEDLEATHLPTGKSFEQNSVKAVHAADDALQTGREFQIHDLAASSCGSLQRSSDLREDVCTGIVVKDELVVVGDLKKVDQTSLSPHVEKNVDSRDGGAVSQPSEQVLGNNQAASDKACGLPSMVEDESAIVMIMDESLGSRTSKNECKDKSTVVSETKGDRVIDRSTIITKHGPDSMLTPTIDDKTSVLREVSCTMQLTPKSLDTSENKSIISRKTTSTASSGAPDLIQNDKARIDDPPSDARVEVKVEEGLSEVGTRLSTVDTQVESGHDVKSICVVSLPQEEIKSESQSTPVSAGSNRAGFRTPNSNTASINKFPGVVLPWEKERDPNVRAEAERHKADLSAKARKAHEDYILEEAEIIKKSKKDTAEWAKRSPHLEPARRKSHWDYLLQEMAWMANDFMQERLWKLASATQFCRWIAEQRGQSSVLQLAGIKQRQERVARVLANAINEFWRSVEYIIHKDKRLTLSSLENQESVVAMKEDSEAVPMDVDIPSIPEGSTQRVEKLPSRSRKPLPVQNYAIRFLKESMGSDVGAQAEAPCTPERISEANSVLDPLWEDQFPEEPLFYLVPDGASRAYRILIETERSSLEIEHEQTLHDHAAAIADAEAVAEAAANADFNVSLSVGEGQPLSVLSSPMKGLRAEEDELGGQFLPNALSSIAKKKRKNILKSNASKGEGISSSGPTHRPPIAPGLDSTAVVQSPLVTGKRSLSVGPGNIVGNVGSIPTKRMRSVSSARQRVMGTASPNSFPSPGGLLQRTIFSSGALNSHQDEVRNLCDDTATRIEADATTVSVKNGLGAGCNNSFVNSKSKKKKKTKHFSGQLSSVNAVKGDGAPSVNTASSTKTPEAEHRSVFDQLKRKGDQVNAASVELDTGGIGSSADTPETPSSQGQQPSKKAKVSKQASDLNPEAAAAAISTAATQSGSLVANTSSTSKLLRQNSNRDRNRKTKSTKVPLTQPAGIGIPWSTIEDQAIFALVHDLGPNWELVSDVLSSSSQLKGIFRKPKQCKERYKSLLDRMSVGEGGDSPEDPSTSQPHPSTLPGIPKGSARVLLQRIQGPMEEDTLKVHLEHIVRVVHKFRALKPPTEEQKLLVQPHASHLNAITQFCANGYPTPSDLCEITAAAPELGGPAYQLPGQHLPGVLAAGSGIRPATNGLPVLPSASNLHMGVPAVAPSTTAASAARDVHRLAAIRPFSPEDAQRVRYHRAMAAARGLSVSGPTVTAGLPMMGLPSPSDCPVPLLGSGNNNIGMMGGISRGMSLSRPGLPGMGSPGVPGIGPPPLGSVLSTGGVGIVSAGPTVGPTVVPQQVNLIRRSREQQLVRPGRSNEDQRRFIEELKHQAAQGNTQAATALSSLGSEVTREMMAVQAQPFQQLQHQNHQQQQQQQQYLAARMAKERQMQQQQKQRLLQQQLQQPQQPSSLQPQLQTQMQQQQMHGMSQQHVLPQQSHLSQQQHLLSSQQHNLQKQQSQQGPQQTGTLSSPSLQPTTIPSMQSNHQQHQTLLQPQQQAPPLGQVQQLPVQSKLQPPKQAQKHPHLQQASQVVQQQPPRGSKGVVRGNMLVQALPGSGQSSMLPGNVSAGSQPQQVAGQQIAHSMQGQRHLMPLAKPLSQTSTQVMTGQSAHMQAQQNQSMAGPVPQGSLGGSQKVVSQQPTQLGTMPSKQLQPSPLPSALPSQQQSPAPPLPTQQQQTSPPAAQQPQIGSSQQLQVQQRRPSQQAQIQSAQRRIQQRQPVASVGAPMIGVLGKNGSSTQQGQVPAQMSSQPGHVTYTQGSSMAVPMSMMSASSGASGLSSSGSPSSSGVHSTPWKPGQVVSPMSSGFYNLSRSGSPGAAQLPSIVSSSGMHLASSNGNSGMSITGSGPPHGVIVGSLSQPLQVGSGGHGLKMGLVTGSNPRGVSTTLQGGTQRSIQHHGNLPASPAIGATQQVRSPVPASSAGMMPVSALGTNTVAGVSSSGSMAYQANSSSLSGHSTAISNSMHMFSVQPRQSHAGSAAATTPAVPMKSPPTSGTSQTSAVSPSSPAPVIPASNTISSSVAEPSPP

Mapoly0075s0051.3  

Gene structure:

mRNA scaffold_75:641575..665517  ( - strand )
three_prime_UTR scaffold_75:641575..642569  ( - strand )
CDS scaffold_75:642570..642743  ( - strand )
CDS scaffold_75:643068..645041  ( - strand )
CDS scaffold_75:645209..645641  ( - strand )
CDS scaffold_75:645847..646056  ( - strand )
CDS scaffold_75:646207..646289  ( - strand )
CDS scaffold_75:646477..646593  ( - strand )
CDS scaffold_75:646841..646981  ( - strand )
CDS scaffold_75:647150..647230  ( - strand )
CDS scaffold_75:647484..647540  ( - strand )
CDS scaffold_75:647979..648205  ( - strand )
CDS scaffold_75:648571..648631  ( - strand )
CDS scaffold_75:648986..649021  ( - strand )
CDS scaffold_75:649169..649927  ( - strand )
CDS scaffold_75:650089..650172  ( - strand )
CDS scaffold_75:650380..650574  ( - strand )
CDS scaffold_75:657671..657955  ( - strand )
CDS scaffold_75:661720..661842  ( - strand )
CDS scaffold_75:662002..663628  ( - strand )
CDS scaffold_75:663929..664020  ( - strand )
CDS scaffold_75:664281..664335  ( - strand )
CDS scaffold_75:664437..664525  ( - strand )
five_prime_UTR scaffold_75:664526..664680  ( - strand )
five_prime_UTR scaffold_75:664916..665517  ( - strand )

Sequences:

Gene

>Mapoly0075s0051.3
CCAGATGACCGGGACGTTGGACGGAAGTGTGGGGTCGATGTGTGAGAGACCACGGGAGGACCAGAAATGAGGGACGGACCGAGTCGGGGACATGGTACAGGGACAGCGGTTCGAGGGGATAGCGAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTATGAATTTAGGGTTCGCAGAGAGATAGGAAAAGGCTTTGTTTGCAAAATATGTGAGTGCTATATTTTCGCTTGCGAAGAGTGAGTTTGATCGATCGAAAAGCACTGACCCTTTCTAACGCGATAAATTCGCTAGAAACAATACTGTTTTTTTTGGGGTATTTGTTTTCGTATTATTTTTCCCCGACGTTTTTCTCGCTTGGTTACGACTCTGTGGATTTGTGCAATTTGGCAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGGTTGGGCGTTGTATCACTGTACTATGGAACACTCGGCAATTTCAATTGCTTTACTTGCATTTCACTTAGAAAGTAACCTCTTGGTCTTTGGTTGGTCACAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGTATGTTTACTGTATTGTAGCTTGCTTAGTTTTTTGAACGAAGAAGTTTCAAATGTTTAGATTTTTAAAAAATATAATTAAGTGCATGTATTTAGCTCAACTTGCAAATTACAGAGAGGTAGATCTTGATGGTTTAGTGTCATCACTAGTGTTTTAAGTTGCACAGGCTGTTCAAAAGTGGAATCTGAATACGTTGTTTTCTGTATCCATTTTGTTTGCTTTTCTTTCTGCTTATGTTCTCAATAAGCTTATTCGTGCAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGGTTCTTACATGACTTGGATTGCTTATGAAGATGGAAATTTTTAAGAGCACTAGAAGAGTGTAGAACTTTCACTATTGACTGCCTATGTATTTTCGACGTTGACTGTTGAGGTGTATTTGTGAATTGATCTGTTCAAAAGTGTTCATTCGAGCCCAAGTTACTGTCAAATCAAAGGGCCTCGTTGTACCGTTCAGGTTATGTCTACGTGTAGTTTTTGCAGACGATGGTTGTGAAGAAAACAAGTGTTGCCTATACATTGTGCATAAGACAGAATTGACCTCACATATGTCTTTTTGGCAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGGTACTGTGGATGTGTTCTTCCTCATGAGTTTATACATTGAAGGTCTAACTAGTGTTCATGGTTCAAGCTCGGCGCTTTCTGGTTTCTTCTCAATTGTCAAGTTATGATTTCAGTACAAGTCTCAACTACTAATGAGTTCAGATTTGATATATTTCCCAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGTGCATTTCTTCCTTTGATTGTGTTATAGTAGTCTCTCTCGTTTTGGAACTGGGATGGTTCATGTACGCTTTTGCGTTAAGCATGCGCAAGAACTTTCTCTTATCCCACAAGTTTGATGTTAACTAGTCATTGATACTACATAGTCACATACATTTTCTGACTACCAAGCTATCGATTTACATTTTTCTTCCATTGGCAAGTTAGCGTCGCGTACTCTCAACCTCCATCGAACTCCAGTGTATGAAAGATCTTTTCTTTGGGCTGCATCTAGGTTGCATCCAGTCGTTGTATTCACAACAGAATTTAATGGAGTGGAACATATTTCAACCATAGTCCCGCTAATCGCATTGAGAACTTTACTTGATATTGCTGGGCAAATATTGTATTGTATATCAAAACAATTAGTAAAAGAAAATTAACAGGGGAACTCTAGAGTTCTAAGACAACAGCTCTCCCTATCAAGATCATTTGCGCATGATCATGTACGTCAATACTCCTAGTGTTTTGTTAAAGTGTCCAGAACTGTAAGTCATTAAAGTTTCTCATTCTCATTACCATTGTTTCAGTCCTGTACTAGACACGGACTCTGTCAAAATCGTTGAACGTATTCACTTGAAAATAGTCACTGTATTTAGCTGTTTAACGCCAGCCTTAGCTGGTTTCATCCACCGGATATCGGTGGCCGTATTTTTCTCGCCCGAGCCTATCGACCCCCCGGCTATGTAACAATTGTGGTCATGAATCCAGCGTTGCTAGTGGAGTCCAAGAGTTGTGTTTTACCCTACTCCTGGAACGAGTAGGAGATGAGTAGTAATTGCTTGTGAACCATGCGGTTGATCATGCACGTGATAGCTCCTAGTGTTTTGGTAAAGTTTATGGAACTGTATATCCTAAGCTTATCTTATCATATTTACCATTGTTTCAGTCTCCTGTACTACACGGGATGGTTGAACATCGTTGAACGTATTCGCTTGAAAGTACACACTTCAACAGTTTCACACCAGACAGTTCTGCTTTTATCCATTGTAATATTGATGGCTTTGATTGTCGCGCCCGAGCCATATCAGACACGGTCAGAGCCATGTAGCCAATGTGCTCATGATTTTAGCGTTGCTAGTGGAGTCCAAGCGTTGGAATTTACACAATTCTTGGAAAGAGAAGAAGAAGAGTATTCCTTGCGTGTTAACCTTGCGGTTGATCATGTACATCGTAGCTCCCAGTGTTTTGGTAAAGTTTCTGGTACTGCTAAAAAGTTTCTCATTTTTATTACCATTGTTACAATCCTGCTGTACCAGAGACCGGATGGGGGAAAATCGTTGAACGCACTCGCTTGAAGGTAGGCACGTCAAGTGTTTTATGCCAGACACCGTTGCTTTTATCCATTGGATATCGATGCTCGTAATCCTTGCACCCAAGCCTTATAGACCTGGTCACGACCATGCAGCTGATGTGGTCATGATTCTAGGGTAGCTAGTGGAGTCCAAGAGTTGTGTTTCATGCAACTTTGGGAAGGGAGAAAATTACTTGATGGGACCCCTGCGGAACACAAAAGACTTGCTGATACACAACACGATTCATTTTACCAGATGGGACCACCCTACGGCCATGCAGCATTGGGTGACGTATCGGGTGACGGCAGCCCACCGTCACCCAATACGAGTTCTGGGTTAGGTACAACCAGTGGGTGGATCAATCAGAAACTTTGACTCCAGTCCTTTGAAAGAAACAGCCCCTAACTTAAGTCCCTCAAGTCCTCACGAAGTTAAGCGGTAACGGTACACAACATAAATTTGACAGTAACAGTAACTACATTCCTTCTGATAGACATACGCATGGGGACTTCGATCTCGTTTGCAACGTTATGATACCAACATAACAGCATCATGGTCTTGAGTTTGATGATTGCAACGCAATTTTCTGAAAGAAGCTACATCCAAAGATGTCGAAAGTTTACACTGCAAGTTAGCTTACTTAGTGTATCGGTTGTGAATCCTTTCAAACACAGTTTCTACTTGTATGCAAGCGACGCTCCCATCGCATCCGTCAGAGGCTTCATCAAGAGATCATTCCTTGCACAGACGAGACCCTCAATCTGGAATCTCTGCTTTGCGTGTAAGTTCAGTAAAGTTCCTGGAGCCCCTGGGTCCCAAGCTTTCGTCTGGGGATGCTGGAAGATTCTGCCATGGCTACACAAAGCTTGATTATCGTTCCTACTACTGTCAGGCTCACTGAATTGATCGTGAACAAAGTTCAGTGATGACGCTAAGGAATCACTGAATTGTGACGGGTTTTGCTGCACCTCAAGATAGTTATACGCTCTTTTCATACAGGGATTACAAGCACTGTGCCCTTTTGGCGTGGTTGATTGACCTCTTATAAGTAACCCAAAGTGAATCGATTTCCACGCAATGCAAATTCTTCATTCTGTCATATTGAGCCAGCCTATTCCTAGACTGGTTCTTCGTTCTTATTCGACGTGGTGGAAGGACGTAGGTATTCCATCTGGTAAAATGAATCGTGTTGGGTCCCAGCAAAAGCATTTGCTGGTACCCAACACTCCGGTGGTGCAGGCTTTACTCCGGTGGAAGTAACGGCCGTATACACTTCTCATCCCATGATGCATCTCACGGATAGAAGTGCAGAACTGTATCTACATCGGTCCTCTTCTAATGCAGATTACACTGGAACAGCTACGAGAGACTTTCTCTCCCTCACACACAACTCGACTTCTAACTTTCGTTTTTATTGACCTTTGTTTATGCATATCGTAGAGGTATTACCCTTCAGTTGTAAATATAGAGTTTTCCTTATCAGTTTTGATCAGGTTGTGTCTGCGAGATATCTTCTAATATTTGGTCAATAGCGCACAGAAAAACAAAAAAAAACATGTGAATATTGTTGAGCTTCACTCGTGTGTTTCAAATTAACCTCTGGGTAGCTAAGTTAAGTTTAGTTAGCTCACCGCCTGGAGTGGGGTATTTAACCCCAGATCTTCTCGACTGTAATCACTCTCTTCACATGTTAACTATATGCGCTGTATTGCACGCGCTCACTTTGACTGCACAACTATGTTGTGATTTCACCGTAGATGCTTAGAGTCACTGCGATCAGGTCTTCAAAATCGGACCCGCTCAGATCTTGCTGTACAGATTCACATCAACCGTGTACTGGAGATAGACAAACGATCCAAGGACGCATGGAAGCATATCGCTTTTGAGACAATTAGGTCTGAGGTCAGAAGCCCATATTCTAAGGGGTCAGTCCTACAAGGGCGAGTGGAAGGGGTTGAAAGGTCTGAAAACAGTAAGCACATCTAATTATAAGGCAGATAATGGATGGAGAAGAATTCTTGTGTGATGTGGTTTTAGTTCATTGCCACGCAAAAGGTAAAATCAGCTACATACCCCGTGAGACATCTACCAGCCAATCAAAGACACCACATGTTTGACAGTCTAATATTCGTGGATACATCTTGTTGATGTTTGTAGGTTAATCCTCGTAGTTTCATAGTATATCTTTCTGACTTATGGTGAACTAATAAATACATGTTATGGTGCTTTCCTCTAAATTCGTCTTTTTACTCAACACAGTGCTATCTTGCTCTTATGTATTATTGCTCTACCATGCGTTTCTATGTGGGCAATGCCTGTTTTTTTTACGTGGATGTGTTGGAGAACACATTTTGTAACTCACAAATTAAATTTAAGCTATACCATGTTCGGATTTAAGAATATAATGCATGGTTGTATTGTTCTGATCGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGTATTCTTTCTTGATATACATAGTGATCTATTTTGTTTCAATTTGATTCAGCTCAACATCCCCATCCATAGTAACGGAAATTGATTCCATTTTACATGGTGGACTTAACATATTGACTAGATTGTATTTCCTTCATATTGGGAGTAATTACAATTCGTTCTCACAAGTTTGATTATTTTCGTGTTCAGCATTACATTGATCACTCTTATAGTCAACTTCATGAATCCGTACTAAGAGCAATCAATGCAACTTTCTTCCACCTAAGTACTCGAGTCATCCGGTGATATATTGAATCCTTCTGTTATTGAGTGTGGTTGTTTGTGGTCTGGTTTGGTCAAGTATTGTGAGCTTCTTGTTGCTTCATTTTGATTTTTAATAAAAAAATGTCTTATATTAAACTTCTGATCGATCACTTGTTTGTTTGAATGTAGAATATAGTTTAACTTGACTAAATAAAGATATGGCTGTATATGTTGTAGGAAATTTTGAACACTATATTGGCCTTTCAATCATGTTATGTGAAGGATTGGAATTCATCAAAGTCGCTTATTTTAATTCGCTATAATTCATAGTTTAGGCAAAAACAGTGTTTAGTGTCGGTGGTGGTCATATTGATACTTGTGGAATATTTTAGTATTGTGTGATCGTTATCGTGGTCTGTTTGTTATTCTGAATTTTTGGTTGAACTTGGTCAGATTCGGTTGGATGAATCTTTACAGAAATTGTAGAAAGGTAGTGTAAAAAGGTCGGTTAGATTCATCTAACCTGAAGACATTGGAGGTAAGGTCTGGATATGAGATTAACCTTCCCTTGATGGAATTAATATGAGATGTTGACTGAGGTGTTGTTTTTTTTAGATATTGAGATCTTGGTTCATACCTTTTTCTTGCTAGAATGTCCCGCTCTTCCTTCCTATCTTCTATAGTTGACTAGTTGTTACAATTCTCATATACAACTTTGCTGTAAAGTGCTTGGTAGATCATATCACAATATTGAAACTGATAGAATGGATTGATCAATATGTCTTATGGTGAATGTCATAATATTCGTCATGATCATGACTGGTATGATGATTCAGTAGTAATCAGTAGTAATCGTGCGGAAATTGTCGCGGTAGGATTCGTTTACATTTTCGCGTTTGTAGGTGTATTTCTAGACCCCATGTATCCAACTCGAACCAGAATGTTATGATGGGTATTTGTTTGGTATTTATAATGACTTTATGTGTTGAATTTGGTGGTCCTAGAAAACAAAATTTAATTCAACCTATTTTTGTTCAATGATAATTAACTCCCAATATTATGGTAGGAAAAACTGCGCGTGTAGATATAGGTATTTTATTATTCCTTCTTGGATTTAAGTTAGTTAAATATACCAATTTGACATTTACATTCATGTAATCCTCCCATCAAAAACAGACACAAGATCATGTCGTGTCATCGATGCAGTAATCCATGCAGCCAGATATACGAGATAAACACAAATTGTAGAGTGCTGCAATAATTCATCCTTCGAGCATTCTTTATTCTAGAGAGCTGCAAGAATTCTCTGCTTTTGGGCTGATTATACAATCCTTATATTGAATTATTACTTCTCATTTGGAATACACTGTGTGCACTACATGGAATTCCAGTCGAGTTTTGCGTGAGATAAGCTAATAGCAAACCTGGAGGTTGACTATGTTCTGAGTTTGAAGATCATATATATATATCACTCTCTCTCGACTTTTATATTGCGAGTTGTACAAATTTTGTTTTCAATACGATAAAAAACTGTATTTTCAGATATAACTAGATCCAACTACTAAAACACACAAGTTTACCACCCTTATATCTGCGCATACCAATACTTCCTAGAAGTCCAACTTAGAAGTAAAGAAGATTGTAATTTTTAGAATTCCAACTTATAAATAAAGAAGATTGTAATACCTCTATGTAGACAAAATCATATTTGTGCTCTAGTTATCTTTCAAATTTAACATACTTGATATAAAAAAGGGATGTTAAATTCACCCCGAGTTGTTAAATTCACCCCGTCACTTTTCATGGCAACAAGACATGTCAGAAATTATTGTTTCTTCTCGTCGCGTCGAGGATTGGTTTCGGACTCTCTTTCTCATTTTCTTTTTCTCCACTGTGCACAAGCTGCTTTCTGTGGTGATTCTTGATATGCATATGGAGGAAATAACGGAATCGGCTGCTGCATGGTTTATTGTCCGAAAGTATCGTGCTGGATCTTAGAGCTGAATCTGCCCTTGGATGTGACCCTGATCAAATTTAAAAGAGATACTGACTAAATTCAGAAGAGAGATGCAACGTGTGAGAACTTGGGTGATGAATTTAACAATCACCAATATAAATATATCAATATATAAATTTCATCAAGTCCAACGATGTACCGAGAGTGTAAACCTCTCTCTTCTCTCTTCGTTTCTCTTGTGTACATATGACAATAAGCACTTGGTTTAGTAGGTATGGAGAAACACTCTCTTGTACTGCATTTTTCATTTTGATTCACGCGCATAATTATATTTTTATTAACTAGATAAGATCTAATTTTTTACATAAATGAAATCTATCCTCCCATAATGATGATGTGGTTTTCTTCTCCACCTTAACTTTCCAACTTTCTCAAAGCTACTTTGAAGACTTAAGTTTATATTAGTGAATGGAATAGTAAGCTTTCAGTTACAATTTCATTGATGCCGGTCACTCTTGTAAGAGACCTATCATGTCGACAATTAAATAGTTCCTACTATTTATCTCATTTTCATCTCCTTGTTTTTATGTGTATGCAATAAAATGTAGTCATGGTTTGTTTACCCTAGCTGGCATTTGTGATCATTGATTCTCTTGCATGTTACATCTCAACGATCTAAACCTTTAAAGTAACGTAGTTAGACTAGAACACAGTATCCTACTCAGATTTGGAAAAGACTGGCTGAAAGATAGAATTGTAATGGTTGCAAATGGGAATGGTATGTAGTAAATTCAGTAGATATTAGTCATCGAGATTGAGTGCAAAGCATTATATCCTTTGGGTATCTTGAAATAAGTGATGTTCTTGGGGAGTTCAACTCCTTCTTCGAGTCCGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGAAGCACATGAACATCAGAGTGATCCCGTGGCATACTGTCGATAGATTCATCTATACATTTTTCACATAAAAATCTGGATGATAAGCATTATATCCTGCTCTAGCTGGTGCAACACATCAACAACAGAGTGATCCCGTGGCATACTGTCGATAGATTCATGTATACATTTTTCACATAAAAATCTAGATGCAAAGCATTATATACTTTGGGGATCTTGAAATAAGTGATGTTACTGGGGAGTTCAACAGCTTCTTCGAGTCGGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGCAGCACATCAACAACATATAGATTTTTCACATAAAAATCTGGATGCATGGGAATAGAATGATGACTTTATAATAATCTTTTCCATTAGATTCTTGATTTGAAAAAATGATTCATAGGGAATGGTTCTTGGAAATCTGACTATAATATTTTTTTTGGAAATCTGACTAATATTTCAGAAAACTCTACCGTCACTAGGAGTGACACGGTAGAGTTTTCTGAAGAACTGTTTGTTCACTTGCTGAACAAACAGTTAGCACTAAACAACATCAGTGAGCACTAAACAACAGGCTTTTTCTTGCATGATACTAGATATTGCATACTATTGACTGCGGTTGAAACTAATCCCAACAATTTTTTTTGGTTTGAAATTCAACCATACTTTAAATATTCGCTAATTTACTGTTCGGTCCCTCTCGCTCCTCTCGCTCCCCTTCCCTTCGATTCCTGTCCGTAGCACCCCTCGCCTCTTTCCTCTTGTGGGTGGAGTGAGTGGGGGCGCCAGGCGAGCACGAGACAGGATCAGACCAGAGTGGGTGCGGTGTTCCTGTCAGAAGGTTTCTTCCTTTCCACTGCTCTGTTCTTCTCTGCTCCTCCCTCTGCTCCGTTCCGTCATCCTCTTCATCTTCTTCCTCTTCCTCTCCTTCTCCTGCCGCTGCTGCATCTTGAAAATCCGTCCGGAGTAAGGTCGCGAGTTAGGCTGCGCGTAGTTTTATATGTGGACGGTGGGGGAAGTTTTTCCAGCTCGAACGGAGATCCTCGCGGGGCTTCTTGAGCTTCATTTCGATCACTGGTGAGCGTCTAGCTCTGTACTGACCACTTTCCTGTGATGTTGATGATAATGATGATTATCACTCAAGTCTGTGTCTGTCGCTGGGTCGTTTGTCTGAGTTCCCTGCGGTCACTCTTGACTCCATAAGGTGCCAGTGCGGGGGTGTGCACTCAGTATAGTATAGGATGCTGCGATGATTGGGAAAAGAAACGAAGAGTGGAAATGGAAAAGCTTGGCTCGAAATCTCCCTGGCGCCGTTGCCTCTGCTCTGATTTCTTTCTCGAATCAACTGTGTGTATTCTTGATATGTTCGTCTCTTAGAACATCTTTTCTGAGAGCATCCCGTCTGTTTGCTGAGTTTCTTCCTATGTTGGCATCATGGCTTAGGATTCTGTGATTTCTCTTCCTCCGATCCTATTCTTGTATTATAGCTTTTAATCTTCCCTGGCTCGCTCGCTCTCTCCCTCCTTGTTTTGTGATGCTAGTTTTGCTAGGGGTGTGTAGATTAATGATGTTGTTAAGTTCTTAGTTTGCACAATATTGCAGTATTTTCATCCTTGGTTTTGGAGTAGTACATTTACATTCTTCATTACAATTGTGCTTAAATTACCATTAACAACTAGACTGAGTATCCAATTCTTCTGTTTTGTGTTTGGGATTGAAGTAATTGTTAATTTTCTTGACAATTGATAGGGATTGTAATATTGAGTCCCATAGTGAATTGCATAAGATCCATAGTGAATTATAAATGAATATATATACTGTTCAAGATACAGTCAATATACGTATTTGTAAATCACCATGGGTCGATTGAGATGCAATGCTTTTAATGCATTTACAAAATTAAATATTTCTCAAATTTCACCTCAATTTTCTATCAAGTTTTTATTTGCTGATGGTATCAATTGATTATGTCATTTCTTACCATAGACAGTATCAAAGTAATGGGTTATATCTTATGGTTTTCTTATCTTTAGCGATCAAATTTTTTTTTAAACTTCTCAATACTTATAGATGCTTTGTTGAACATATTTAATCGTGGTGAATGAATATGTACGCTTCAAAATGTAGGCTTCGCAACTAACGGATAATATTTTGTTTCAGACCAATCTTTGAAATCTCTGCTTTGTATATGAAATCTGCTTATATTTTATATAGGGGAATGTTAAAACAACCACATAAATTGTTCACATGATTTGTCAAAAACAATTTTTTTCGCATAAAAGCTCAAATATCAGCTGCGAGTGTGTTTTTGACTTCCCCCTCCTTCCTGTGCAAAAAACACCTTCAGAGTTGTTATCTCACAGGGATCATTGCAATAGTTTCAGTCAGTAGTCAATAGTCATTGTTCTTGAAGTGTGTACGTAGAAGTTTGATTGTGTCTTCTGCATATATGCAGCAATATGTAACAAAAATATGCTTGGAGATGATACTTGGGCTTGTGTGCGAAATATCAATTTTTGACAGGAGACTCGTCCGTGGTAGTTTTAACATTGGATGTGATCGTTTAACATTCCCCTTTGTATATTGCTTAACCCATTATGTTGGAACTTTTTCCAACATAATTGTTTGATAGTTTGAACAGATAGGCGAAATTGAAATCCTTTTTTCCCTTGGTTGAAGATTTTATTTTTACTCTCTCTGATCTCTATGCTTCTCATTCAAAGGTCTGGGTATATGAAAGGTAATCCGTTTAGGATTTATATGGATATATCTGAATGAATGCCTCCACGGGGTAGTATTTAGATAACAATCTTGTAATTTACATAATAACATTGTAATCATCATGTTTTCATTGGTTTGGTAATATCAATAATATAGCTAATAATAGTTTGATAGCAAGAACATGAAGTAATGCGACATCAGATGCTACTGGTATTTGTATATCGGTGCGGAAATTGTATGTGATGTATGACGTATCTCATATTACAGTAGCCTCCCGTTTGAACGGGAGGCTACTGTAATATGCATCAATAGTACGCATCATTTTCCCCAAAAAATAGTTCCAAAAAATAGGGTTCAGATTTATTTAGTTCAACGTGTCATATATTTTCATTTGGCGCAAGTTTTGAAGATTCTTGCGTTTGAAACCTGATTTTTGGTATATATTTTCGGCATTAGAAGGCTGTATTTGGGTAGTAAGCCATAAAACATAAGCGAGTATCTTCCGTATTGTATAAGTTTTTAGCACCATATTGGTAGTCTAAGGCTTCCAGCAATCCATGATTGGATTTGTTGAATTAAGCTCTCTCTTCGTGAAGCATCACCTTTTGCAACCCTCGGCGATTTGTGATTGACTGAGACATCAGCCATTACCATGATTCCTTAAACTCTGTTTCTGAAATGGGTAAACTCAATGCAATACTTTTCGCTTTGGCGACGGCGGAATAGATAGATTGGACGTATTCTGTATTAACAGAATGGTAAGCATGTCTTTTAGCTTGGTGAAACAACCAACACAGGATTGAAAAGTGTTATCTTTAGCTTCATAGATATCAAGACAGATCGCTTTAGGGTTTGCTCACACATTTCTGATAGCTGCTTCACTAGCATCGGGCCAGAGCCCTTTTACTGGGAGTATCGTGGTAAGTTTTCAAATGATCGATAAGAGCTGGTTGGTGTTTCCAGGTTGTTTACCCTAGTGATAACTATCTGAGATAAATTAAGTATGGAGTTTTCATCATCCTCATCAGATTTTGTTGTTTCGAGCTTTTTCAAGTGCTCTTGTATTAGTCCCGTCACCACTTCAGCTGGCTAGCTTCAAATATTTGCCGAAGCCATACAGTAAGACAGAAAAATATGCAACTCCACTATCTCTTCTAGTTACTTAATTGGGTCAAGTGGCCTCCATTCCTCGGATTTTTAACCGAGAATCATCTCATATGCAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGTATGTTTGGATTATATGCGACCTCATCCATGCTTGTAAGTCCTTATCATTTGGTTGCAAGTTTGGTTATGGTGAAGAGTCCATACTCCTGGTGGTTATGGTGAACAATGGCAGTATAACAGTACAATCATTAATGCTCAAGTTGAATATTGAACTGCATGTAATCTCCTGATAACCTGCTCCTTTGGTTGGTTTTTTTGGGTTCAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGTAAGCTTTCCGTGGGCTTTATCATTCTTCTCGACATTGATCAGTTATATGCTGAAGTTGTTACTTGGTGTTCATGATTTCCAAATTCGAGCAATGTCTTGGATCCGCACGAAGGTGTTCATTTAAACATCACTCGATGTTTCTTTTTTTGTTTATTGTAGGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAGTACGTCAAATGGGCTTCTTATCTACTAGTCTTTGTCTATCAGTGTATCATATTTCTCCGTGTGGAATCTCTGCTACACTTACAACGATAGGACTCCTTGACAACACTACTTCATGCTACTAATGTGTTTGGCTTTATGTTCAGCAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGGTTGGTTTTGTCTTGGAGACTGCCCTAACATTTCGACATGGTTGCATGAAGTATCTGCTTGATTGTTGGGGATCTCTTTCCAAGCCCCTTTACAATTATCAGTAAATTTCTGATGTGGTTGGGAAGAGTAGGTACTAGAGTATAATAAGCTGCCTCTGGTCGTGACTAAAATACAGTTTTGGTCAATACGTGATTCTCTTACAATGTTGCCATCTACTATTCTCTTGAAACCATCCACTCTTTGCAGTGGCTCTCATGGATGCATTATCTTCTGGCCTTCTGTGTACCATCCCCAACTTGAGTCTCCTAGTTTTTTTGTTAGTCTTCAAAATTGCTTGATATTGTTGTGTTCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGTATGTTTTGTCACTTAGTTTCACACTTTACGCGGAGTTCAAGTTTGTGTCGTATACTTGGTGGTTTGCATGTTGTCCATTTATAACTGGAGAGAGGATCTATTCTGGACTTGACCACTCATTTCACTATTTACTATTATTGAAGTGATTGTGGAGGATTATCATGGGGTTGATACTGATCTTTCGTTCACTTGAGTCTTCACTGTCGAAATCATGATTTAGATGTTTTGGTATGATCAAACTGAATGTAGTCAACGCATCTTCGTCTTCTGAGATTAAATTTGCGATGGATGATGCGAGTTACATACATGCAGTATATCCTGAAAAGAACGCTAGAATTGATTGTGTGACTTCCCGTTGTGCAGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTAGAGTTTCATAGAGGTGGTCTTTATTGTGTGCTAAAATCTTATAACGTATAAATATGTGATCAGACCTAGCATGGTTGTTGCTTGATTTAGCTATGTTGTTAAAGAAATCATACACTGTCCAAAAGTTCTAGCGAGAGCATGCATCAAGTACAAAGCATTAGATTCAACCTTTAACCCATTTTATTTTCATTTTCTCGCAAGGCGCAGATAATTGAAAATTTTACCTTTGTATTTTTTCAAAGTAGCAAGAGTTCACAACCTTTAGGCTGAATCCGTTCTTTGAATTGATCGTAAATGATGAAGTGTGAAGTGCATAGGGGTTAGAATTTATTGCCTAATCGAAGACAAGTAATTTCTTTTTTCCTGTTTGTGTTTTTGGGATTACTTACAGTTATTCTCCTTTATATTGCTGAGTTTTAGAATTGTCTGTTCCAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGTTTGTTTTAATGCTCGAATATTCAGGGGAATAACACACTCAGCTGAGATCTTGATAGTTGTCTCAGTTTAGTCGTCCTTTTGTTGCTGTTAACTTGAGCATGTGGTTTGCAAGTTAGAGTGTTCAAAGGAAGGTCGTCGTAGGTTGATCTAGAAATCTGGGAGATGATCGCGAAGACAATGTCTGCAAACTTCATCAGAATCAAGTCAGAAATAGAGGAGCTAATTTTCTCGAGCAATATTTCCATTTTCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGTACGTCGTGCGTAATGAACCATGTTGACCTCCTTGGACGAATGGACGGAATGACCTTGAAGTAGTCAACCAGAACTTATTCAGAAGGCTTTCTCTGTTTTGGTGCTGATCAATTTCTTCGATGTCGACATGTCTTTATGAAATGCAATGGCCATCGTTGATCAACAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGTGAGGTCCTATATGCTTCTCTAAGCATTTGGGTGGTTTCTTGAGCAAAGGACGCAGCTATGTTTTGAGGTCCCTTCTTGTCTTTCTAACCGCCGAGTACAATTGGCTGGTTCCGTGAGCTCAGCACCTCGCTATCTGTTGTATCTTTCTTGTTTCTCCTTCAACGTGAAGATGATGGTTCAGATTTAATCCGGTCATGTTCTTCACAATTCTTATTTCTTGCTGAGTTTGTCTTTACGTCATACAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGGTAAGGAGTTTAGAAGAAACCGTCAGTAGGAAGCTGTCTAGTGATATTGATTCACACCTTGATTATTGTTATATTTACCTGATAAATTCTGTTGTTTCCGCTTTTGAGAATTGTGTTTAAAGTACACAGTCTGAACCTCATTTTCTTTTGCCTTCGATGGACAAACTTATTTCTATGTTTTTGACAGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACGTAAGTAAAAGACAGAACTAGCTAAGACAAAAGTTTCTGCAAGTCTGGGGTTGTTTATTTTATTACAATTACATGATGTGCAAGTTGACTTTTGGAAAAACTTTTCGAGATCAATCGCTCACTCTGTGTCTTAACGTCTGTTGAATATAGTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGTGAGCTTTCCAATTCTGTTATTCTGTTTTTCTTCTCTTGACCAGCTTGCCGCCAAAGCTGCGTGGTGAACTTTCATTTCTTGTAAAGAGACATCGAGAACTGATTCATTTGGACAATATAAAGCAAAAGGCAGTATGAGTAGTGGTCGGAGTCGGTGATGGCAGTCTTTGCCACCTCATATTCTGAGTTTTCACGGGATTACAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGGTAACTATCTAGTCTGAACGCCCTTGAGGATAACCACGAGGACGTATTCGATGCTTAAGTAAATGATAACCTCTTGCATATTTTACTCATTCATGTGGCCGTTATCCCAACCCTGTTGTATTATAGGAGTATCTGAAATTTGATTCTTTCTTTCATGACCTTTACAGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGGTAATTACATGCCAAACGTAGTAAGCTCTAGCTTCACAGCTTGTGTGGTCAAACCGCCTGGATGTTCTCTGTATGTAGGTAGTCCCATTTGTCAAAAACACGCAACAAATCTGCCGAGGAAAGTAGAACAACAATGCAATATTTACGTATTCTTGTTAGAAATTAGACACGTTTTACATTTATATTTTTTCAAGGAAAGTTGATCTCATGATTTCAAGCTTGCTTCGTTGTTTTTAACCCACATTCATCTTGAATTGAATACATTTTCTGGTTTAAGTGCTAAAACTTGGTGGGAAAAATCTAATTTGTTCTTCCTGGGAACAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

mRNA

>Mapoly0075s0051.3
CCAGATGACCGGGACGTTGGACGGAAGTGTGGGGTCGATGTGTGAGAGACCACGGGAGGACCAGAAATGAGGGACGGACCGAGTCGGGGACATGGTACAGGGACAGCGGTTCGAGGGGATAGCGAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

CDS

>Mapoly0075s0051.3
ATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAA

Protein

>Mapoly0075s0051.3
MGAGAGAAAAIENEPSPRRAAIEKAQAELRREVAVREERRRELEFLEKGGELLDFFSAANFALPPSSPTDPLADQLLSSEGEGGHASVALTNGDSVENSVGTSLCVGRSSEGGGDLCPGEDFLSAVIEPLTPWEGKGRASRTGSTSLRSHSDVNLKRESEGSGGGRAAVKGQAYSRRNRPRSNRFGNGHTPTRDVEKAGEVGVLPSIEIKGSPAPPVIFEEVTEENETMVDKKLQVLPAPTLLYNSHASTQLGPVTTKVIEDLEATHLPTGKSFEQNSVKAVHAADDALQTGREFQIHDLAASSCGSLQRSSDLREDVCTGIVVKDELVVVGDLKKVDQTSLSPHVEKNVDSRDGGAVSQPSEQVLGNNQAASDKACGLPSMVEDESAIVMIMDESLGSRTSKNECKDKSTVVSETKGDRVIDRSTIITKHGPDSMLTPTIDDKTSVLREVSCTMQLTPKSLDTSENKSIISRKTTSTASSGAPDLIQNDKARIDDPPSDARVEVKVEEGLSEVGTRLSTVDTQVESGHDVKSICVVSLPQEEIKSESQSTPVSAGSNRAGFRTPNSNTASINKFPGVVLPWEKERDPNVRAEAERHKADLSAKARKAHEDYILEEAEIIKKSKKDTAEWAKRSPHLEPARRKSHWDYLLQEMAWMANDFMQERLWKLASATQFCRWIAEQRGQSSVLQLAGIKQRQERVARVLANAINEFWRSVEYIIHKDKRLTLSSLENQESVVAMKEDSEAVPMDVDIPSIPEGSTQRVEKLPSRSRKPLPVQNYAIRFLKESMGSDVGAQAEAPCTPERISEANSVLDPLWEDQFPEEPLFYLVPDGASRAYRILIETERSSLEIEHEQTLHDHAAAIADAEAVAEAAANADFNVSLSVGEGQPLSVLSSPMKGLRAEEDELGGQFLPNALSSIAKKKRKNILKSNASKGEGISSSGPTHRPPIAPGLDSTAVVQSPLVTGKRSLSVGPGNIVGNVGSIPTKRMRSVSSARQRVMGTASPNSFPSPGGLLQRTIFSSGALNSHQDEVRNLCDDTATRIEADATTVSVKNGLGAGCNNSFVNSKSKKKKKTKHFSGQLSSVNAVKGDGAPSVNTASSTKTPEAEHRSVFDQLKRKGDQVNAASVELDTGGIGSSADTPETPSSQGQQPSKKAKVSKQASDLNPEAAAAAISTAATQSGSLVANTSSTSKLLRQNSNRDRNRKTKSTKVPLTQPAGIGIPWSTIEDQAIFALVHDLGPNWELVSDVLSSSSQLKGIFRKPKQCKERYKSLLDRMSVGEGGDSPEDPSTSQPHPSTLPGIPKGSARVLLQRIQGPMEEDTLKVHLEHIVRVVHKFRALKPPTEEQKLLVQPHASHLNAITQFCANGYPTPSDLCEITAAAPELGGPAYQLPGQHLPGVLAAGSGIRPATNGLPVLPSASNLHMGVPAVAPSTTAASAARDAAVYRDVHRLAAIRPFSPEDAQRVRYHRAMAAARGLSVSGPTVTAGLPMMGLPSPSDCPVPLLGSGNNNIGMMGGISRGMSLSRPGLPGMGSPGVPGIGPPPLGSVLSTGGVGIVSAGPTVGPTVVPQQVNLIRRSREQQLVRPGRSNEDQRRFIEELKHQAAQGNTQAATALSSLGSEVTREMMAVQAQPFQQLQHQNHQQQQQQQQYLAARMAKERQMQQQQKQRLLQQQLQQPQQPSSLQPQLQTQMQQQQMHGMSQQHVLPQQSHLSQQQHLLSSQQHNLQKQQSQQGPQQTGTLSSPSLQPTTIPSMQSNHQQHQTLLQPQQQAPPLGQVQQLPVQSKLQPPKQAQKHPHLQQASQVVQQQPPRGSKGVVRGNMLVQALPGSGQSSMLPGNVSAGSQPQQVAGQQIAHSMQGQRHLMPLAKPLSQTSTQVMTGQSAHMQAQQNQSMAGPVPQGSLGGSQKVVSQQPTQLGTMPSKQLQPSPLPSALPSQQQSPAPPLPTQQQQTSPPAAQQPQIGSSQQLQVQQRRPSQQAQIQSAQRRIQQRQPVASVGAPMIGVLGKNGSSTQQGQVPAQMSSQPGHVTYTQGSSMAVPMSMMSASSGASGLSSSGSPSSSGVHSTPWKPGQVVSPMSSGFYNLSRSGSPGAAQLPSIVSSSGMHLASSNGNSGMSITGSGPPHGVIVGSLSQPLQVGSGGHGLKMGLVTGSNPRGVSTTLQGGTQRSIQHHGNLPASPAIGATQQVRSPVPASSAGMMPVSALGTNTVAGVSSSGSMAYQANSSSLSGHSTAISNSMHMFSVQPRQSHAGSAAATTPAVPMKSPPTSGTSQTSAVSPSSPAPVIPASNTISSSVAEPSPP

Mapoly0075s0051.4  

Gene structure:

mRNA scaffold_75:641575..665517  ( - strand )
three_prime_UTR scaffold_75:641575..642569  ( - strand )
CDS scaffold_75:642570..642743  ( - strand )
CDS scaffold_75:643068..645041  ( - strand )
CDS scaffold_75:645209..645623  ( - strand )
CDS scaffold_75:645847..646056  ( - strand )
CDS scaffold_75:646207..646289  ( - strand )
CDS scaffold_75:646477..646593  ( - strand )
CDS scaffold_75:646841..646981  ( - strand )
CDS scaffold_75:647150..647230  ( - strand )
CDS scaffold_75:647484..647540  ( - strand )
CDS scaffold_75:647979..648205  ( - strand )
CDS scaffold_75:648571..648631  ( - strand )
CDS scaffold_75:648986..649024  ( - strand )
CDS scaffold_75:649169..649927  ( - strand )
CDS scaffold_75:650089..650172  ( - strand )
CDS scaffold_75:650380..650574  ( - strand )
CDS scaffold_75:657671..657955  ( - strand )
CDS scaffold_75:661720..661842  ( - strand )
CDS scaffold_75:662002..663628  ( - strand )
CDS scaffold_75:663929..664020  ( - strand )
CDS scaffold_75:664281..664335  ( - strand )
CDS scaffold_75:664437..664525  ( - strand )
five_prime_UTR scaffold_75:664526..664680  ( - strand )
five_prime_UTR scaffold_75:664916..665517  ( - strand )

Sequences:

Gene

>Mapoly0075s0051.4
CCAGATGACCGGGACGTTGGACGGAAGTGTGGGGTCGATGTGTGAGAGACCACGGGAGGACCAGAAATGAGGGACGGACCGAGTCGGGGACATGGTACAGGGACAGCGGTTCGAGGGGATAGCGAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTATGAATTTAGGGTTCGCAGAGAGATAGGAAAAGGCTTTGTTTGCAAAATATGTGAGTGCTATATTTTCGCTTGCGAAGAGTGAGTTTGATCGATCGAAAAGCACTGACCCTTTCTAACGCGATAAATTCGCTAGAAACAATACTGTTTTTTTTGGGGTATTTGTTTTCGTATTATTTTTCCCCGACGTTTTTCTCGCTTGGTTACGACTCTGTGGATTTGTGCAATTTGGCAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGGTTGGGCGTTGTATCACTGTACTATGGAACACTCGGCAATTTCAATTGCTTTACTTGCATTTCACTTAGAAAGTAACCTCTTGGTCTTTGGTTGGTCACAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGTATGTTTACTGTATTGTAGCTTGCTTAGTTTTTTGAACGAAGAAGTTTCAAATGTTTAGATTTTTAAAAAATATAATTAAGTGCATGTATTTAGCTCAACTTGCAAATTACAGAGAGGTAGATCTTGATGGTTTAGTGTCATCACTAGTGTTTTAAGTTGCACAGGCTGTTCAAAAGTGGAATCTGAATACGTTGTTTTCTGTATCCATTTTGTTTGCTTTTCTTTCTGCTTATGTTCTCAATAAGCTTATTCGTGCAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGGTTCTTACATGACTTGGATTGCTTATGAAGATGGAAATTTTTAAGAGCACTAGAAGAGTGTAGAACTTTCACTATTGACTGCCTATGTATTTTCGACGTTGACTGTTGAGGTGTATTTGTGAATTGATCTGTTCAAAAGTGTTCATTCGAGCCCAAGTTACTGTCAAATCAAAGGGCCTCGTTGTACCGTTCAGGTTATGTCTACGTGTAGTTTTTGCAGACGATGGTTGTGAAGAAAACAAGTGTTGCCTATACATTGTGCATAAGACAGAATTGACCTCACATATGTCTTTTTGGCAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGGTACTGTGGATGTGTTCTTCCTCATGAGTTTATACATTGAAGGTCTAACTAGTGTTCATGGTTCAAGCTCGGCGCTTTCTGGTTTCTTCTCAATTGTCAAGTTATGATTTCAGTACAAGTCTCAACTACTAATGAGTTCAGATTTGATATATTTCCCAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGTGCATTTCTTCCTTTGATTGTGTTATAGTAGTCTCTCTCGTTTTGGAACTGGGATGGTTCATGTACGCTTTTGCGTTAAGCATGCGCAAGAACTTTCTCTTATCCCACAAGTTTGATGTTAACTAGTCATTGATACTACATAGTCACATACATTTTCTGACTACCAAGCTATCGATTTACATTTTTCTTCCATTGGCAAGTTAGCGTCGCGTACTCTCAACCTCCATCGAACTCCAGTGTATGAAAGATCTTTTCTTTGGGCTGCATCTAGGTTGCATCCAGTCGTTGTATTCACAACAGAATTTAATGGAGTGGAACATATTTCAACCATAGTCCCGCTAATCGCATTGAGAACTTTACTTGATATTGCTGGGCAAATATTGTATTGTATATCAAAACAATTAGTAAAAGAAAATTAACAGGGGAACTCTAGAGTTCTAAGACAACAGCTCTCCCTATCAAGATCATTTGCGCATGATCATGTACGTCAATACTCCTAGTGTTTTGTTAAAGTGTCCAGAACTGTAAGTCATTAAAGTTTCTCATTCTCATTACCATTGTTTCAGTCCTGTACTAGACACGGACTCTGTCAAAATCGTTGAACGTATTCACTTGAAAATAGTCACTGTATTTAGCTGTTTAACGCCAGCCTTAGCTGGTTTCATCCACCGGATATCGGTGGCCGTATTTTTCTCGCCCGAGCCTATCGACCCCCCGGCTATGTAACAATTGTGGTCATGAATCCAGCGTTGCTAGTGGAGTCCAAGAGTTGTGTTTTACCCTACTCCTGGAACGAGTAGGAGATGAGTAGTAATTGCTTGTGAACCATGCGGTTGATCATGCACGTGATAGCTCCTAGTGTTTTGGTAAAGTTTATGGAACTGTATATCCTAAGCTTATCTTATCATATTTACCATTGTTTCAGTCTCCTGTACTACACGGGATGGTTGAACATCGTTGAACGTATTCGCTTGAAAGTACACACTTCAACAGTTTCACACCAGACAGTTCTGCTTTTATCCATTGTAATATTGATGGCTTTGATTGTCGCGCCCGAGCCATATCAGACACGGTCAGAGCCATGTAGCCAATGTGCTCATGATTTTAGCGTTGCTAGTGGAGTCCAAGCGTTGGAATTTACACAATTCTTGGAAAGAGAAGAAGAAGAGTATTCCTTGCGTGTTAACCTTGCGGTTGATCATGTACATCGTAGCTCCCAGTGTTTTGGTAAAGTTTCTGGTACTGCTAAAAAGTTTCTCATTTTTATTACCATTGTTACAATCCTGCTGTACCAGAGACCGGATGGGGGAAAATCGTTGAACGCACTCGCTTGAAGGTAGGCACGTCAAGTGTTTTATGCCAGACACCGTTGCTTTTATCCATTGGATATCGATGCTCGTAATCCTTGCACCCAAGCCTTATAGACCTGGTCACGACCATGCAGCTGATGTGGTCATGATTCTAGGGTAGCTAGTGGAGTCCAAGAGTTGTGTTTCATGCAACTTTGGGAAGGGAGAAAATTACTTGATGGGACCCCTGCGGAACACAAAAGACTTGCTGATACACAACACGATTCATTTTACCAGATGGGACCACCCTACGGCCATGCAGCATTGGGTGACGTATCGGGTGACGGCAGCCCACCGTCACCCAATACGAGTTCTGGGTTAGGTACAACCAGTGGGTGGATCAATCAGAAACTTTGACTCCAGTCCTTTGAAAGAAACAGCCCCTAACTTAAGTCCCTCAAGTCCTCACGAAGTTAAGCGGTAACGGTACACAACATAAATTTGACAGTAACAGTAACTACATTCCTTCTGATAGACATACGCATGGGGACTTCGATCTCGTTTGCAACGTTATGATACCAACATAACAGCATCATGGTCTTGAGTTTGATGATTGCAACGCAATTTTCTGAAAGAAGCTACATCCAAAGATGTCGAAAGTTTACACTGCAAGTTAGCTTACTTAGTGTATCGGTTGTGAATCCTTTCAAACACAGTTTCTACTTGTATGCAAGCGACGCTCCCATCGCATCCGTCAGAGGCTTCATCAAGAGATCATTCCTTGCACAGACGAGACCCTCAATCTGGAATCTCTGCTTTGCGTGTAAGTTCAGTAAAGTTCCTGGAGCCCCTGGGTCCCAAGCTTTCGTCTGGGGATGCTGGAAGATTCTGCCATGGCTACACAAAGCTTGATTATCGTTCCTACTACTGTCAGGCTCACTGAATTGATCGTGAACAAAGTTCAGTGATGACGCTAAGGAATCACTGAATTGTGACGGGTTTTGCTGCACCTCAAGATAGTTATACGCTCTTTTCATACAGGGATTACAAGCACTGTGCCCTTTTGGCGTGGTTGATTGACCTCTTATAAGTAACCCAAAGTGAATCGATTTCCACGCAATGCAAATTCTTCATTCTGTCATATTGAGCCAGCCTATTCCTAGACTGGTTCTTCGTTCTTATTCGACGTGGTGGAAGGACGTAGGTATTCCATCTGGTAAAATGAATCGTGTTGGGTCCCAGCAAAAGCATTTGCTGGTACCCAACACTCCGGTGGTGCAGGCTTTACTCCGGTGGAAGTAACGGCCGTATACACTTCTCATCCCATGATGCATCTCACGGATAGAAGTGCAGAACTGTATCTACATCGGTCCTCTTCTAATGCAGATTACACTGGAACAGCTACGAGAGACTTTCTCTCCCTCACACACAACTCGACTTCTAACTTTCGTTTTTATTGACCTTTGTTTATGCATATCGTAGAGGTATTACCCTTCAGTTGTAAATATAGAGTTTTCCTTATCAGTTTTGATCAGGTTGTGTCTGCGAGATATCTTCTAATATTTGGTCAATAGCGCACAGAAAAACAAAAAAAAACATGTGAATATTGTTGAGCTTCACTCGTGTGTTTCAAATTAACCTCTGGGTAGCTAAGTTAAGTTTAGTTAGCTCACCGCCTGGAGTGGGGTATTTAACCCCAGATCTTCTCGACTGTAATCACTCTCTTCACATGTTAACTATATGCGCTGTATTGCACGCGCTCACTTTGACTGCACAACTATGTTGTGATTTCACCGTAGATGCTTAGAGTCACTGCGATCAGGTCTTCAAAATCGGACCCGCTCAGATCTTGCTGTACAGATTCACATCAACCGTGTACTGGAGATAGACAAACGATCCAAGGACGCATGGAAGCATATCGCTTTTGAGACAATTAGGTCTGAGGTCAGAAGCCCATATTCTAAGGGGTCAGTCCTACAAGGGCGAGTGGAAGGGGTTGAAAGGTCTGAAAACAGTAAGCACATCTAATTATAAGGCAGATAATGGATGGAGAAGAATTCTTGTGTGATGTGGTTTTAGTTCATTGCCACGCAAAAGGTAAAATCAGCTACATACCCCGTGAGACATCTACCAGCCAATCAAAGACACCACATGTTTGACAGTCTAATATTCGTGGATACATCTTGTTGATGTTTGTAGGTTAATCCTCGTAGTTTCATAGTATATCTTTCTGACTTATGGTGAACTAATAAATACATGTTATGGTGCTTTCCTCTAAATTCGTCTTTTTACTCAACACAGTGCTATCTTGCTCTTATGTATTATTGCTCTACCATGCGTTTCTATGTGGGCAATGCCTGTTTTTTTTACGTGGATGTGTTGGAGAACACATTTTGTAACTCACAAATTAAATTTAAGCTATACCATGTTCGGATTTAAGAATATAATGCATGGTTGTATTGTTCTGATCGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGTATTCTTTCTTGATATACATAGTGATCTATTTTGTTTCAATTTGATTCAGCTCAACATCCCCATCCATAGTAACGGAAATTGATTCCATTTTACATGGTGGACTTAACATATTGACTAGATTGTATTTCCTTCATATTGGGAGTAATTACAATTCGTTCTCACAAGTTTGATTATTTTCGTGTTCAGCATTACATTGATCACTCTTATAGTCAACTTCATGAATCCGTACTAAGAGCAATCAATGCAACTTTCTTCCACCTAAGTACTCGAGTCATCCGGTGATATATTGAATCCTTCTGTTATTGAGTGTGGTTGTTTGTGGTCTGGTTTGGTCAAGTATTGTGAGCTTCTTGTTGCTTCATTTTGATTTTTAATAAAAAAATGTCTTATATTAAACTTCTGATCGATCACTTGTTTGTTTGAATGTAGAATATAGTTTAACTTGACTAAATAAAGATATGGCTGTATATGTTGTAGGAAATTTTGAACACTATATTGGCCTTTCAATCATGTTATGTGAAGGATTGGAATTCATCAAAGTCGCTTATTTTAATTCGCTATAATTCATAGTTTAGGCAAAAACAGTGTTTAGTGTCGGTGGTGGTCATATTGATACTTGTGGAATATTTTAGTATTGTGTGATCGTTATCGTGGTCTGTTTGTTATTCTGAATTTTTGGTTGAACTTGGTCAGATTCGGTTGGATGAATCTTTACAGAAATTGTAGAAAGGTAGTGTAAAAAGGTCGGTTAGATTCATCTAACCTGAAGACATTGGAGGTAAGGTCTGGATATGAGATTAACCTTCCCTTGATGGAATTAATATGAGATGTTGACTGAGGTGTTGTTTTTTTTAGATATTGAGATCTTGGTTCATACCTTTTTCTTGCTAGAATGTCCCGCTCTTCCTTCCTATCTTCTATAGTTGACTAGTTGTTACAATTCTCATATACAACTTTGCTGTAAAGTGCTTGGTAGATCATATCACAATATTGAAACTGATAGAATGGATTGATCAATATGTCTTATGGTGAATGTCATAATATTCGTCATGATCATGACTGGTATGATGATTCAGTAGTAATCAGTAGTAATCGTGCGGAAATTGTCGCGGTAGGATTCGTTTACATTTTCGCGTTTGTAGGTGTATTTCTAGACCCCATGTATCCAACTCGAACCAGAATGTTATGATGGGTATTTGTTTGGTATTTATAATGACTTTATGTGTTGAATTTGGTGGTCCTAGAAAACAAAATTTAATTCAACCTATTTTTGTTCAATGATAATTAACTCCCAATATTATGGTAGGAAAAACTGCGCGTGTAGATATAGGTATTTTATTATTCCTTCTTGGATTTAAGTTAGTTAAATATACCAATTTGACATTTACATTCATGTAATCCTCCCATCAAAAACAGACACAAGATCATGTCGTGTCATCGATGCAGTAATCCATGCAGCCAGATATACGAGATAAACACAAATTGTAGAGTGCTGCAATAATTCATCCTTCGAGCATTCTTTATTCTAGAGAGCTGCAAGAATTCTCTGCTTTTGGGCTGATTATACAATCCTTATATTGAATTATTACTTCTCATTTGGAATACACTGTGTGCACTACATGGAATTCCAGTCGAGTTTTGCGTGAGATAAGCTAATAGCAAACCTGGAGGTTGACTATGTTCTGAGTTTGAAGATCATATATATATATCACTCTCTCTCGACTTTTATATTGCGAGTTGTACAAATTTTGTTTTCAATACGATAAAAAACTGTATTTTCAGATATAACTAGATCCAACTACTAAAACACACAAGTTTACCACCCTTATATCTGCGCATACCAATACTTCCTAGAAGTCCAACTTAGAAGTAAAGAAGATTGTAATTTTTAGAATTCCAACTTATAAATAAAGAAGATTGTAATACCTCTATGTAGACAAAATCATATTTGTGCTCTAGTTATCTTTCAAATTTAACATACTTGATATAAAAAAGGGATGTTAAATTCACCCCGAGTTGTTAAATTCACCCCGTCACTTTTCATGGCAACAAGACATGTCAGAAATTATTGTTTCTTCTCGTCGCGTCGAGGATTGGTTTCGGACTCTCTTTCTCATTTTCTTTTTCTCCACTGTGCACAAGCTGCTTTCTGTGGTGATTCTTGATATGCATATGGAGGAAATAACGGAATCGGCTGCTGCATGGTTTATTGTCCGAAAGTATCGTGCTGGATCTTAGAGCTGAATCTGCCCTTGGATGTGACCCTGATCAAATTTAAAAGAGATACTGACTAAATTCAGAAGAGAGATGCAACGTGTGAGAACTTGGGTGATGAATTTAACAATCACCAATATAAATATATCAATATATAAATTTCATCAAGTCCAACGATGTACCGAGAGTGTAAACCTCTCTCTTCTCTCTTCGTTTCTCTTGTGTACATATGACAATAAGCACTTGGTTTAGTAGGTATGGAGAAACACTCTCTTGTACTGCATTTTTCATTTTGATTCACGCGCATAATTATATTTTTATTAACTAGATAAGATCTAATTTTTTACATAAATGAAATCTATCCTCCCATAATGATGATGTGGTTTTCTTCTCCACCTTAACTTTCCAACTTTCTCAAAGCTACTTTGAAGACTTAAGTTTATATTAGTGAATGGAATAGTAAGCTTTCAGTTACAATTTCATTGATGCCGGTCACTCTTGTAAGAGACCTATCATGTCGACAATTAAATAGTTCCTACTATTTATCTCATTTTCATCTCCTTGTTTTTATGTGTATGCAATAAAATGTAGTCATGGTTTGTTTACCCTAGCTGGCATTTGTGATCATTGATTCTCTTGCATGTTACATCTCAACGATCTAAACCTTTAAAGTAACGTAGTTAGACTAGAACACAGTATCCTACTCAGATTTGGAAAAGACTGGCTGAAAGATAGAATTGTAATGGTTGCAAATGGGAATGGTATGTAGTAAATTCAGTAGATATTAGTCATCGAGATTGAGTGCAAAGCATTATATCCTTTGGGTATCTTGAAATAAGTGATGTTCTTGGGGAGTTCAACTCCTTCTTCGAGTCCGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGAAGCACATGAACATCAGAGTGATCCCGTGGCATACTGTCGATAGATTCATCTATACATTTTTCACATAAAAATCTGGATGATAAGCATTATATCCTGCTCTAGCTGGTGCAACACATCAACAACAGAGTGATCCCGTGGCATACTGTCGATAGATTCATGTATACATTTTTCACATAAAAATCTAGATGCAAAGCATTATATACTTTGGGGATCTTGAAATAAGTGATGTTACTGGGGAGTTCAACAGCTTCTTCGAGTCGGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGCAGCACATCAACAACATATAGATTTTTCACATAAAAATCTGGATGCATGGGAATAGAATGATGACTTTATAATAATCTTTTCCATTAGATTCTTGATTTGAAAAAATGATTCATAGGGAATGGTTCTTGGAAATCTGACTATAATATTTTTTTTGGAAATCTGACTAATATTTCAGAAAACTCTACCGTCACTAGGAGTGACACGGTAGAGTTTTCTGAAGAACTGTTTGTTCACTTGCTGAACAAACAGTTAGCACTAAACAACATCAGTGAGCACTAAACAACAGGCTTTTTCTTGCATGATACTAGATATTGCATACTATTGACTGCGGTTGAAACTAATCCCAACAATTTTTTTTGGTTTGAAATTCAACCATACTTTAAATATTCGCTAATTTACTGTTCGGTCCCTCTCGCTCCTCTCGCTCCCCTTCCCTTCGATTCCTGTCCGTAGCACCCCTCGCCTCTTTCCTCTTGTGGGTGGAGTGAGTGGGGGCGCCAGGCGAGCACGAGACAGGATCAGACCAGAGTGGGTGCGGTGTTCCTGTCAGAAGGTTTCTTCCTTTCCACTGCTCTGTTCTTCTCTGCTCCTCCCTCTGCTCCGTTCCGTCATCCTCTTCATCTTCTTCCTCTTCCTCTCCTTCTCCTGCCGCTGCTGCATCTTGAAAATCCGTCCGGAGTAAGGTCGCGAGTTAGGCTGCGCGTAGTTTTATATGTGGACGGTGGGGGAAGTTTTTCCAGCTCGAACGGAGATCCTCGCGGGGCTTCTTGAGCTTCATTTCGATCACTGGTGAGCGTCTAGCTCTGTACTGACCACTTTCCTGTGATGTTGATGATAATGATGATTATCACTCAAGTCTGTGTCTGTCGCTGGGTCGTTTGTCTGAGTTCCCTGCGGTCACTCTTGACTCCATAAGGTGCCAGTGCGGGGGTGTGCACTCAGTATAGTATAGGATGCTGCGATGATTGGGAAAAGAAACGAAGAGTGGAAATGGAAAAGCTTGGCTCGAAATCTCCCTGGCGCCGTTGCCTCTGCTCTGATTTCTTTCTCGAATCAACTGTGTGTATTCTTGATATGTTCGTCTCTTAGAACATCTTTTCTGAGAGCATCCCGTCTGTTTGCTGAGTTTCTTCCTATGTTGGCATCATGGCTTAGGATTCTGTGATTTCTCTTCCTCCGATCCTATTCTTGTATTATAGCTTTTAATCTTCCCTGGCTCGCTCGCTCTCTCCCTCCTTGTTTTGTGATGCTAGTTTTGCTAGGGGTGTGTAGATTAATGATGTTGTTAAGTTCTTAGTTTGCACAATATTGCAGTATTTTCATCCTTGGTTTTGGAGTAGTACATTTACATTCTTCATTACAATTGTGCTTAAATTACCATTAACAACTAGACTGAGTATCCAATTCTTCTGTTTTGTGTTTGGGATTGAAGTAATTGTTAATTTTCTTGACAATTGATAGGGATTGTAATATTGAGTCCCATAGTGAATTGCATAAGATCCATAGTGAATTATAAATGAATATATATACTGTTCAAGATACAGTCAATATACGTATTTGTAAATCACCATGGGTCGATTGAGATGCAATGCTTTTAATGCATTTACAAAATTAAATATTTCTCAAATTTCACCTCAATTTTCTATCAAGTTTTTATTTGCTGATGGTATCAATTGATTATGTCATTTCTTACCATAGACAGTATCAAAGTAATGGGTTATATCTTATGGTTTTCTTATCTTTAGCGATCAAATTTTTTTTTAAACTTCTCAATACTTATAGATGCTTTGTTGAACATATTTAATCGTGGTGAATGAATATGTACGCTTCAAAATGTAGGCTTCGCAACTAACGGATAATATTTTGTTTCAGACCAATCTTTGAAATCTCTGCTTTGTATATGAAATCTGCTTATATTTTATATAGGGGAATGTTAAAACAACCACATAAATTGTTCACATGATTTGTCAAAAACAATTTTTTTCGCATAAAAGCTCAAATATCAGCTGCGAGTGTGTTTTTGACTTCCCCCTCCTTCCTGTGCAAAAAACACCTTCAGAGTTGTTATCTCACAGGGATCATTGCAATAGTTTCAGTCAGTAGTCAATAGTCATTGTTCTTGAAGTGTGTACGTAGAAGTTTGATTGTGTCTTCTGCATATATGCAGCAATATGTAACAAAAATATGCTTGGAGATGATACTTGGGCTTGTGTGCGAAATATCAATTTTTGACAGGAGACTCGTCCGTGGTAGTTTTAACATTGGATGTGATCGTTTAACATTCCCCTTTGTATATTGCTTAACCCATTATGTTGGAACTTTTTCCAACATAATTGTTTGATAGTTTGAACAGATAGGCGAAATTGAAATCCTTTTTTCCCTTGGTTGAAGATTTTATTTTTACTCTCTCTGATCTCTATGCTTCTCATTCAAAGGTCTGGGTATATGAAAGGTAATCCGTTTAGGATTTATATGGATATATCTGAATGAATGCCTCCACGGGGTAGTATTTAGATAACAATCTTGTAATTTACATAATAACATTGTAATCATCATGTTTTCATTGGTTTGGTAATATCAATAATATAGCTAATAATAGTTTGATAGCAAGAACATGAAGTAATGCGACATCAGATGCTACTGGTATTTGTATATCGGTGCGGAAATTGTATGTGATGTATGACGTATCTCATATTACAGTAGCCTCCCGTTTGAACGGGAGGCTACTGTAATATGCATCAATAGTACGCATCATTTTCCCCAAAAAATAGTTCCAAAAAATAGGGTTCAGATTTATTTAGTTCAACGTGTCATATATTTTCATTTGGCGCAAGTTTTGAAGATTCTTGCGTTTGAAACCTGATTTTTGGTATATATTTTCGGCATTAGAAGGCTGTATTTGGGTAGTAAGCCATAAAACATAAGCGAGTATCTTCCGTATTGTATAAGTTTTTAGCACCATATTGGTAGTCTAAGGCTTCCAGCAATCCATGATTGGATTTGTTGAATTAAGCTCTCTCTTCGTGAAGCATCACCTTTTGCAACCCTCGGCGATTTGTGATTGACTGAGACATCAGCCATTACCATGATTCCTTAAACTCTGTTTCTGAAATGGGTAAACTCAATGCAATACTTTTCGCTTTGGCGACGGCGGAATAGATAGATTGGACGTATTCTGTATTAACAGAATGGTAAGCATGTCTTTTAGCTTGGTGAAACAACCAACACAGGATTGAAAAGTGTTATCTTTAGCTTCATAGATATCAAGACAGATCGCTTTAGGGTTTGCTCACACATTTCTGATAGCTGCTTCACTAGCATCGGGCCAGAGCCCTTTTACTGGGAGTATCGTGGTAAGTTTTCAAATGATCGATAAGAGCTGGTTGGTGTTTCCAGGTTGTTTACCCTAGTGATAACTATCTGAGATAAATTAAGTATGGAGTTTTCATCATCCTCATCAGATTTTGTTGTTTCGAGCTTTTTCAAGTGCTCTTGTATTAGTCCCGTCACCACTTCAGCTGGCTAGCTTCAAATATTTGCCGAAGCCATACAGTAAGACAGAAAAATATGCAACTCCACTATCTCTTCTAGTTACTTAATTGGGTCAAGTGGCCTCCATTCCTCGGATTTTTAACCGAGAATCATCTCATATGCAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGTATGTTTGGATTATATGCGACCTCATCCATGCTTGTAAGTCCTTATCATTTGGTTGCAAGTTTGGTTATGGTGAAGAGTCCATACTCCTGGTGGTTATGGTGAACAATGGCAGTATAACAGTACAATCATTAATGCTCAAGTTGAATATTGAACTGCATGTAATCTCCTGATAACCTGCTCCTTTGGTTGGTTTTTTTGGGTTCAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGTAAGCTTTCCGTGGGCTTTATCATTCTTCTCGACATTGATCAGTTATATGCTGAAGTTGTTACTTGGTGTTCATGATTTCCAAATTCGAGCAATGTCTTGGATCCGCACGAAGGTGTTCATTTAAACATCACTCGATGTTTCTTTTTTTGTTTATTGTAGGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAGTACGTCAAATGGGCTTCTTATCTACTAGTCTTTGTCTATCAGTGTATCATATTTCTCCGTGTGGAATCTCTGCTACACTTACAACGATAGGACTCCTTGACAACACTACTTCATGCTACTAATGTGTTTGGCTTTATGTTCAGCAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGGTTGGTTTTGTCTTGGAGACTGCCCTAACATTTCGACATGGTTGCATGAAGTATCTGCTTGATTGTTGGGGATCTCTTTCCAAGCCCCTTTACAATTATCAGTAAATTTCTGATGTGGTTGGGAAGAGTAGGTACTAGAGTATAATAAGCTGCCTCTGGTCGTGACTAAAATACAGTTTTGGTCAATACGTGATTCTCTTACAATGTTGCCATCTACTATTCTCTTGAAACCATCCACTCTTTGCAGTGGCTCTCATGGATGCATTATCTTCTGGCCTTCTGTGTACCATCCCCAACTTGAGTCTCCTAGTTTTTTTGTTAGTCTTCAAAATTGCTTGATATTGTTGTGTTCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGTATGTTTTGTCACTTAGTTTCACACTTTACGCGGAGTTCAAGTTTGTGTCGTATACTTGGTGGTTTGCATGTTGTCCATTTATAACTGGAGAGAGGATCTATTCTGGACTTGACCACTCATTTCACTATTTACTATTATTGAAGTGATTGTGGAGGATTATCATGGGGTTGATACTGATCTTTCGTTCACTTGAGTCTTCACTGTCGAAATCATGATTTAGATGTTTTGGTATGATCAAACTGAATGTAGTCAACGCATCTTCGTCTTCTGAGATTAAATTTGCGATGGATGATGCGAGTTACATACATGCAGTATATCCTGAAAAGAACGCTAGAATTGATTGTGTGACTTCCCGTTGTGCAGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTAGAGTTTCATAGAGGTGGTCTTTATTGTGTGCTAAAATCTTATAACGTATAAATATGTGATCAGACCTAGCATGGTTGTTGCTTGATTTAGCTATGTTGTTAAAGAAATCATACACTGTCCAAAAGTTCTAGCGAGAGCATGCATCAAGTACAAAGCATTAGATTCAACCTTTAACCCATTTTATTTTCATTTTCTCGCAAGGCGCAGATAATTGAAAATTTTACCTTTGTATTTTTTCAAAGTAGCAAGAGTTCACAACCTTTAGGCTGAATCCGTTCTTTGAATTGATCGTAAATGATGAAGTGTGAAGTGCATAGGGGTTAGAATTTATTGCCTAATCGAAGACAAGTAATTTCTTTTTTCCTGTTTGTGTTTTTGGGATTACTTACAGTTATTCTCCTTTATATTGCTGAGTTTTAGAATTGTCTGTTCCAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGTTTGTTTTAATGCTCGAATATTCAGGGGAATAACACACTCAGCTGAGATCTTGATAGTTGTCTCAGTTTAGTCGTCCTTTTGTTGCTGTTAACTTGAGCATGTGGTTTGCAAGTTAGAGTGTTCAAAGGAAGGTCGTCGTAGGTTGATCTAGAAATCTGGGAGATGATCGCGAAGACAATGTCTGCAAACTTCATCAGAATCAAGTCAGAAATAGAGGAGCTAATTTTCTCGAGCAATATTTCCATTTTCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGTACGTCGTGCGTAATGAACCATGTTGACCTCCTTGGACGAATGGACGGAATGACCTTGAAGTAGTCAACCAGAACTTATTCAGAAGGCTTTCTCTGTTTTGGTGCTGATCAATTTCTTCGATGTCGACATGTCTTTATGAAATGCAATGGCCATCGTTGATCAACAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGTGAGGTCCTATATGCTTCTCTAAGCATTTGGGTGGTTTCTTGAGCAAAGGACGCAGCTATGTTTTGAGGTCCCTTCTTGTCTTTCTAACCGCCGAGTACAATTGGCTGGTTCCGTGAGCTCAGCACCTCGCTATCTGTTGTATCTTTCTTGTTTCTCCTTCAACGTGAAGATGATGGTTCAGATTTAATCCGGTCATGTTCTTCACAATTCTTATTTCTTGCTGAGTTTGTCTTTACGTCATACAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGGTAAGGAGTTTAGAAGAAACCGTCAGTAGGAAGCTGTCTAGTGATATTGATTCACACCTTGATTATTGTTATATTTACCTGATAAATTCTGTTGTTTCCGCTTTTGAGAATTGTGTTTAAAGTACACAGTCTGAACCTCATTTTCTTTTGCCTTCGATGGACAAACTTATTTCTATGTTTTTGACAGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACGTAAGTAAAAGACAGAACTAGCTAAGACAAAAGTTTCTGCAAGTCTGGGGTTGTTTATTTTATTACAATTACATGATGTGCAAGTTGACTTTTGGAAAAACTTTTCGAGATCAATCGCTCACTCTGTGTCTTAACGTCTGTTGAATATAGTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGTGAGCTTTCCAATTCTGTTATTCTGTTTTTCTTCTCTTGACCAGCTTGCCGCCAAAGCTGCGTGGTGAACTTTCATTTCTTGTAAAGAGACATCGAGAACTGATTCATTTGGACAATATAAAGCAAAAGGCAGTATGAGTAGTGGTCGGAGTCGGTGATGGCAGTCTTTGCCACCTCATATTCTGAGTTTTCACGGGATTACAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGGTAACTATCTAGTCTGAACGCCCTTGAGGATAACCACGAGGACGTATTCGATGCTTAAGTAAATGATAACCTCTTGCATATTTTACTCATTCATGTGGCCGTTATCCCAACCCTGTTGTATTATAGGAGTATCTGAAATTTGATTCTTTCTTTCATGACCTTTACAGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGGTAATTACATGCCAAACGTAGTAAGCTCTAGCTTCACAGCTTGTGTGGTCAAACCGCCTGGATGTTCTCTGTATGTAGGTAGTCCCATTTGTCAAAAACACGCAACAAATCTGCCGAGGAAAGTAGAACAACAATGCAATATTTACGTATTCTTGTTAGAAATTAGACACGTTTTACATTTATATTTTTTCAAGGAAAGTTGATCTCATGATTTCAAGCTTGCTTCGTTGTTTTTAACCCACATTCATCTTGAATTGAATACATTTTCTGGTTTAAGTGCTAAAACTTGGTGGGAAAAATCTAATTTGTTCTTCCTGGGAACAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

mRNA

>Mapoly0075s0051.4
CCAGATGACCGGGACGTTGGACGGAAGTGTGGGGTCGATGTGTGAGAGACCACGGGAGGACCAGAAATGAGGGACGGACCGAGTCGGGGACATGGTACAGGGACAGCGGTTCGAGGGGATAGCGAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAACAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

CDS

>Mapoly0075s0051.4
ATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAACAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAA

Protein

>Mapoly0075s0051.4
MGAGAGAAAAIENEPSPRRAAIEKAQAELRREVAVREERRRELEFLEKGGELLDFFSAANFALPPSSPTDPLADQLLSSEGEGGHASVALTNGDSVENSVGTSLCVGRSSEGGGDLCPGEDFLSAVIEPLTPWEGKGRASRTGSTSLRSHSDVNLKRESEGSGGGRAAVKGQAYSRRNRPRSNRFGNGHTPTRDVEKAGEVGVLPSIEIKGSPAPPVIFEEVTEENETMVDKKLQVLPAPTLLYNSHASTQLGPVTTKVIEDLEATHLPTGKSFEQNSVKAVHAADDALQTGREFQIHDLAASSCGSLQRSSDLREDVCTGIVVKDELVVVGDLKKVDQTSLSPHVEKNVDSRDGGAVSQPSEQVLGNNQAASDKACGLPSMVEDESAIVMIMDESLGSRTSKNECKDKSTVVSETKGDRVIDRSTIITKHGPDSMLTPTIDDKTSVLREVSCTMQLTPKSLDTSENKSIISRKTTSTASSGAPDLIQNDKARIDDPPSDARVEVKVEEGLSEVGTRLSTVDTQVESGHDVKSICVVSLPQEEIKSESQSTPVSAGSNRAGFRTPNSNTASINKFPGVVLPWEKERDPNVRAEAERHKADLSAKARKAHEDYILEEAEIIKKSKKDTAEWAKRSPHLEPARRKSHWDYLLQEMAWMANDFMQERLWKLASATQFCRWIAEQRGQSSVLQLAGIKQRQERVARVLANAINEFWRSVEYIIHKDKRLTLSSLENQESVVAMKEDSEAVPMDVDIPSIPEGSTQRVEKLPSRSRKPLPVQNYAIRFLKESMGSDVGAQAEAPCTPERISEANSVLDPLWEDQFPEEPLFYLVPDGASRAYRILIETERSSLEIEHEQTLHDHAAAIADAEAVAEAAANADFNVSLSVGEGQPLSVLSSPMKGLRAEEDELGGQFLPNALSSIAKKKRKNILKSNASKGEGISSSGPTHRPPIAPGLDSTAVVQSPLVTGKRSLSVGPGNIVGNVGSIPTKRMRSVSSARQRVMGTASPNSFPSPGGLLQRTIFSSGALNSHQDEVRNLCDDTATRIEADATTVSVKNGLGAGCNNSFVNSKSKKKKKTKHFSGQLSSVNAVKGDGAPSVNTASSTKQTPEAEHRSVFDQLKRKGDQVNAASVELDTGGIGSSADTPETPSSQGQQPSKKAKVSKQASDLNPEAAAAAISTAATQSGSLVANTSSTSKLLRQNSNRDRNRKTKSTKVPLTQPAGIGIPWSTIEDQAIFALVHDLGPNWELVSDVLSSSSQLKGIFRKPKQCKERYKSLLDRMSVGEGGDSPEDPSTSQPHPSTLPGIPKGSARVLLQRIQGPMEEDTLKVHLEHIVRVVHKFRALKPPTEEQKLLVQPHASHLNAITQFCANGYPTPSDLCEITAAAPELGGPAYQLPGQHLPGVLAAGSGIRPATNGLPVLPSASNLHMGVPAVAPSTTAASAARDVHRLAAIRPFSPEDAQRVRYHRAMAAARGLSVSGPTVTAGLPMMGLPSPSDCPVPLLGSGNNNIGMMGGISRGMSLSRPGLPGMGSPGVPGIGPPPLGSVLSTGGVGIVSAGPTVGPTVVPQQVNLIRRSREQQLVRPGRSNEDQRRFIEELKHQAAQGNTQAATALSSLGSEVTREMMAVQAQPFQQLQHQNHQQQQQQQQYLAARMAKERQMQQQQKQRLLQQQLQQPQQPSSLQPQLQTQMQQQQMHGMSQQHVLPQQSHLSQQQHLLSSQQHNLQKQQSQQGPQQTGTLSSPSLQPTTIPSMQSNHQQHQTLLQPQQQAPPLGQVQQLPVQSKLQPPKQAQKHPHLQQASQVVQQQPPRGSKGVVRGNMLVQALPGSGQSSMLPGNVSAGSQPQQVAGQQIAHSMQGQRHLMPLAKPLSQTSTQVMTGQSAHMQAQQNQSMAGPVPQGSLGGSQKVVSQQPTQLGTMPSKQLQPSPLPSALPSQQQSPAPPLPTQQQQTSPPAAQQPQIGSSQQLQVQQRRPSQQAQIQSAQRRIQQRQPVASVGAPMIGVLGKNGSSTQQGQVPAQMSSQPGHVTYTQGSSMAVPMSMMSASSGASGLSSSGSPSSSGVHSTPWKPGQVVSPMSSGFYNLSRSGSPGAAQLPSIVSSSGMHLASSNGNSGMSITGSGPPHGVIVGSLSQPLQVGSGGHGLKMGLVTGSNPRGVSTTLQGGTQRSIQHHGNLPASPAIGATQQVRSPVPASSAGMMPVSALGTNTVAGVSSSGSMAYQANSSSLSGHSTAISNSMHMFSVQPRQSHAGSAAATTPAVPMKSPPTSGTSQTSAVSPSSPAPVIPASNTISSSVAEPSPP

Mapoly0075s0051.5  

Gene structure:

mRNA scaffold_75:641575..665517  ( - strand )
three_prime_UTR scaffold_75:641575..642569  ( - strand )
CDS scaffold_75:642570..642743  ( - strand )
CDS scaffold_75:643068..645041  ( - strand )
CDS scaffold_75:645209..645641  ( - strand )
CDS scaffold_75:645847..646056  ( - strand )
CDS scaffold_75:646207..646289  ( - strand )
CDS scaffold_75:646477..646593  ( - strand )
CDS scaffold_75:646841..646981  ( - strand )
CDS scaffold_75:647150..647230  ( - strand )
CDS scaffold_75:647484..647540  ( - strand )
CDS scaffold_75:647979..648205  ( - strand )
CDS scaffold_75:648571..648631  ( - strand )
CDS scaffold_75:648986..649024  ( - strand )
CDS scaffold_75:649169..649927  ( - strand )
CDS scaffold_75:650089..650172  ( - strand )
CDS scaffold_75:650380..650574  ( - strand )
CDS scaffold_75:657671..657955  ( - strand )
CDS scaffold_75:661720..661842  ( - strand )
CDS scaffold_75:662002..663628  ( - strand )
CDS scaffold_75:663929..664020  ( - strand )
CDS scaffold_75:664281..664335  ( - strand )
CDS scaffold_75:664437..664525  ( - strand )
five_prime_UTR scaffold_75:664526..664680  ( - strand )
five_prime_UTR scaffold_75:664916..665517  ( - strand )

Sequences:

Gene

>Mapoly0075s0051.5
CCAGATGACCGGGACGTTGGACGGAAGTGTGGGGTCGATGTGTGAGAGACCACGGGAGGACCAGAAATGAGGGACGGACCGAGTCGGGGACATGGTACAGGGACAGCGGTTCGAGGGGATAGCGAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTATGAATTTAGGGTTCGCAGAGAGATAGGAAAAGGCTTTGTTTGCAAAATATGTGAGTGCTATATTTTCGCTTGCGAAGAGTGAGTTTGATCGATCGAAAAGCACTGACCCTTTCTAACGCGATAAATTCGCTAGAAACAATACTGTTTTTTTTGGGGTATTTGTTTTCGTATTATTTTTCCCCGACGTTTTTCTCGCTTGGTTACGACTCTGTGGATTTGTGCAATTTGGCAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGGTTGGGCGTTGTATCACTGTACTATGGAACACTCGGCAATTTCAATTGCTTTACTTGCATTTCACTTAGAAAGTAACCTCTTGGTCTTTGGTTGGTCACAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGTATGTTTACTGTATTGTAGCTTGCTTAGTTTTTTGAACGAAGAAGTTTCAAATGTTTAGATTTTTAAAAAATATAATTAAGTGCATGTATTTAGCTCAACTTGCAAATTACAGAGAGGTAGATCTTGATGGTTTAGTGTCATCACTAGTGTTTTAAGTTGCACAGGCTGTTCAAAAGTGGAATCTGAATACGTTGTTTTCTGTATCCATTTTGTTTGCTTTTCTTTCTGCTTATGTTCTCAATAAGCTTATTCGTGCAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGGTTCTTACATGACTTGGATTGCTTATGAAGATGGAAATTTTTAAGAGCACTAGAAGAGTGTAGAACTTTCACTATTGACTGCCTATGTATTTTCGACGTTGACTGTTGAGGTGTATTTGTGAATTGATCTGTTCAAAAGTGTTCATTCGAGCCCAAGTTACTGTCAAATCAAAGGGCCTCGTTGTACCGTTCAGGTTATGTCTACGTGTAGTTTTTGCAGACGATGGTTGTGAAGAAAACAAGTGTTGCCTATACATTGTGCATAAGACAGAATTGACCTCACATATGTCTTTTTGGCAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGGTACTGTGGATGTGTTCTTCCTCATGAGTTTATACATTGAAGGTCTAACTAGTGTTCATGGTTCAAGCTCGGCGCTTTCTGGTTTCTTCTCAATTGTCAAGTTATGATTTCAGTACAAGTCTCAACTACTAATGAGTTCAGATTTGATATATTTCCCAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGTGCATTTCTTCCTTTGATTGTGTTATAGTAGTCTCTCTCGTTTTGGAACTGGGATGGTTCATGTACGCTTTTGCGTTAAGCATGCGCAAGAACTTTCTCTTATCCCACAAGTTTGATGTTAACTAGTCATTGATACTACATAGTCACATACATTTTCTGACTACCAAGCTATCGATTTACATTTTTCTTCCATTGGCAAGTTAGCGTCGCGTACTCTCAACCTCCATCGAACTCCAGTGTATGAAAGATCTTTTCTTTGGGCTGCATCTAGGTTGCATCCAGTCGTTGTATTCACAACAGAATTTAATGGAGTGGAACATATTTCAACCATAGTCCCGCTAATCGCATTGAGAACTTTACTTGATATTGCTGGGCAAATATTGTATTGTATATCAAAACAATTAGTAAAAGAAAATTAACAGGGGAACTCTAGAGTTCTAAGACAACAGCTCTCCCTATCAAGATCATTTGCGCATGATCATGTACGTCAATACTCCTAGTGTTTTGTTAAAGTGTCCAGAACTGTAAGTCATTAAAGTTTCTCATTCTCATTACCATTGTTTCAGTCCTGTACTAGACACGGACTCTGTCAAAATCGTTGAACGTATTCACTTGAAAATAGTCACTGTATTTAGCTGTTTAACGCCAGCCTTAGCTGGTTTCATCCACCGGATATCGGTGGCCGTATTTTTCTCGCCCGAGCCTATCGACCCCCCGGCTATGTAACAATTGTGGTCATGAATCCAGCGTTGCTAGTGGAGTCCAAGAGTTGTGTTTTACCCTACTCCTGGAACGAGTAGGAGATGAGTAGTAATTGCTTGTGAACCATGCGGTTGATCATGCACGTGATAGCTCCTAGTGTTTTGGTAAAGTTTATGGAACTGTATATCCTAAGCTTATCTTATCATATTTACCATTGTTTCAGTCTCCTGTACTACACGGGATGGTTGAACATCGTTGAACGTATTCGCTTGAAAGTACACACTTCAACAGTTTCACACCAGACAGTTCTGCTTTTATCCATTGTAATATTGATGGCTTTGATTGTCGCGCCCGAGCCATATCAGACACGGTCAGAGCCATGTAGCCAATGTGCTCATGATTTTAGCGTTGCTAGTGGAGTCCAAGCGTTGGAATTTACACAATTCTTGGAAAGAGAAGAAGAAGAGTATTCCTTGCGTGTTAACCTTGCGGTTGATCATGTACATCGTAGCTCCCAGTGTTTTGGTAAAGTTTCTGGTACTGCTAAAAAGTTTCTCATTTTTATTACCATTGTTACAATCCTGCTGTACCAGAGACCGGATGGGGGAAAATCGTTGAACGCACTCGCTTGAAGGTAGGCACGTCAAGTGTTTTATGCCAGACACCGTTGCTTTTATCCATTGGATATCGATGCTCGTAATCCTTGCACCCAAGCCTTATAGACCTGGTCACGACCATGCAGCTGATGTGGTCATGATTCTAGGGTAGCTAGTGGAGTCCAAGAGTTGTGTTTCATGCAACTTTGGGAAGGGAGAAAATTACTTGATGGGACCCCTGCGGAACACAAAAGACTTGCTGATACACAACACGATTCATTTTACCAGATGGGACCACCCTACGGCCATGCAGCATTGGGTGACGTATCGGGTGACGGCAGCCCACCGTCACCCAATACGAGTTCTGGGTTAGGTACAACCAGTGGGTGGATCAATCAGAAACTTTGACTCCAGTCCTTTGAAAGAAACAGCCCCTAACTTAAGTCCCTCAAGTCCTCACGAAGTTAAGCGGTAACGGTACACAACATAAATTTGACAGTAACAGTAACTACATTCCTTCTGATAGACATACGCATGGGGACTTCGATCTCGTTTGCAACGTTATGATACCAACATAACAGCATCATGGTCTTGAGTTTGATGATTGCAACGCAATTTTCTGAAAGAAGCTACATCCAAAGATGTCGAAAGTTTACACTGCAAGTTAGCTTACTTAGTGTATCGGTTGTGAATCCTTTCAAACACAGTTTCTACTTGTATGCAAGCGACGCTCCCATCGCATCCGTCAGAGGCTTCATCAAGAGATCATTCCTTGCACAGACGAGACCCTCAATCTGGAATCTCTGCTTTGCGTGTAAGTTCAGTAAAGTTCCTGGAGCCCCTGGGTCCCAAGCTTTCGTCTGGGGATGCTGGAAGATTCTGCCATGGCTACACAAAGCTTGATTATCGTTCCTACTACTGTCAGGCTCACTGAATTGATCGTGAACAAAGTTCAGTGATGACGCTAAGGAATCACTGAATTGTGACGGGTTTTGCTGCACCTCAAGATAGTTATACGCTCTTTTCATACAGGGATTACAAGCACTGTGCCCTTTTGGCGTGGTTGATTGACCTCTTATAAGTAACCCAAAGTGAATCGATTTCCACGCAATGCAAATTCTTCATTCTGTCATATTGAGCCAGCCTATTCCTAGACTGGTTCTTCGTTCTTATTCGACGTGGTGGAAGGACGTAGGTATTCCATCTGGTAAAATGAATCGTGTTGGGTCCCAGCAAAAGCATTTGCTGGTACCCAACACTCCGGTGGTGCAGGCTTTACTCCGGTGGAAGTAACGGCCGTATACACTTCTCATCCCATGATGCATCTCACGGATAGAAGTGCAGAACTGTATCTACATCGGTCCTCTTCTAATGCAGATTACACTGGAACAGCTACGAGAGACTTTCTCTCCCTCACACACAACTCGACTTCTAACTTTCGTTTTTATTGACCTTTGTTTATGCATATCGTAGAGGTATTACCCTTCAGTTGTAAATATAGAGTTTTCCTTATCAGTTTTGATCAGGTTGTGTCTGCGAGATATCTTCTAATATTTGGTCAATAGCGCACAGAAAAACAAAAAAAAACATGTGAATATTGTTGAGCTTCACTCGTGTGTTTCAAATTAACCTCTGGGTAGCTAAGTTAAGTTTAGTTAGCTCACCGCCTGGAGTGGGGTATTTAACCCCAGATCTTCTCGACTGTAATCACTCTCTTCACATGTTAACTATATGCGCTGTATTGCACGCGCTCACTTTGACTGCACAACTATGTTGTGATTTCACCGTAGATGCTTAGAGTCACTGCGATCAGGTCTTCAAAATCGGACCCGCTCAGATCTTGCTGTACAGATTCACATCAACCGTGTACTGGAGATAGACAAACGATCCAAGGACGCATGGAAGCATATCGCTTTTGAGACAATTAGGTCTGAGGTCAGAAGCCCATATTCTAAGGGGTCAGTCCTACAAGGGCGAGTGGAAGGGGTTGAAAGGTCTGAAAACAGTAAGCACATCTAATTATAAGGCAGATAATGGATGGAGAAGAATTCTTGTGTGATGTGGTTTTAGTTCATTGCCACGCAAAAGGTAAAATCAGCTACATACCCCGTGAGACATCTACCAGCCAATCAAAGACACCACATGTTTGACAGTCTAATATTCGTGGATACATCTTGTTGATGTTTGTAGGTTAATCCTCGTAGTTTCATAGTATATCTTTCTGACTTATGGTGAACTAATAAATACATGTTATGGTGCTTTCCTCTAAATTCGTCTTTTTACTCAACACAGTGCTATCTTGCTCTTATGTATTATTGCTCTACCATGCGTTTCTATGTGGGCAATGCCTGTTTTTTTTACGTGGATGTGTTGGAGAACACATTTTGTAACTCACAAATTAAATTTAAGCTATACCATGTTCGGATTTAAGAATATAATGCATGGTTGTATTGTTCTGATCGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGTATTCTTTCTTGATATACATAGTGATCTATTTTGTTTCAATTTGATTCAGCTCAACATCCCCATCCATAGTAACGGAAATTGATTCCATTTTACATGGTGGACTTAACATATTGACTAGATTGTATTTCCTTCATATTGGGAGTAATTACAATTCGTTCTCACAAGTTTGATTATTTTCGTGTTCAGCATTACATTGATCACTCTTATAGTCAACTTCATGAATCCGTACTAAGAGCAATCAATGCAACTTTCTTCCACCTAAGTACTCGAGTCATCCGGTGATATATTGAATCCTTCTGTTATTGAGTGTGGTTGTTTGTGGTCTGGTTTGGTCAAGTATTGTGAGCTTCTTGTTGCTTCATTTTGATTTTTAATAAAAAAATGTCTTATATTAAACTTCTGATCGATCACTTGTTTGTTTGAATGTAGAATATAGTTTAACTTGACTAAATAAAGATATGGCTGTATATGTTGTAGGAAATTTTGAACACTATATTGGCCTTTCAATCATGTTATGTGAAGGATTGGAATTCATCAAAGTCGCTTATTTTAATTCGCTATAATTCATAGTTTAGGCAAAAACAGTGTTTAGTGTCGGTGGTGGTCATATTGATACTTGTGGAATATTTTAGTATTGTGTGATCGTTATCGTGGTCTGTTTGTTATTCTGAATTTTTGGTTGAACTTGGTCAGATTCGGTTGGATGAATCTTTACAGAAATTGTAGAAAGGTAGTGTAAAAAGGTCGGTTAGATTCATCTAACCTGAAGACATTGGAGGTAAGGTCTGGATATGAGATTAACCTTCCCTTGATGGAATTAATATGAGATGTTGACTGAGGTGTTGTTTTTTTTAGATATTGAGATCTTGGTTCATACCTTTTTCTTGCTAGAATGTCCCGCTCTTCCTTCCTATCTTCTATAGTTGACTAGTTGTTACAATTCTCATATACAACTTTGCTGTAAAGTGCTTGGTAGATCATATCACAATATTGAAACTGATAGAATGGATTGATCAATATGTCTTATGGTGAATGTCATAATATTCGTCATGATCATGACTGGTATGATGATTCAGTAGTAATCAGTAGTAATCGTGCGGAAATTGTCGCGGTAGGATTCGTTTACATTTTCGCGTTTGTAGGTGTATTTCTAGACCCCATGTATCCAACTCGAACCAGAATGTTATGATGGGTATTTGTTTGGTATTTATAATGACTTTATGTGTTGAATTTGGTGGTCCTAGAAAACAAAATTTAATTCAACCTATTTTTGTTCAATGATAATTAACTCCCAATATTATGGTAGGAAAAACTGCGCGTGTAGATATAGGTATTTTATTATTCCTTCTTGGATTTAAGTTAGTTAAATATACCAATTTGACATTTACATTCATGTAATCCTCCCATCAAAAACAGACACAAGATCATGTCGTGTCATCGATGCAGTAATCCATGCAGCCAGATATACGAGATAAACACAAATTGTAGAGTGCTGCAATAATTCATCCTTCGAGCATTCTTTATTCTAGAGAGCTGCAAGAATTCTCTGCTTTTGGGCTGATTATACAATCCTTATATTGAATTATTACTTCTCATTTGGAATACACTGTGTGCACTACATGGAATTCCAGTCGAGTTTTGCGTGAGATAAGCTAATAGCAAACCTGGAGGTTGACTATGTTCTGAGTTTGAAGATCATATATATATATCACTCTCTCTCGACTTTTATATTGCGAGTTGTACAAATTTTGTTTTCAATACGATAAAAAACTGTATTTTCAGATATAACTAGATCCAACTACTAAAACACACAAGTTTACCACCCTTATATCTGCGCATACCAATACTTCCTAGAAGTCCAACTTAGAAGTAAAGAAGATTGTAATTTTTAGAATTCCAACTTATAAATAAAGAAGATTGTAATACCTCTATGTAGACAAAATCATATTTGTGCTCTAGTTATCTTTCAAATTTAACATACTTGATATAAAAAAGGGATGTTAAATTCACCCCGAGTTGTTAAATTCACCCCGTCACTTTTCATGGCAACAAGACATGTCAGAAATTATTGTTTCTTCTCGTCGCGTCGAGGATTGGTTTCGGACTCTCTTTCTCATTTTCTTTTTCTCCACTGTGCACAAGCTGCTTTCTGTGGTGATTCTTGATATGCATATGGAGGAAATAACGGAATCGGCTGCTGCATGGTTTATTGTCCGAAAGTATCGTGCTGGATCTTAGAGCTGAATCTGCCCTTGGATGTGACCCTGATCAAATTTAAAAGAGATACTGACTAAATTCAGAAGAGAGATGCAACGTGTGAGAACTTGGGTGATGAATTTAACAATCACCAATATAAATATATCAATATATAAATTTCATCAAGTCCAACGATGTACCGAGAGTGTAAACCTCTCTCTTCTCTCTTCGTTTCTCTTGTGTACATATGACAATAAGCACTTGGTTTAGTAGGTATGGAGAAACACTCTCTTGTACTGCATTTTTCATTTTGATTCACGCGCATAATTATATTTTTATTAACTAGATAAGATCTAATTTTTTACATAAATGAAATCTATCCTCCCATAATGATGATGTGGTTTTCTTCTCCACCTTAACTTTCCAACTTTCTCAAAGCTACTTTGAAGACTTAAGTTTATATTAGTGAATGGAATAGTAAGCTTTCAGTTACAATTTCATTGATGCCGGTCACTCTTGTAAGAGACCTATCATGTCGACAATTAAATAGTTCCTACTATTTATCTCATTTTCATCTCCTTGTTTTTATGTGTATGCAATAAAATGTAGTCATGGTTTGTTTACCCTAGCTGGCATTTGTGATCATTGATTCTCTTGCATGTTACATCTCAACGATCTAAACCTTTAAAGTAACGTAGTTAGACTAGAACACAGTATCCTACTCAGATTTGGAAAAGACTGGCTGAAAGATAGAATTGTAATGGTTGCAAATGGGAATGGTATGTAGTAAATTCAGTAGATATTAGTCATCGAGATTGAGTGCAAAGCATTATATCCTTTGGGTATCTTGAAATAAGTGATGTTCTTGGGGAGTTCAACTCCTTCTTCGAGTCCGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGAAGCACATGAACATCAGAGTGATCCCGTGGCATACTGTCGATAGATTCATCTATACATTTTTCACATAAAAATCTGGATGATAAGCATTATATCCTGCTCTAGCTGGTGCAACACATCAACAACAGAGTGATCCCGTGGCATACTGTCGATAGATTCATGTATACATTTTTCACATAAAAATCTAGATGCAAAGCATTATATACTTTGGGGATCTTGAAATAAGTGATGTTACTGGGGAGTTCAACAGCTTCTTCGAGTCGGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGCAGCACATCAACAACATATAGATTTTTCACATAAAAATCTGGATGCATGGGAATAGAATGATGACTTTATAATAATCTTTTCCATTAGATTCTTGATTTGAAAAAATGATTCATAGGGAATGGTTCTTGGAAATCTGACTATAATATTTTTTTTGGAAATCTGACTAATATTTCAGAAAACTCTACCGTCACTAGGAGTGACACGGTAGAGTTTTCTGAAGAACTGTTTGTTCACTTGCTGAACAAACAGTTAGCACTAAACAACATCAGTGAGCACTAAACAACAGGCTTTTTCTTGCATGATACTAGATATTGCATACTATTGACTGCGGTTGAAACTAATCCCAACAATTTTTTTTGGTTTGAAATTCAACCATACTTTAAATATTCGCTAATTTACTGTTCGGTCCCTCTCGCTCCTCTCGCTCCCCTTCCCTTCGATTCCTGTCCGTAGCACCCCTCGCCTCTTTCCTCTTGTGGGTGGAGTGAGTGGGGGCGCCAGGCGAGCACGAGACAGGATCAGACCAGAGTGGGTGCGGTGTTCCTGTCAGAAGGTTTCTTCCTTTCCACTGCTCTGTTCTTCTCTGCTCCTCCCTCTGCTCCGTTCCGTCATCCTCTTCATCTTCTTCCTCTTCCTCTCCTTCTCCTGCCGCTGCTGCATCTTGAAAATCCGTCCGGAGTAAGGTCGCGAGTTAGGCTGCGCGTAGTTTTATATGTGGACGGTGGGGGAAGTTTTTCCAGCTCGAACGGAGATCCTCGCGGGGCTTCTTGAGCTTCATTTCGATCACTGGTGAGCGTCTAGCTCTGTACTGACCACTTTCCTGTGATGTTGATGATAATGATGATTATCACTCAAGTCTGTGTCTGTCGCTGGGTCGTTTGTCTGAGTTCCCTGCGGTCACTCTTGACTCCATAAGGTGCCAGTGCGGGGGTGTGCACTCAGTATAGTATAGGATGCTGCGATGATTGGGAAAAGAAACGAAGAGTGGAAATGGAAAAGCTTGGCTCGAAATCTCCCTGGCGCCGTTGCCTCTGCTCTGATTTCTTTCTCGAATCAACTGTGTGTATTCTTGATATGTTCGTCTCTTAGAACATCTTTTCTGAGAGCATCCCGTCTGTTTGCTGAGTTTCTTCCTATGTTGGCATCATGGCTTAGGATTCTGTGATTTCTCTTCCTCCGATCCTATTCTTGTATTATAGCTTTTAATCTTCCCTGGCTCGCTCGCTCTCTCCCTCCTTGTTTTGTGATGCTAGTTTTGCTAGGGGTGTGTAGATTAATGATGTTGTTAAGTTCTTAGTTTGCACAATATTGCAGTATTTTCATCCTTGGTTTTGGAGTAGTACATTTACATTCTTCATTACAATTGTGCTTAAATTACCATTAACAACTAGACTGAGTATCCAATTCTTCTGTTTTGTGTTTGGGATTGAAGTAATTGTTAATTTTCTTGACAATTGATAGGGATTGTAATATTGAGTCCCATAGTGAATTGCATAAGATCCATAGTGAATTATAAATGAATATATATACTGTTCAAGATACAGTCAATATACGTATTTGTAAATCACCATGGGTCGATTGAGATGCAATGCTTTTAATGCATTTACAAAATTAAATATTTCTCAAATTTCACCTCAATTTTCTATCAAGTTTTTATTTGCTGATGGTATCAATTGATTATGTCATTTCTTACCATAGACAGTATCAAAGTAATGGGTTATATCTTATGGTTTTCTTATCTTTAGCGATCAAATTTTTTTTTAAACTTCTCAATACTTATAGATGCTTTGTTGAACATATTTAATCGTGGTGAATGAATATGTACGCTTCAAAATGTAGGCTTCGCAACTAACGGATAATATTTTGTTTCAGACCAATCTTTGAAATCTCTGCTTTGTATATGAAATCTGCTTATATTTTATATAGGGGAATGTTAAAACAACCACATAAATTGTTCACATGATTTGTCAAAAACAATTTTTTTCGCATAAAAGCTCAAATATCAGCTGCGAGTGTGTTTTTGACTTCCCCCTCCTTCCTGTGCAAAAAACACCTTCAGAGTTGTTATCTCACAGGGATCATTGCAATAGTTTCAGTCAGTAGTCAATAGTCATTGTTCTTGAAGTGTGTACGTAGAAGTTTGATTGTGTCTTCTGCATATATGCAGCAATATGTAACAAAAATATGCTTGGAGATGATACTTGGGCTTGTGTGCGAAATATCAATTTTTGACAGGAGACTCGTCCGTGGTAGTTTTAACATTGGATGTGATCGTTTAACATTCCCCTTTGTATATTGCTTAACCCATTATGTTGGAACTTTTTCCAACATAATTGTTTGATAGTTTGAACAGATAGGCGAAATTGAAATCCTTTTTTCCCTTGGTTGAAGATTTTATTTTTACTCTCTCTGATCTCTATGCTTCTCATTCAAAGGTCTGGGTATATGAAAGGTAATCCGTTTAGGATTTATATGGATATATCTGAATGAATGCCTCCACGGGGTAGTATTTAGATAACAATCTTGTAATTTACATAATAACATTGTAATCATCATGTTTTCATTGGTTTGGTAATATCAATAATATAGCTAATAATAGTTTGATAGCAAGAACATGAAGTAATGCGACATCAGATGCTACTGGTATTTGTATATCGGTGCGGAAATTGTATGTGATGTATGACGTATCTCATATTACAGTAGCCTCCCGTTTGAACGGGAGGCTACTGTAATATGCATCAATAGTACGCATCATTTTCCCCAAAAAATAGTTCCAAAAAATAGGGTTCAGATTTATTTAGTTCAACGTGTCATATATTTTCATTTGGCGCAAGTTTTGAAGATTCTTGCGTTTGAAACCTGATTTTTGGTATATATTTTCGGCATTAGAAGGCTGTATTTGGGTAGTAAGCCATAAAACATAAGCGAGTATCTTCCGTATTGTATAAGTTTTTAGCACCATATTGGTAGTCTAAGGCTTCCAGCAATCCATGATTGGATTTGTTGAATTAAGCTCTCTCTTCGTGAAGCATCACCTTTTGCAACCCTCGGCGATTTGTGATTGACTGAGACATCAGCCATTACCATGATTCCTTAAACTCTGTTTCTGAAATGGGTAAACTCAATGCAATACTTTTCGCTTTGGCGACGGCGGAATAGATAGATTGGACGTATTCTGTATTAACAGAATGGTAAGCATGTCTTTTAGCTTGGTGAAACAACCAACACAGGATTGAAAAGTGTTATCTTTAGCTTCATAGATATCAAGACAGATCGCTTTAGGGTTTGCTCACACATTTCTGATAGCTGCTTCACTAGCATCGGGCCAGAGCCCTTTTACTGGGAGTATCGTGGTAAGTTTTCAAATGATCGATAAGAGCTGGTTGGTGTTTCCAGGTTGTTTACCCTAGTGATAACTATCTGAGATAAATTAAGTATGGAGTTTTCATCATCCTCATCAGATTTTGTTGTTTCGAGCTTTTTCAAGTGCTCTTGTATTAGTCCCGTCACCACTTCAGCTGGCTAGCTTCAAATATTTGCCGAAGCCATACAGTAAGACAGAAAAATATGCAACTCCACTATCTCTTCTAGTTACTTAATTGGGTCAAGTGGCCTCCATTCCTCGGATTTTTAACCGAGAATCATCTCATATGCAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGTATGTTTGGATTATATGCGACCTCATCCATGCTTGTAAGTCCTTATCATTTGGTTGCAAGTTTGGTTATGGTGAAGAGTCCATACTCCTGGTGGTTATGGTGAACAATGGCAGTATAACAGTACAATCATTAATGCTCAAGTTGAATATTGAACTGCATGTAATCTCCTGATAACCTGCTCCTTTGGTTGGTTTTTTTGGGTTCAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGTAAGCTTTCCGTGGGCTTTATCATTCTTCTCGACATTGATCAGTTATATGCTGAAGTTGTTACTTGGTGTTCATGATTTCCAAATTCGAGCAATGTCTTGGATCCGCACGAAGGTGTTCATTTAAACATCACTCGATGTTTCTTTTTTTGTTTATTGTAGGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAGTACGTCAAATGGGCTTCTTATCTACTAGTCTTTGTCTATCAGTGTATCATATTTCTCCGTGTGGAATCTCTGCTACACTTACAACGATAGGACTCCTTGACAACACTACTTCATGCTACTAATGTGTTTGGCTTTATGTTCAGCAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGGTTGGTTTTGTCTTGGAGACTGCCCTAACATTTCGACATGGTTGCATGAAGTATCTGCTTGATTGTTGGGGATCTCTTTCCAAGCCCCTTTACAATTATCAGTAAATTTCTGATGTGGTTGGGAAGAGTAGGTACTAGAGTATAATAAGCTGCCTCTGGTCGTGACTAAAATACAGTTTTGGTCAATACGTGATTCTCTTACAATGTTGCCATCTACTATTCTCTTGAAACCATCCACTCTTTGCAGTGGCTCTCATGGATGCATTATCTTCTGGCCTTCTGTGTACCATCCCCAACTTGAGTCTCCTAGTTTTTTTGTTAGTCTTCAAAATTGCTTGATATTGTTGTGTTCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGTATGTTTTGTCACTTAGTTTCACACTTTACGCGGAGTTCAAGTTTGTGTCGTATACTTGGTGGTTTGCATGTTGTCCATTTATAACTGGAGAGAGGATCTATTCTGGACTTGACCACTCATTTCACTATTTACTATTATTGAAGTGATTGTGGAGGATTATCATGGGGTTGATACTGATCTTTCGTTCACTTGAGTCTTCACTGTCGAAATCATGATTTAGATGTTTTGGTATGATCAAACTGAATGTAGTCAACGCATCTTCGTCTTCTGAGATTAAATTTGCGATGGATGATGCGAGTTACATACATGCAGTATATCCTGAAAAGAACGCTAGAATTGATTGTGTGACTTCCCGTTGTGCAGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTAGAGTTTCATAGAGGTGGTCTTTATTGTGTGCTAAAATCTTATAACGTATAAATATGTGATCAGACCTAGCATGGTTGTTGCTTGATTTAGCTATGTTGTTAAAGAAATCATACACTGTCCAAAAGTTCTAGCGAGAGCATGCATCAAGTACAAAGCATTAGATTCAACCTTTAACCCATTTTATTTTCATTTTCTCGCAAGGCGCAGATAATTGAAAATTTTACCTTTGTATTTTTTCAAAGTAGCAAGAGTTCACAACCTTTAGGCTGAATCCGTTCTTTGAATTGATCGTAAATGATGAAGTGTGAAGTGCATAGGGGTTAGAATTTATTGCCTAATCGAAGACAAGTAATTTCTTTTTTCCTGTTTGTGTTTTTGGGATTACTTACAGTTATTCTCCTTTATATTGCTGAGTTTTAGAATTGTCTGTTCCAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGTTTGTTTTAATGCTCGAATATTCAGGGGAATAACACACTCAGCTGAGATCTTGATAGTTGTCTCAGTTTAGTCGTCCTTTTGTTGCTGTTAACTTGAGCATGTGGTTTGCAAGTTAGAGTGTTCAAAGGAAGGTCGTCGTAGGTTGATCTAGAAATCTGGGAGATGATCGCGAAGACAATGTCTGCAAACTTCATCAGAATCAAGTCAGAAATAGAGGAGCTAATTTTCTCGAGCAATATTTCCATTTTCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGTACGTCGTGCGTAATGAACCATGTTGACCTCCTTGGACGAATGGACGGAATGACCTTGAAGTAGTCAACCAGAACTTATTCAGAAGGCTTTCTCTGTTTTGGTGCTGATCAATTTCTTCGATGTCGACATGTCTTTATGAAATGCAATGGCCATCGTTGATCAACAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGTGAGGTCCTATATGCTTCTCTAAGCATTTGGGTGGTTTCTTGAGCAAAGGACGCAGCTATGTTTTGAGGTCCCTTCTTGTCTTTCTAACCGCCGAGTACAATTGGCTGGTTCCGTGAGCTCAGCACCTCGCTATCTGTTGTATCTTTCTTGTTTCTCCTTCAACGTGAAGATGATGGTTCAGATTTAATCCGGTCATGTTCTTCACAATTCTTATTTCTTGCTGAGTTTGTCTTTACGTCATACAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGGTAAGGAGTTTAGAAGAAACCGTCAGTAGGAAGCTGTCTAGTGATATTGATTCACACCTTGATTATTGTTATATTTACCTGATAAATTCTGTTGTTTCCGCTTTTGAGAATTGTGTTTAAAGTACACAGTCTGAACCTCATTTTCTTTTGCCTTCGATGGACAAACTTATTTCTATGTTTTTGACAGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACGTAAGTAAAAGACAGAACTAGCTAAGACAAAAGTTTCTGCAAGTCTGGGGTTGTTTATTTTATTACAATTACATGATGTGCAAGTTGACTTTTGGAAAAACTTTTCGAGATCAATCGCTCACTCTGTGTCTTAACGTCTGTTGAATATAGTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGTGAGCTTTCCAATTCTGTTATTCTGTTTTTCTTCTCTTGACCAGCTTGCCGCCAAAGCTGCGTGGTGAACTTTCATTTCTTGTAAAGAGACATCGAGAACTGATTCATTTGGACAATATAAAGCAAAAGGCAGTATGAGTAGTGGTCGGAGTCGGTGATGGCAGTCTTTGCCACCTCATATTCTGAGTTTTCACGGGATTACAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGGTAACTATCTAGTCTGAACGCCCTTGAGGATAACCACGAGGACGTATTCGATGCTTAAGTAAATGATAACCTCTTGCATATTTTACTCATTCATGTGGCCGTTATCCCAACCCTGTTGTATTATAGGAGTATCTGAAATTTGATTCTTTCTTTCATGACCTTTACAGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGGTAATTACATGCCAAACGTAGTAAGCTCTAGCTTCACAGCTTGTGTGGTCAAACCGCCTGGATGTTCTCTGTATGTAGGTAGTCCCATTTGTCAAAAACACGCAACAAATCTGCCGAGGAAAGTAGAACAACAATGCAATATTTACGTATTCTTGTTAGAAATTAGACACGTTTTACATTTATATTTTTTCAAGGAAAGTTGATCTCATGATTTCAAGCTTGCTTCGTTGTTTTTAACCCACATTCATCTTGAATTGAATACATTTTCTGGTTTAAGTGCTAAAACTTGGTGGGAAAAATCTAATTTGTTCTTCCTGGGAACAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

mRNA

>Mapoly0075s0051.5
CCAGATGACCGGGACGTTGGACGGAAGTGTGGGGTCGATGTGTGAGAGACCACGGGAGGACCAGAAATGAGGGACGGACCGAGTCGGGGACATGGTACAGGGACAGCGGTTCGAGGGGATAGCGAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAACAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

CDS

>Mapoly0075s0051.5
ATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAACAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAA

Protein

>Mapoly0075s0051.5
MGAGAGAAAAIENEPSPRRAAIEKAQAELRREVAVREERRRELEFLEKGGELLDFFSAANFALPPSSPTDPLADQLLSSEGEGGHASVALTNGDSVENSVGTSLCVGRSSEGGGDLCPGEDFLSAVIEPLTPWEGKGRASRTGSTSLRSHSDVNLKRESEGSGGGRAAVKGQAYSRRNRPRSNRFGNGHTPTRDVEKAGEVGVLPSIEIKGSPAPPVIFEEVTEENETMVDKKLQVLPAPTLLYNSHASTQLGPVTTKVIEDLEATHLPTGKSFEQNSVKAVHAADDALQTGREFQIHDLAASSCGSLQRSSDLREDVCTGIVVKDELVVVGDLKKVDQTSLSPHVEKNVDSRDGGAVSQPSEQVLGNNQAASDKACGLPSMVEDESAIVMIMDESLGSRTSKNECKDKSTVVSETKGDRVIDRSTIITKHGPDSMLTPTIDDKTSVLREVSCTMQLTPKSLDTSENKSIISRKTTSTASSGAPDLIQNDKARIDDPPSDARVEVKVEEGLSEVGTRLSTVDTQVESGHDVKSICVVSLPQEEIKSESQSTPVSAGSNRAGFRTPNSNTASINKFPGVVLPWEKERDPNVRAEAERHKADLSAKARKAHEDYILEEAEIIKKSKKDTAEWAKRSPHLEPARRKSHWDYLLQEMAWMANDFMQERLWKLASATQFCRWIAEQRGQSSVLQLAGIKQRQERVARVLANAINEFWRSVEYIIHKDKRLTLSSLENQESVVAMKEDSEAVPMDVDIPSIPEGSTQRVEKLPSRSRKPLPVQNYAIRFLKESMGSDVGAQAEAPCTPERISEANSVLDPLWEDQFPEEPLFYLVPDGASRAYRILIETERSSLEIEHEQTLHDHAAAIADAEAVAEAAANADFNVSLSVGEGQPLSVLSSPMKGLRAEEDELGGQFLPNALSSIAKKKRKNILKSNASKGEGISSSGPTHRPPIAPGLDSTAVVQSPLVTGKRSLSVGPGNIVGNVGSIPTKRMRSVSSARQRVMGTASPNSFPSPGGLLQRTIFSSGALNSHQDEVRNLCDDTATRIEADATTVSVKNGLGAGCNNSFVNSKSKKKKKTKHFSGQLSSVNAVKGDGAPSVNTASSTKQTPEAEHRSVFDQLKRKGDQVNAASVELDTGGIGSSADTPETPSSQGQQPSKKAKVSKQASDLNPEAAAAAISTAATQSGSLVANTSSTSKLLRQNSNRDRNRKTKSTKVPLTQPAGIGIPWSTIEDQAIFALVHDLGPNWELVSDVLSSSSQLKGIFRKPKQCKERYKSLLDRMSVGEGGDSPEDPSTSQPHPSTLPGIPKGSARVLLQRIQGPMEEDTLKVHLEHIVRVVHKFRALKPPTEEQKLLVQPHASHLNAITQFCANGYPTPSDLCEITAAAPELGGPAYQLPGQHLPGVLAAGSGIRPATNGLPVLPSASNLHMGVPAVAPSTTAASAARDAAVYRDVHRLAAIRPFSPEDAQRVRYHRAMAAARGLSVSGPTVTAGLPMMGLPSPSDCPVPLLGSGNNNIGMMGGISRGMSLSRPGLPGMGSPGVPGIGPPPLGSVLSTGGVGIVSAGPTVGPTVVPQQVNLIRRSREQQLVRPGRSNEDQRRFIEELKHQAAQGNTQAATALSSLGSEVTREMMAVQAQPFQQLQHQNHQQQQQQQQYLAARMAKERQMQQQQKQRLLQQQLQQPQQPSSLQPQLQTQMQQQQMHGMSQQHVLPQQSHLSQQQHLLSSQQHNLQKQQSQQGPQQTGTLSSPSLQPTTIPSMQSNHQQHQTLLQPQQQAPPLGQVQQLPVQSKLQPPKQAQKHPHLQQASQVVQQQPPRGSKGVVRGNMLVQALPGSGQSSMLPGNVSAGSQPQQVAGQQIAHSMQGQRHLMPLAKPLSQTSTQVMTGQSAHMQAQQNQSMAGPVPQGSLGGSQKVVSQQPTQLGTMPSKQLQPSPLPSALPSQQQSPAPPLPTQQQQTSPPAAQQPQIGSSQQLQVQQRRPSQQAQIQSAQRRIQQRQPVASVGAPMIGVLGKNGSSTQQGQVPAQMSSQPGHVTYTQGSSMAVPMSMMSASSGASGLSSSGSPSSSGVHSTPWKPGQVVSPMSSGFYNLSRSGSPGAAQLPSIVSSSGMHLASSNGNSGMSITGSGPPHGVIVGSLSQPLQVGSGGHGLKMGLVTGSNPRGVSTTLQGGTQRSIQHHGNLPASPAIGATQQVRSPVPASSAGMMPVSALGTNTVAGVSSSGSMAYQANSSSLSGHSTAISNSMHMFSVQPRQSHAGSAAATTPAVPMKSPPTSGTSQTSAVSPSSPAPVIPASNTISSSVAEPSPP

Mapoly0075s0051.6  

Gene structure:

mRNA scaffold_75:641574..665394  ( - strand )
three_prime_UTR scaffold_75:641574..642323  ( - strand )
CDS scaffold_75:642324..642350  ( - strand )
CDS scaffold_75:642627..642743  ( - strand )
CDS scaffold_75:643068..645041  ( - strand )
CDS scaffold_75:645209..645623  ( - strand )
CDS scaffold_75:645847..646056  ( - strand )
CDS scaffold_75:646207..646289  ( - strand )
CDS scaffold_75:646477..646593  ( - strand )
CDS scaffold_75:646841..646981  ( - strand )
CDS scaffold_75:647150..647230  ( - strand )
CDS scaffold_75:647484..647540  ( - strand )
CDS scaffold_75:647979..648205  ( - strand )
CDS scaffold_75:648571..648631  ( - strand )
CDS scaffold_75:648986..649021  ( - strand )
CDS scaffold_75:649169..649927  ( - strand )
CDS scaffold_75:650089..650172  ( - strand )
CDS scaffold_75:650380..650574  ( - strand )
CDS scaffold_75:657671..657955  ( - strand )
CDS scaffold_75:661720..661842  ( - strand )
CDS scaffold_75:662002..663628  ( - strand )
CDS scaffold_75:663929..664020  ( - strand )
CDS scaffold_75:664281..664335  ( - strand )
CDS scaffold_75:664437..664525  ( - strand )
five_prime_UTR scaffold_75:664526..664680  ( - strand )
five_prime_UTR scaffold_75:664916..665394  ( - strand )

Sequences:

Gene

>Mapoly0075s0051.6
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTATGAATTTAGGGTTCGCAGAGAGATAGGAAAAGGCTTTGTTTGCAAAATATGTGAGTGCTATATTTTCGCTTGCGAAGAGTGAGTTTGATCGATCGAAAAGCACTGACCCTTTCTAACGCGATAAATTCGCTAGAAACAATACTGTTTTTTTTGGGGTATTTGTTTTCGTATTATTTTTCCCCGACGTTTTTCTCGCTTGGTTACGACTCTGTGGATTTGTGCAATTTGGCAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGGTTGGGCGTTGTATCACTGTACTATGGAACACTCGGCAATTTCAATTGCTTTACTTGCATTTCACTTAGAAAGTAACCTCTTGGTCTTTGGTTGGTCACAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGTATGTTTACTGTATTGTAGCTTGCTTAGTTTTTTGAACGAAGAAGTTTCAAATGTTTAGATTTTTAAAAAATATAATTAAGTGCATGTATTTAGCTCAACTTGCAAATTACAGAGAGGTAGATCTTGATGGTTTAGTGTCATCACTAGTGTTTTAAGTTGCACAGGCTGTTCAAAAGTGGAATCTGAATACGTTGTTTTCTGTATCCATTTTGTTTGCTTTTCTTTCTGCTTATGTTCTCAATAAGCTTATTCGTGCAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGGTTCTTACATGACTTGGATTGCTTATGAAGATGGAAATTTTTAAGAGCACTAGAAGAGTGTAGAACTTTCACTATTGACTGCCTATGTATTTTCGACGTTGACTGTTGAGGTGTATTTGTGAATTGATCTGTTCAAAAGTGTTCATTCGAGCCCAAGTTACTGTCAAATCAAAGGGCCTCGTTGTACCGTTCAGGTTATGTCTACGTGTAGTTTTTGCAGACGATGGTTGTGAAGAAAACAAGTGTTGCCTATACATTGTGCATAAGACAGAATTGACCTCACATATGTCTTTTTGGCAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGGTACTGTGGATGTGTTCTTCCTCATGAGTTTATACATTGAAGGTCTAACTAGTGTTCATGGTTCAAGCTCGGCGCTTTCTGGTTTCTTCTCAATTGTCAAGTTATGATTTCAGTACAAGTCTCAACTACTAATGAGTTCAGATTTGATATATTTCCCAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGTGCATTTCTTCCTTTGATTGTGTTATAGTAGTCTCTCTCGTTTTGGAACTGGGATGGTTCATGTACGCTTTTGCGTTAAGCATGCGCAAGAACTTTCTCTTATCCCACAAGTTTGATGTTAACTAGTCATTGATACTACATAGTCACATACATTTTCTGACTACCAAGCTATCGATTTACATTTTTCTTCCATTGGCAAGTTAGCGTCGCGTACTCTCAACCTCCATCGAACTCCAGTGTATGAAAGATCTTTTCTTTGGGCTGCATCTAGGTTGCATCCAGTCGTTGTATTCACAACAGAATTTAATGGAGTGGAACATATTTCAACCATAGTCCCGCTAATCGCATTGAGAACTTTACTTGATATTGCTGGGCAAATATTGTATTGTATATCAAAACAATTAGTAAAAGAAAATTAACAGGGGAACTCTAGAGTTCTAAGACAACAGCTCTCCCTATCAAGATCATTTGCGCATGATCATGTACGTCAATACTCCTAGTGTTTTGTTAAAGTGTCCAGAACTGTAAGTCATTAAAGTTTCTCATTCTCATTACCATTGTTTCAGTCCTGTACTAGACACGGACTCTGTCAAAATCGTTGAACGTATTCACTTGAAAATAGTCACTGTATTTAGCTGTTTAACGCCAGCCTTAGCTGGTTTCATCCACCGGATATCGGTGGCCGTATTTTTCTCGCCCGAGCCTATCGACCCCCCGGCTATGTAACAATTGTGGTCATGAATCCAGCGTTGCTAGTGGAGTCCAAGAGTTGTGTTTTACCCTACTCCTGGAACGAGTAGGAGATGAGTAGTAATTGCTTGTGAACCATGCGGTTGATCATGCACGTGATAGCTCCTAGTGTTTTGGTAAAGTTTATGGAACTGTATATCCTAAGCTTATCTTATCATATTTACCATTGTTTCAGTCTCCTGTACTACACGGGATGGTTGAACATCGTTGAACGTATTCGCTTGAAAGTACACACTTCAACAGTTTCACACCAGACAGTTCTGCTTTTATCCATTGTAATATTGATGGCTTTGATTGTCGCGCCCGAGCCATATCAGACACGGTCAGAGCCATGTAGCCAATGTGCTCATGATTTTAGCGTTGCTAGTGGAGTCCAAGCGTTGGAATTTACACAATTCTTGGAAAGAGAAGAAGAAGAGTATTCCTTGCGTGTTAACCTTGCGGTTGATCATGTACATCGTAGCTCCCAGTGTTTTGGTAAAGTTTCTGGTACTGCTAAAAAGTTTCTCATTTTTATTACCATTGTTACAATCCTGCTGTACCAGAGACCGGATGGGGGAAAATCGTTGAACGCACTCGCTTGAAGGTAGGCACGTCAAGTGTTTTATGCCAGACACCGTTGCTTTTATCCATTGGATATCGATGCTCGTAATCCTTGCACCCAAGCCTTATAGACCTGGTCACGACCATGCAGCTGATGTGGTCATGATTCTAGGGTAGCTAGTGGAGTCCAAGAGTTGTGTTTCATGCAACTTTGGGAAGGGAGAAAATTACTTGATGGGACCCCTGCGGAACACAAAAGACTTGCTGATACACAACACGATTCATTTTACCAGATGGGACCACCCTACGGCCATGCAGCATTGGGTGACGTATCGGGTGACGGCAGCCCACCGTCACCCAATACGAGTTCTGGGTTAGGTACAACCAGTGGGTGGATCAATCAGAAACTTTGACTCCAGTCCTTTGAAAGAAACAGCCCCTAACTTAAGTCCCTCAAGTCCTCACGAAGTTAAGCGGTAACGGTACACAACATAAATTTGACAGTAACAGTAACTACATTCCTTCTGATAGACATACGCATGGGGACTTCGATCTCGTTTGCAACGTTATGATACCAACATAACAGCATCATGGTCTTGAGTTTGATGATTGCAACGCAATTTTCTGAAAGAAGCTACATCCAAAGATGTCGAAAGTTTACACTGCAAGTTAGCTTACTTAGTGTATCGGTTGTGAATCCTTTCAAACACAGTTTCTACTTGTATGCAAGCGACGCTCCCATCGCATCCGTCAGAGGCTTCATCAAGAGATCATTCCTTGCACAGACGAGACCCTCAATCTGGAATCTCTGCTTTGCGTGTAAGTTCAGTAAAGTTCCTGGAGCCCCTGGGTCCCAAGCTTTCGTCTGGGGATGCTGGAAGATTCTGCCATGGCTACACAAAGCTTGATTATCGTTCCTACTACTGTCAGGCTCACTGAATTGATCGTGAACAAAGTTCAGTGATGACGCTAAGGAATCACTGAATTGTGACGGGTTTTGCTGCACCTCAAGATAGTTATACGCTCTTTTCATACAGGGATTACAAGCACTGTGCCCTTTTGGCGTGGTTGATTGACCTCTTATAAGTAACCCAAAGTGAATCGATTTCCACGCAATGCAAATTCTTCATTCTGTCATATTGAGCCAGCCTATTCCTAGACTGGTTCTTCGTTCTTATTCGACGTGGTGGAAGGACGTAGGTATTCCATCTGGTAAAATGAATCGTGTTGGGTCCCAGCAAAAGCATTTGCTGGTACCCAACACTCCGGTGGTGCAGGCTTTACTCCGGTGGAAGTAACGGCCGTATACACTTCTCATCCCATGATGCATCTCACGGATAGAAGTGCAGAACTGTATCTACATCGGTCCTCTTCTAATGCAGATTACACTGGAACAGCTACGAGAGACTTTCTCTCCCTCACACACAACTCGACTTCTAACTTTCGTTTTTATTGACCTTTGTTTATGCATATCGTAGAGGTATTACCCTTCAGTTGTAAATATAGAGTTTTCCTTATCAGTTTTGATCAGGTTGTGTCTGCGAGATATCTTCTAATATTTGGTCAATAGCGCACAGAAAAACAAAAAAAAACATGTGAATATTGTTGAGCTTCACTCGTGTGTTTCAAATTAACCTCTGGGTAGCTAAGTTAAGTTTAGTTAGCTCACCGCCTGGAGTGGGGTATTTAACCCCAGATCTTCTCGACTGTAATCACTCTCTTCACATGTTAACTATATGCGCTGTATTGCACGCGCTCACTTTGACTGCACAACTATGTTGTGATTTCACCGTAGATGCTTAGAGTCACTGCGATCAGGTCTTCAAAATCGGACCCGCTCAGATCTTGCTGTACAGATTCACATCAACCGTGTACTGGAGATAGACAAACGATCCAAGGACGCATGGAAGCATATCGCTTTTGAGACAATTAGGTCTGAGGTCAGAAGCCCATATTCTAAGGGGTCAGTCCTACAAGGGCGAGTGGAAGGGGTTGAAAGGTCTGAAAACAGTAAGCACATCTAATTATAAGGCAGATAATGGATGGAGAAGAATTCTTGTGTGATGTGGTTTTAGTTCATTGCCACGCAAAAGGTAAAATCAGCTACATACCCCGTGAGACATCTACCAGCCAATCAAAGACACCACATGTTTGACAGTCTAATATTCGTGGATACATCTTGTTGATGTTTGTAGGTTAATCCTCGTAGTTTCATAGTATATCTTTCTGACTTATGGTGAACTAATAAATACATGTTATGGTGCTTTCCTCTAAATTCGTCTTTTTACTCAACACAGTGCTATCTTGCTCTTATGTATTATTGCTCTACCATGCGTTTCTATGTGGGCAATGCCTGTTTTTTTTACGTGGATGTGTTGGAGAACACATTTTGTAACTCACAAATTAAATTTAAGCTATACCATGTTCGGATTTAAGAATATAATGCATGGTTGTATTGTTCTGATCGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGTATTCTTTCTTGATATACATAGTGATCTATTTTGTTTCAATTTGATTCAGCTCAACATCCCCATCCATAGTAACGGAAATTGATTCCATTTTACATGGTGGACTTAACATATTGACTAGATTGTATTTCCTTCATATTGGGAGTAATTACAATTCGTTCTCACAAGTTTGATTATTTTCGTGTTCAGCATTACATTGATCACTCTTATAGTCAACTTCATGAATCCGTACTAAGAGCAATCAATGCAACTTTCTTCCACCTAAGTACTCGAGTCATCCGGTGATATATTGAATCCTTCTGTTATTGAGTGTGGTTGTTTGTGGTCTGGTTTGGTCAAGTATTGTGAGCTTCTTGTTGCTTCATTTTGATTTTTAATAAAAAAATGTCTTATATTAAACTTCTGATCGATCACTTGTTTGTTTGAATGTAGAATATAGTTTAACTTGACTAAATAAAGATATGGCTGTATATGTTGTAGGAAATTTTGAACACTATATTGGCCTTTCAATCATGTTATGTGAAGGATTGGAATTCATCAAAGTCGCTTATTTTAATTCGCTATAATTCATAGTTTAGGCAAAAACAGTGTTTAGTGTCGGTGGTGGTCATATTGATACTTGTGGAATATTTTAGTATTGTGTGATCGTTATCGTGGTCTGTTTGTTATTCTGAATTTTTGGTTGAACTTGGTCAGATTCGGTTGGATGAATCTTTACAGAAATTGTAGAAAGGTAGTGTAAAAAGGTCGGTTAGATTCATCTAACCTGAAGACATTGGAGGTAAGGTCTGGATATGAGATTAACCTTCCCTTGATGGAATTAATATGAGATGTTGACTGAGGTGTTGTTTTTTTTAGATATTGAGATCTTGGTTCATACCTTTTTCTTGCTAGAATGTCCCGCTCTTCCTTCCTATCTTCTATAGTTGACTAGTTGTTACAATTCTCATATACAACTTTGCTGTAAAGTGCTTGGTAGATCATATCACAATATTGAAACTGATAGAATGGATTGATCAATATGTCTTATGGTGAATGTCATAATATTCGTCATGATCATGACTGGTATGATGATTCAGTAGTAATCAGTAGTAATCGTGCGGAAATTGTCGCGGTAGGATTCGTTTACATTTTCGCGTTTGTAGGTGTATTTCTAGACCCCATGTATCCAACTCGAACCAGAATGTTATGATGGGTATTTGTTTGGTATTTATAATGACTTTATGTGTTGAATTTGGTGGTCCTAGAAAACAAAATTTAATTCAACCTATTTTTGTTCAATGATAATTAACTCCCAATATTATGGTAGGAAAAACTGCGCGTGTAGATATAGGTATTTTATTATTCCTTCTTGGATTTAAGTTAGTTAAATATACCAATTTGACATTTACATTCATGTAATCCTCCCATCAAAAACAGACACAAGATCATGTCGTGTCATCGATGCAGTAATCCATGCAGCCAGATATACGAGATAAACACAAATTGTAGAGTGCTGCAATAATTCATCCTTCGAGCATTCTTTATTCTAGAGAGCTGCAAGAATTCTCTGCTTTTGGGCTGATTATACAATCCTTATATTGAATTATTACTTCTCATTTGGAATACACTGTGTGCACTACATGGAATTCCAGTCGAGTTTTGCGTGAGATAAGCTAATAGCAAACCTGGAGGTTGACTATGTTCTGAGTTTGAAGATCATATATATATATCACTCTCTCTCGACTTTTATATTGCGAGTTGTACAAATTTTGTTTTCAATACGATAAAAAACTGTATTTTCAGATATAACTAGATCCAACTACTAAAACACACAAGTTTACCACCCTTATATCTGCGCATACCAATACTTCCTAGAAGTCCAACTTAGAAGTAAAGAAGATTGTAATTTTTAGAATTCCAACTTATAAATAAAGAAGATTGTAATACCTCTATGTAGACAAAATCATATTTGTGCTCTAGTTATCTTTCAAATTTAACATACTTGATATAAAAAAGGGATGTTAAATTCACCCCGAGTTGTTAAATTCACCCCGTCACTTTTCATGGCAACAAGACATGTCAGAAATTATTGTTTCTTCTCGTCGCGTCGAGGATTGGTTTCGGACTCTCTTTCTCATTTTCTTTTTCTCCACTGTGCACAAGCTGCTTTCTGTGGTGATTCTTGATATGCATATGGAGGAAATAACGGAATCGGCTGCTGCATGGTTTATTGTCCGAAAGTATCGTGCTGGATCTTAGAGCTGAATCTGCCCTTGGATGTGACCCTGATCAAATTTAAAAGAGATACTGACTAAATTCAGAAGAGAGATGCAACGTGTGAGAACTTGGGTGATGAATTTAACAATCACCAATATAAATATATCAATATATAAATTTCATCAAGTCCAACGATGTACCGAGAGTGTAAACCTCTCTCTTCTCTCTTCGTTTCTCTTGTGTACATATGACAATAAGCACTTGGTTTAGTAGGTATGGAGAAACACTCTCTTGTACTGCATTTTTCATTTTGATTCACGCGCATAATTATATTTTTATTAACTAGATAAGATCTAATTTTTTACATAAATGAAATCTATCCTCCCATAATGATGATGTGGTTTTCTTCTCCACCTTAACTTTCCAACTTTCTCAAAGCTACTTTGAAGACTTAAGTTTATATTAGTGAATGGAATAGTAAGCTTTCAGTTACAATTTCATTGATGCCGGTCACTCTTGTAAGAGACCTATCATGTCGACAATTAAATAGTTCCTACTATTTATCTCATTTTCATCTCCTTGTTTTTATGTGTATGCAATAAAATGTAGTCATGGTTTGTTTACCCTAGCTGGCATTTGTGATCATTGATTCTCTTGCATGTTACATCTCAACGATCTAAACCTTTAAAGTAACGTAGTTAGACTAGAACACAGTATCCTACTCAGATTTGGAAAAGACTGGCTGAAAGATAGAATTGTAATGGTTGCAAATGGGAATGGTATGTAGTAAATTCAGTAGATATTAGTCATCGAGATTGAGTGCAAAGCATTATATCCTTTGGGTATCTTGAAATAAGTGATGTTCTTGGGGAGTTCAACTCCTTCTTCGAGTCCGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGAAGCACATGAACATCAGAGTGATCCCGTGGCATACTGTCGATAGATTCATCTATACATTTTTCACATAAAAATCTGGATGATAAGCATTATATCCTGCTCTAGCTGGTGCAACACATCAACAACAGAGTGATCCCGTGGCATACTGTCGATAGATTCATGTATACATTTTTCACATAAAAATCTAGATGCAAAGCATTATATACTTTGGGGATCTTGAAATAAGTGATGTTACTGGGGAGTTCAACAGCTTCTTCGAGTCGGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGCAGCACATCAACAACATATAGATTTTTCACATAAAAATCTGGATGCATGGGAATAGAATGATGACTTTATAATAATCTTTTCCATTAGATTCTTGATTTGAAAAAATGATTCATAGGGAATGGTTCTTGGAAATCTGACTATAATATTTTTTTTGGAAATCTGACTAATATTTCAGAAAACTCTACCGTCACTAGGAGTGACACGGTAGAGTTTTCTGAAGAACTGTTTGTTCACTTGCTGAACAAACAGTTAGCACTAAACAACATCAGTGAGCACTAAACAACAGGCTTTTTCTTGCATGATACTAGATATTGCATACTATTGACTGCGGTTGAAACTAATCCCAACAATTTTTTTTGGTTTGAAATTCAACCATACTTTAAATATTCGCTAATTTACTGTTCGGTCCCTCTCGCTCCTCTCGCTCCCCTTCCCTTCGATTCCTGTCCGTAGCACCCCTCGCCTCTTTCCTCTTGTGGGTGGAGTGAGTGGGGGCGCCAGGCGAGCACGAGACAGGATCAGACCAGAGTGGGTGCGGTGTTCCTGTCAGAAGGTTTCTTCCTTTCCACTGCTCTGTTCTTCTCTGCTCCTCCCTCTGCTCCGTTCCGTCATCCTCTTCATCTTCTTCCTCTTCCTCTCCTTCTCCTGCCGCTGCTGCATCTTGAAAATCCGTCCGGAGTAAGGTCGCGAGTTAGGCTGCGCGTAGTTTTATATGTGGACGGTGGGGGAAGTTTTTCCAGCTCGAACGGAGATCCTCGCGGGGCTTCTTGAGCTTCATTTCGATCACTGGTGAGCGTCTAGCTCTGTACTGACCACTTTCCTGTGATGTTGATGATAATGATGATTATCACTCAAGTCTGTGTCTGTCGCTGGGTCGTTTGTCTGAGTTCCCTGCGGTCACTCTTGACTCCATAAGGTGCCAGTGCGGGGGTGTGCACTCAGTATAGTATAGGATGCTGCGATGATTGGGAAAAGAAACGAAGAGTGGAAATGGAAAAGCTTGGCTCGAAATCTCCCTGGCGCCGTTGCCTCTGCTCTGATTTCTTTCTCGAATCAACTGTGTGTATTCTTGATATGTTCGTCTCTTAGAACATCTTTTCTGAGAGCATCCCGTCTGTTTGCTGAGTTTCTTCCTATGTTGGCATCATGGCTTAGGATTCTGTGATTTCTCTTCCTCCGATCCTATTCTTGTATTATAGCTTTTAATCTTCCCTGGCTCGCTCGCTCTCTCCCTCCTTGTTTTGTGATGCTAGTTTTGCTAGGGGTGTGTAGATTAATGATGTTGTTAAGTTCTTAGTTTGCACAATATTGCAGTATTTTCATCCTTGGTTTTGGAGTAGTACATTTACATTCTTCATTACAATTGTGCTTAAATTACCATTAACAACTAGACTGAGTATCCAATTCTTCTGTTTTGTGTTTGGGATTGAAGTAATTGTTAATTTTCTTGACAATTGATAGGGATTGTAATATTGAGTCCCATAGTGAATTGCATAAGATCCATAGTGAATTATAAATGAATATATATACTGTTCAAGATACAGTCAATATACGTATTTGTAAATCACCATGGGTCGATTGAGATGCAATGCTTTTAATGCATTTACAAAATTAAATATTTCTCAAATTTCACCTCAATTTTCTATCAAGTTTTTATTTGCTGATGGTATCAATTGATTATGTCATTTCTTACCATAGACAGTATCAAAGTAATGGGTTATATCTTATGGTTTTCTTATCTTTAGCGATCAAATTTTTTTTTAAACTTCTCAATACTTATAGATGCTTTGTTGAACATATTTAATCGTGGTGAATGAATATGTACGCTTCAAAATGTAGGCTTCGCAACTAACGGATAATATTTTGTTTCAGACCAATCTTTGAAATCTCTGCTTTGTATATGAAATCTGCTTATATTTTATATAGGGGAATGTTAAAACAACCACATAAATTGTTCACATGATTTGTCAAAAACAATTTTTTTCGCATAAAAGCTCAAATATCAGCTGCGAGTGTGTTTTTGACTTCCCCCTCCTTCCTGTGCAAAAAACACCTTCAGAGTTGTTATCTCACAGGGATCATTGCAATAGTTTCAGTCAGTAGTCAATAGTCATTGTTCTTGAAGTGTGTACGTAGAAGTTTGATTGTGTCTTCTGCATATATGCAGCAATATGTAACAAAAATATGCTTGGAGATGATACTTGGGCTTGTGTGCGAAATATCAATTTTTGACAGGAGACTCGTCCGTGGTAGTTTTAACATTGGATGTGATCGTTTAACATTCCCCTTTGTATATTGCTTAACCCATTATGTTGGAACTTTTTCCAACATAATTGTTTGATAGTTTGAACAGATAGGCGAAATTGAAATCCTTTTTTCCCTTGGTTGAAGATTTTATTTTTACTCTCTCTGATCTCTATGCTTCTCATTCAAAGGTCTGGGTATATGAAAGGTAATCCGTTTAGGATTTATATGGATATATCTGAATGAATGCCTCCACGGGGTAGTATTTAGATAACAATCTTGTAATTTACATAATAACATTGTAATCATCATGTTTTCATTGGTTTGGTAATATCAATAATATAGCTAATAATAGTTTGATAGCAAGAACATGAAGTAATGCGACATCAGATGCTACTGGTATTTGTATATCGGTGCGGAAATTGTATGTGATGTATGACGTATCTCATATTACAGTAGCCTCCCGTTTGAACGGGAGGCTACTGTAATATGCATCAATAGTACGCATCATTTTCCCCAAAAAATAGTTCCAAAAAATAGGGTTCAGATTTATTTAGTTCAACGTGTCATATATTTTCATTTGGCGCAAGTTTTGAAGATTCTTGCGTTTGAAACCTGATTTTTGGTATATATTTTCGGCATTAGAAGGCTGTATTTGGGTAGTAAGCCATAAAACATAAGCGAGTATCTTCCGTATTGTATAAGTTTTTAGCACCATATTGGTAGTCTAAGGCTTCCAGCAATCCATGATTGGATTTGTTGAATTAAGCTCTCTCTTCGTGAAGCATCACCTTTTGCAACCCTCGGCGATTTGTGATTGACTGAGACATCAGCCATTACCATGATTCCTTAAACTCTGTTTCTGAAATGGGTAAACTCAATGCAATACTTTTCGCTTTGGCGACGGCGGAATAGATAGATTGGACGTATTCTGTATTAACAGAATGGTAAGCATGTCTTTTAGCTTGGTGAAACAACCAACACAGGATTGAAAAGTGTTATCTTTAGCTTCATAGATATCAAGACAGATCGCTTTAGGGTTTGCTCACACATTTCTGATAGCTGCTTCACTAGCATCGGGCCAGAGCCCTTTTACTGGGAGTATCGTGGTAAGTTTTCAAATGATCGATAAGAGCTGGTTGGTGTTTCCAGGTTGTTTACCCTAGTGATAACTATCTGAGATAAATTAAGTATGGAGTTTTCATCATCCTCATCAGATTTTGTTGTTTCGAGCTTTTTCAAGTGCTCTTGTATTAGTCCCGTCACCACTTCAGCTGGCTAGCTTCAAATATTTGCCGAAGCCATACAGTAAGACAGAAAAATATGCAACTCCACTATCTCTTCTAGTTACTTAATTGGGTCAAGTGGCCTCCATTCCTCGGATTTTTAACCGAGAATCATCTCATATGCAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGTATGTTTGGATTATATGCGACCTCATCCATGCTTGTAAGTCCTTATCATTTGGTTGCAAGTTTGGTTATGGTGAAGAGTCCATACTCCTGGTGGTTATGGTGAACAATGGCAGTATAACAGTACAATCATTAATGCTCAAGTTGAATATTGAACTGCATGTAATCTCCTGATAACCTGCTCCTTTGGTTGGTTTTTTTGGGTTCAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGTAAGCTTTCCGTGGGCTTTATCATTCTTCTCGACATTGATCAGTTATATGCTGAAGTTGTTACTTGGTGTTCATGATTTCCAAATTCGAGCAATGTCTTGGATCCGCACGAAGGTGTTCATTTAAACATCACTCGATGTTTCTTTTTTTGTTTATTGTAGGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAGTACGTCAAATGGGCTTCTTATCTACTAGTCTTTGTCTATCAGTGTATCATATTTCTCCGTGTGGAATCTCTGCTACACTTACAACGATAGGACTCCTTGACAACACTACTTCATGCTACTAATGTGTTTGGCTTTATGTTCAGCAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGGTTGGTTTTGTCTTGGAGACTGCCCTAACATTTCGACATGGTTGCATGAAGTATCTGCTTGATTGTTGGGGATCTCTTTCCAAGCCCCTTTACAATTATCAGTAAATTTCTGATGTGGTTGGGAAGAGTAGGTACTAGAGTATAATAAGCTGCCTCTGGTCGTGACTAAAATACAGTTTTGGTCAATACGTGATTCTCTTACAATGTTGCCATCTACTATTCTCTTGAAACCATCCACTCTTTGCAGTGGCTCTCATGGATGCATTATCTTCTGGCCTTCTGTGTACCATCCCCAACTTGAGTCTCCTAGTTTTTTTGTTAGTCTTCAAAATTGCTTGATATTGTTGTGTTCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGTATGTTTTGTCACTTAGTTTCACACTTTACGCGGAGTTCAAGTTTGTGTCGTATACTTGGTGGTTTGCATGTTGTCCATTTATAACTGGAGAGAGGATCTATTCTGGACTTGACCACTCATTTCACTATTTACTATTATTGAAGTGATTGTGGAGGATTATCATGGGGTTGATACTGATCTTTCGTTCACTTGAGTCTTCACTGTCGAAATCATGATTTAGATGTTTTGGTATGATCAAACTGAATGTAGTCAACGCATCTTCGTCTTCTGAGATTAAATTTGCGATGGATGATGCGAGTTACATACATGCAGTATATCCTGAAAAGAACGCTAGAATTGATTGTGTGACTTCCCGTTGTGCAGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTAGAGTTTCATAGAGGTGGTCTTTATTGTGTGCTAAAATCTTATAACGTATAAATATGTGATCAGACCTAGCATGGTTGTTGCTTGATTTAGCTATGTTGTTAAAGAAATCATACACTGTCCAAAAGTTCTAGCGAGAGCATGCATCAAGTACAAAGCATTAGATTCAACCTTTAACCCATTTTATTTTCATTTTCTCGCAAGGCGCAGATAATTGAAAATTTTACCTTTGTATTTTTTCAAAGTAGCAAGAGTTCACAACCTTTAGGCTGAATCCGTTCTTTGAATTGATCGTAAATGATGAAGTGTGAAGTGCATAGGGGTTAGAATTTATTGCCTAATCGAAGACAAGTAATTTCTTTTTTCCTGTTTGTGTTTTTGGGATTACTTACAGTTATTCTCCTTTATATTGCTGAGTTTTAGAATTGTCTGTTCCAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGTTTGTTTTAATGCTCGAATATTCAGGGGAATAACACACTCAGCTGAGATCTTGATAGTTGTCTCAGTTTAGTCGTCCTTTTGTTGCTGTTAACTTGAGCATGTGGTTTGCAAGTTAGAGTGTTCAAAGGAAGGTCGTCGTAGGTTGATCTAGAAATCTGGGAGATGATCGCGAAGACAATGTCTGCAAACTTCATCAGAATCAAGTCAGAAATAGAGGAGCTAATTTTCTCGAGCAATATTTCCATTTTCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGTACGTCGTGCGTAATGAACCATGTTGACCTCCTTGGACGAATGGACGGAATGACCTTGAAGTAGTCAACCAGAACTTATTCAGAAGGCTTTCTCTGTTTTGGTGCTGATCAATTTCTTCGATGTCGACATGTCTTTATGAAATGCAATGGCCATCGTTGATCAACAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGTGAGGTCCTATATGCTTCTCTAAGCATTTGGGTGGTTTCTTGAGCAAAGGACGCAGCTATGTTTTGAGGTCCCTTCTTGTCTTTCTAACCGCCGAGTACAATTGGCTGGTTCCGTGAGCTCAGCACCTCGCTATCTGTTGTATCTTTCTTGTTTCTCCTTCAACGTGAAGATGATGGTTCAGATTTAATCCGGTCATGTTCTTCACAATTCTTATTTCTTGCTGAGTTTGTCTTTACGTCATACAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGGTAAGGAGTTTAGAAGAAACCGTCAGTAGGAAGCTGTCTAGTGATATTGATTCACACCTTGATTATTGTTATATTTACCTGATAAATTCTGTTGTTTCCGCTTTTGAGAATTGTGTTTAAAGTACACAGTCTGAACCTCATTTTCTTTTGCCTTCGATGGACAAACTTATTTCTATGTTTTTGACAGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACGTAAGTAAAAGACAGAACTAGCTAAGACAAAAGTTTCTGCAAGTCTGGGGTTGTTTATTTTATTACAATTACATGATGTGCAAGTTGACTTTTGGAAAAACTTTTCGAGATCAATCGCTCACTCTGTGTCTTAACGTCTGTTGAATATAGTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGTGAGCTTTCCAATTCTGTTATTCTGTTTTTCTTCTCTTGACCAGCTTGCCGCCAAAGCTGCGTGGTGAACTTTCATTTCTTGTAAAGAGACATCGAGAACTGATTCATTTGGACAATATAAAGCAAAAGGCAGTATGAGTAGTGGTCGGAGTCGGTGATGGCAGTCTTTGCCACCTCATATTCTGAGTTTTCACGGGATTACAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGGTAACTATCTAGTCTGAACGCCCTTGAGGATAACCACGAGGACGTATTCGATGCTTAAGTAAATGATAACCTCTTGCATATTTTACTCATTCATGTGGCCGTTATCCCAACCCTGTTGTATTATAGGAGTATCTGAAATTTGATTCTTTCTTTCATGACCTTTACAGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGGTAATTACATGCCAAACGTAGTAAGCTCTAGCTTCACAGCTTGTGTGGTCAAACCGCCTGGATGTTCTCTGTATGTAGGTAGTCCCATTTGTCAAAAACACGCAACAAATCTGCCGAGGAAAGTAGAACAACAATGCAATATTTACGTATTCTTGTTAGAAATTAGACACGTTTTACATTTATATTTTTTCAAGGAAAGTTGATCTCATGATTTCAAGCTTGCTTCGTTGTTTTTAACCCACATTCATCTTGAATTGAATACATTTTCTGGTTTAAGTGCTAAAACTTGGTGGGAAAAATCTAATTTGTTCTTCCTGGGAACAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGGC

mRNA

>Mapoly0075s0051.6
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGGC

CDS

>Mapoly0075s0051.6
ATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGAATTTGCTTCATGTACTCGTCACTTGA

Protein

>Mapoly0075s0051.6
MGAGAGAAAAIENEPSPRRAAIEKAQAELRREVAVREERRRELEFLEKGGELLDFFSAANFALPPSSPTDPLADQLLSSEGEGGHASVALTNGDSVENSVGTSLCVGRSSEGGGDLCPGEDFLSAVIEPLTPWEGKGRASRTGSTSLRSHSDVNLKRESEGSGGGRAAVKGQAYSRRNRPRSNRFGNGHTPTRDVEKAGEVGVLPSIEIKGSPAPPVIFEEVTEENETMVDKKLQVLPAPTLLYNSHASTQLGPVTTKVIEDLEATHLPTGKSFEQNSVKAVHAADDALQTGREFQIHDLAASSCGSLQRSSDLREDVCTGIVVKDELVVVGDLKKVDQTSLSPHVEKNVDSRDGGAVSQPSEQVLGNNQAASDKACGLPSMVEDESAIVMIMDESLGSRTSKNECKDKSTVVSETKGDRVIDRSTIITKHGPDSMLTPTIDDKTSVLREVSCTMQLTPKSLDTSENKSIISRKTTSTASSGAPDLIQNDKARIDDPPSDARVEVKVEEGLSEVGTRLSTVDTQVESGHDVKSICVVSLPQEEIKSESQSTPVSAGSNRAGFRTPNSNTASINKFPGVVLPWEKERDPNVRAEAERHKADLSAKARKAHEDYILEEAEIIKKSKKDTAEWAKRSPHLEPARRKSHWDYLLQEMAWMANDFMQERLWKLASATQFCRWIAEQRGQSSVLQLAGIKQRQERVARVLANAINEFWRSVEYIIHKDKRLTLSSLENQESVVAMKEDSEAVPMDVDIPSIPEGSTQRVEKLPSRSRKPLPVQNYAIRFLKESMGSDVGAQAEAPCTPERISEANSVLDPLWEDQFPEEPLFYLVPDGASRAYRILIETERSSLEIEHEQTLHDHAAAIADAEAVAEAAANADFNVSLSVGEGQPLSVLSSPMKGLRAEEDELGGQFLPNALSSIAKKKRKNILKSNASKGEGISSSGPTHRPPIAPGLDSTAVVQSPLVTGKRSLSVGPGNIVGNVGSIPTKRMRSVSSARQRVMGTASPNSFPSPGGLLQRTIFSSGALNSHQDEVRNLCDDTATRIEADATTVSVKNGLGAGCNNSFVNSKSKKKKKTKHFSGQLSSVNAVKGDGAPSVNTASSTKTPEAEHRSVFDQLKRKGDQVNAASVELDTGGIGSSADTPETPSSQGQQPSKKAKVSKQASDLNPEAAAAAISTAATQSGSLVANTSSTSKLLRQNSNRDRNRKTKSTKVPLTQPAGIGIPWSTIEDQAIFALVHDLGPNWELVSDVLSSSSQLKGIFRKPKQCKERYKSLLDRMSVGEGGDSPEDPSTSQPHPSTLPGIPKGSARVLLQRIQGPMEEDTLKVHLEHIVRVVHKFRALKPPTEEQKLLVQPHASHLNAITQFCANGYPTPSDLCEITAAAPELGGPAYQLPGQHLPGVLAAGSGIRPATNGLPVLPSASNLHMGVPAVAPSTTAASAARDVHRLAAIRPFSPEDAQRVRYHRAMAAARGLSVSGPTVTAGLPMMGLPSPSDCPVPLLGSGNNNIGMMGGISRGMSLSRPGLPGMGSPGVPGIGPPPLGSVLSTGGVGIVSAGPTVGPTVVPQQVNLIRRSREQQLVRPGRSNEDQRRFIEELKHQAAQGNTQAATALSSLGSEVTREMMAVQAQPFQQLQHQNHQQQQQQQQYLAARMAKERQMQQQQKQRLLQQQLQQPQQPSSLQPQLQTQMQQQQMHGMSQQHVLPQQSHLSQQQHLLSSQQHNLQKQQSQQGPQQTGTLSSPSLQPTTIPSMQSNHQQHQTLLQPQQQAPPLGQVQQLPVQSKLQPPKQAQKHPHLQQASQVVQQQPPRGSKGVVRGNMLVQALPGSGQSSMLPGNVSAGSQPQQVAGQQIAHSMQGQRHLMPLAKPLSQTSTQVMTGQSAHMQAQQNQSMAGPVPQGSLGGSQKVVSQQPTQLGTMPSKQLQPSPLPSALPSQQQSPAPPLPTQQQQTSPPAAQQPQIGSSQQLQVQQRRPSQQAQIQSAQRRIQQRQPVASVGAPMIGVLGKNGSSTQQGQVPAQMSSQPGHVTYTQGSSMAVPMSMMSASSGASGLSSSGSPSSSGVHSTPWKPGQVVSPMSSGFYNLSRSGSPGAAQLPSIVSSSGMHLASSNGNSGMSITGSGPPHGVIVGSLSQPLQVGSGGHGLKMGLVTGSNPRGVSTTLQGGTQRSIQHHGNLPASPAIGATQQVRSPVPASSAGMMPVSALGTNTVAGVSSSGSMAYQANSSSLSGHSTAISNSMHMFSVQPRQSHAGSAAATTPAVPMKSPPTSGTSQTSAVSPSSPAPNLLHVLVT

Mapoly0075s0051.7  

Gene structure:

mRNA scaffold_75:641574..665394  ( - strand )
three_prime_UTR scaffold_75:641574..642323  ( - strand )
CDS scaffold_75:642324..642350  ( - strand )
CDS scaffold_75:642627..642743  ( - strand )
CDS scaffold_75:643068..645041  ( - strand )
CDS scaffold_75:645209..645623  ( - strand )
CDS scaffold_75:645847..646056  ( - strand )
CDS scaffold_75:646207..646289  ( - strand )
CDS scaffold_75:646477..646593  ( - strand )
CDS scaffold_75:646841..646981  ( - strand )
CDS scaffold_75:647150..647230  ( - strand )
CDS scaffold_75:647484..647540  ( - strand )
CDS scaffold_75:647979..648205  ( - strand )
CDS scaffold_75:648571..648631  ( - strand )
CDS scaffold_75:648986..649024  ( - strand )
CDS scaffold_75:649169..649927  ( - strand )
CDS scaffold_75:650089..650172  ( - strand )
CDS scaffold_75:650380..650574  ( - strand )
CDS scaffold_75:657671..657955  ( - strand )
CDS scaffold_75:661720..661842  ( - strand )
CDS scaffold_75:662002..663628  ( - strand )
CDS scaffold_75:663929..664020  ( - strand )
CDS scaffold_75:664281..664335  ( - strand )
CDS scaffold_75:664437..664525  ( - strand )
five_prime_UTR scaffold_75:664526..664680  ( - strand )
five_prime_UTR scaffold_75:664916..665394  ( - strand )

Sequences:

Gene

>Mapoly0075s0051.7
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTATGAATTTAGGGTTCGCAGAGAGATAGGAAAAGGCTTTGTTTGCAAAATATGTGAGTGCTATATTTTCGCTTGCGAAGAGTGAGTTTGATCGATCGAAAAGCACTGACCCTTTCTAACGCGATAAATTCGCTAGAAACAATACTGTTTTTTTTGGGGTATTTGTTTTCGTATTATTTTTCCCCGACGTTTTTCTCGCTTGGTTACGACTCTGTGGATTTGTGCAATTTGGCAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGGTTGGGCGTTGTATCACTGTACTATGGAACACTCGGCAATTTCAATTGCTTTACTTGCATTTCACTTAGAAAGTAACCTCTTGGTCTTTGGTTGGTCACAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGTATGTTTACTGTATTGTAGCTTGCTTAGTTTTTTGAACGAAGAAGTTTCAAATGTTTAGATTTTTAAAAAATATAATTAAGTGCATGTATTTAGCTCAACTTGCAAATTACAGAGAGGTAGATCTTGATGGTTTAGTGTCATCACTAGTGTTTTAAGTTGCACAGGCTGTTCAAAAGTGGAATCTGAATACGTTGTTTTCTGTATCCATTTTGTTTGCTTTTCTTTCTGCTTATGTTCTCAATAAGCTTATTCGTGCAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGGTTCTTACATGACTTGGATTGCTTATGAAGATGGAAATTTTTAAGAGCACTAGAAGAGTGTAGAACTTTCACTATTGACTGCCTATGTATTTTCGACGTTGACTGTTGAGGTGTATTTGTGAATTGATCTGTTCAAAAGTGTTCATTCGAGCCCAAGTTACTGTCAAATCAAAGGGCCTCGTTGTACCGTTCAGGTTATGTCTACGTGTAGTTTTTGCAGACGATGGTTGTGAAGAAAACAAGTGTTGCCTATACATTGTGCATAAGACAGAATTGACCTCACATATGTCTTTTTGGCAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGGTACTGTGGATGTGTTCTTCCTCATGAGTTTATACATTGAAGGTCTAACTAGTGTTCATGGTTCAAGCTCGGCGCTTTCTGGTTTCTTCTCAATTGTCAAGTTATGATTTCAGTACAAGTCTCAACTACTAATGAGTTCAGATTTGATATATTTCCCAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGTGCATTTCTTCCTTTGATTGTGTTATAGTAGTCTCTCTCGTTTTGGAACTGGGATGGTTCATGTACGCTTTTGCGTTAAGCATGCGCAAGAACTTTCTCTTATCCCACAAGTTTGATGTTAACTAGTCATTGATACTACATAGTCACATACATTTTCTGACTACCAAGCTATCGATTTACATTTTTCTTCCATTGGCAAGTTAGCGTCGCGTACTCTCAACCTCCATCGAACTCCAGTGTATGAAAGATCTTTTCTTTGGGCTGCATCTAGGTTGCATCCAGTCGTTGTATTCACAACAGAATTTAATGGAGTGGAACATATTTCAACCATAGTCCCGCTAATCGCATTGAGAACTTTACTTGATATTGCTGGGCAAATATTGTATTGTATATCAAAACAATTAGTAAAAGAAAATTAACAGGGGAACTCTAGAGTTCTAAGACAACAGCTCTCCCTATCAAGATCATTTGCGCATGATCATGTACGTCAATACTCCTAGTGTTTTGTTAAAGTGTCCAGAACTGTAAGTCATTAAAGTTTCTCATTCTCATTACCATTGTTTCAGTCCTGTACTAGACACGGACTCTGTCAAAATCGTTGAACGTATTCACTTGAAAATAGTCACTGTATTTAGCTGTTTAACGCCAGCCTTAGCTGGTTTCATCCACCGGATATCGGTGGCCGTATTTTTCTCGCCCGAGCCTATCGACCCCCCGGCTATGTAACAATTGTGGTCATGAATCCAGCGTTGCTAGTGGAGTCCAAGAGTTGTGTTTTACCCTACTCCTGGAACGAGTAGGAGATGAGTAGTAATTGCTTGTGAACCATGCGGTTGATCATGCACGTGATAGCTCCTAGTGTTTTGGTAAAGTTTATGGAACTGTATATCCTAAGCTTATCTTATCATATTTACCATTGTTTCAGTCTCCTGTACTACACGGGATGGTTGAACATCGTTGAACGTATTCGCTTGAAAGTACACACTTCAACAGTTTCACACCAGACAGTTCTGCTTTTATCCATTGTAATATTGATGGCTTTGATTGTCGCGCCCGAGCCATATCAGACACGGTCAGAGCCATGTAGCCAATGTGCTCATGATTTTAGCGTTGCTAGTGGAGTCCAAGCGTTGGAATTTACACAATTCTTGGAAAGAGAAGAAGAAGAGTATTCCTTGCGTGTTAACCTTGCGGTTGATCATGTACATCGTAGCTCCCAGTGTTTTGGTAAAGTTTCTGGTACTGCTAAAAAGTTTCTCATTTTTATTACCATTGTTACAATCCTGCTGTACCAGAGACCGGATGGGGGAAAATCGTTGAACGCACTCGCTTGAAGGTAGGCACGTCAAGTGTTTTATGCCAGACACCGTTGCTTTTATCCATTGGATATCGATGCTCGTAATCCTTGCACCCAAGCCTTATAGACCTGGTCACGACCATGCAGCTGATGTGGTCATGATTCTAGGGTAGCTAGTGGAGTCCAAGAGTTGTGTTTCATGCAACTTTGGGAAGGGAGAAAATTACTTGATGGGACCCCTGCGGAACACAAAAGACTTGCTGATACACAACACGATTCATTTTACCAGATGGGACCACCCTACGGCCATGCAGCATTGGGTGACGTATCGGGTGACGGCAGCCCACCGTCACCCAATACGAGTTCTGGGTTAGGTACAACCAGTGGGTGGATCAATCAGAAACTTTGACTCCAGTCCTTTGAAAGAAACAGCCCCTAACTTAAGTCCCTCAAGTCCTCACGAAGTTAAGCGGTAACGGTACACAACATAAATTTGACAGTAACAGTAACTACATTCCTTCTGATAGACATACGCATGGGGACTTCGATCTCGTTTGCAACGTTATGATACCAACATAACAGCATCATGGTCTTGAGTTTGATGATTGCAACGCAATTTTCTGAAAGAAGCTACATCCAAAGATGTCGAAAGTTTACACTGCAAGTTAGCTTACTTAGTGTATCGGTTGTGAATCCTTTCAAACACAGTTTCTACTTGTATGCAAGCGACGCTCCCATCGCATCCGTCAGAGGCTTCATCAAGAGATCATTCCTTGCACAGACGAGACCCTCAATCTGGAATCTCTGCTTTGCGTGTAAGTTCAGTAAAGTTCCTGGAGCCCCTGGGTCCCAAGCTTTCGTCTGGGGATGCTGGAAGATTCTGCCATGGCTACACAAAGCTTGATTATCGTTCCTACTACTGTCAGGCTCACTGAATTGATCGTGAACAAAGTTCAGTGATGACGCTAAGGAATCACTGAATTGTGACGGGTTTTGCTGCACCTCAAGATAGTTATACGCTCTTTTCATACAGGGATTACAAGCACTGTGCCCTTTTGGCGTGGTTGATTGACCTCTTATAAGTAACCCAAAGTGAATCGATTTCCACGCAATGCAAATTCTTCATTCTGTCATATTGAGCCAGCCTATTCCTAGACTGGTTCTTCGTTCTTATTCGACGTGGTGGAAGGACGTAGGTATTCCATCTGGTAAAATGAATCGTGTTGGGTCCCAGCAAAAGCATTTGCTGGTACCCAACACTCCGGTGGTGCAGGCTTTACTCCGGTGGAAGTAACGGCCGTATACACTTCTCATCCCATGATGCATCTCACGGATAGAAGTGCAGAACTGTATCTACATCGGTCCTCTTCTAATGCAGATTACACTGGAACAGCTACGAGAGACTTTCTCTCCCTCACACACAACTCGACTTCTAACTTTCGTTTTTATTGACCTTTGTTTATGCATATCGTAGAGGTATTACCCTTCAGTTGTAAATATAGAGTTTTCCTTATCAGTTTTGATCAGGTTGTGTCTGCGAGATATCTTCTAATATTTGGTCAATAGCGCACAGAAAAACAAAAAAAAACATGTGAATATTGTTGAGCTTCACTCGTGTGTTTCAAATTAACCTCTGGGTAGCTAAGTTAAGTTTAGTTAGCTCACCGCCTGGAGTGGGGTATTTAACCCCAGATCTTCTCGACTGTAATCACTCTCTTCACATGTTAACTATATGCGCTGTATTGCACGCGCTCACTTTGACTGCACAACTATGTTGTGATTTCACCGTAGATGCTTAGAGTCACTGCGATCAGGTCTTCAAAATCGGACCCGCTCAGATCTTGCTGTACAGATTCACATCAACCGTGTACTGGAGATAGACAAACGATCCAAGGACGCATGGAAGCATATCGCTTTTGAGACAATTAGGTCTGAGGTCAGAAGCCCATATTCTAAGGGGTCAGTCCTACAAGGGCGAGTGGAAGGGGTTGAAAGGTCTGAAAACAGTAAGCACATCTAATTATAAGGCAGATAATGGATGGAGAAGAATTCTTGTGTGATGTGGTTTTAGTTCATTGCCACGCAAAAGGTAAAATCAGCTACATACCCCGTGAGACATCTACCAGCCAATCAAAGACACCACATGTTTGACAGTCTAATATTCGTGGATACATCTTGTTGATGTTTGTAGGTTAATCCTCGTAGTTTCATAGTATATCTTTCTGACTTATGGTGAACTAATAAATACATGTTATGGTGCTTTCCTCTAAATTCGTCTTTTTACTCAACACAGTGCTATCTTGCTCTTATGTATTATTGCTCTACCATGCGTTTCTATGTGGGCAATGCCTGTTTTTTTTACGTGGATGTGTTGGAGAACACATTTTGTAACTCACAAATTAAATTTAAGCTATACCATGTTCGGATTTAAGAATATAATGCATGGTTGTATTGTTCTGATCGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGTATTCTTTCTTGATATACATAGTGATCTATTTTGTTTCAATTTGATTCAGCTCAACATCCCCATCCATAGTAACGGAAATTGATTCCATTTTACATGGTGGACTTAACATATTGACTAGATTGTATTTCCTTCATATTGGGAGTAATTACAATTCGTTCTCACAAGTTTGATTATTTTCGTGTTCAGCATTACATTGATCACTCTTATAGTCAACTTCATGAATCCGTACTAAGAGCAATCAATGCAACTTTCTTCCACCTAAGTACTCGAGTCATCCGGTGATATATTGAATCCTTCTGTTATTGAGTGTGGTTGTTTGTGGTCTGGTTTGGTCAAGTATTGTGAGCTTCTTGTTGCTTCATTTTGATTTTTAATAAAAAAATGTCTTATATTAAACTTCTGATCGATCACTTGTTTGTTTGAATGTAGAATATAGTTTAACTTGACTAAATAAAGATATGGCTGTATATGTTGTAGGAAATTTTGAACACTATATTGGCCTTTCAATCATGTTATGTGAAGGATTGGAATTCATCAAAGTCGCTTATTTTAATTCGCTATAATTCATAGTTTAGGCAAAAACAGTGTTTAGTGTCGGTGGTGGTCATATTGATACTTGTGGAATATTTTAGTATTGTGTGATCGTTATCGTGGTCTGTTTGTTATTCTGAATTTTTGGTTGAACTTGGTCAGATTCGGTTGGATGAATCTTTACAGAAATTGTAGAAAGGTAGTGTAAAAAGGTCGGTTAGATTCATCTAACCTGAAGACATTGGAGGTAAGGTCTGGATATGAGATTAACCTTCCCTTGATGGAATTAATATGAGATGTTGACTGAGGTGTTGTTTTTTTTAGATATTGAGATCTTGGTTCATACCTTTTTCTTGCTAGAATGTCCCGCTCTTCCTTCCTATCTTCTATAGTTGACTAGTTGTTACAATTCTCATATACAACTTTGCTGTAAAGTGCTTGGTAGATCATATCACAATATTGAAACTGATAGAATGGATTGATCAATATGTCTTATGGTGAATGTCATAATATTCGTCATGATCATGACTGGTATGATGATTCAGTAGTAATCAGTAGTAATCGTGCGGAAATTGTCGCGGTAGGATTCGTTTACATTTTCGCGTTTGTAGGTGTATTTCTAGACCCCATGTATCCAACTCGAACCAGAATGTTATGATGGGTATTTGTTTGGTATTTATAATGACTTTATGTGTTGAATTTGGTGGTCCTAGAAAACAAAATTTAATTCAACCTATTTTTGTTCAATGATAATTAACTCCCAATATTATGGTAGGAAAAACTGCGCGTGTAGATATAGGTATTTTATTATTCCTTCTTGGATTTAAGTTAGTTAAATATACCAATTTGACATTTACATTCATGTAATCCTCCCATCAAAAACAGACACAAGATCATGTCGTGTCATCGATGCAGTAATCCATGCAGCCAGATATACGAGATAAACACAAATTGTAGAGTGCTGCAATAATTCATCCTTCGAGCATTCTTTATTCTAGAGAGCTGCAAGAATTCTCTGCTTTTGGGCTGATTATACAATCCTTATATTGAATTATTACTTCTCATTTGGAATACACTGTGTGCACTACATGGAATTCCAGTCGAGTTTTGCGTGAGATAAGCTAATAGCAAACCTGGAGGTTGACTATGTTCTGAGTTTGAAGATCATATATATATATCACTCTCTCTCGACTTTTATATTGCGAGTTGTACAAATTTTGTTTTCAATACGATAAAAAACTGTATTTTCAGATATAACTAGATCCAACTACTAAAACACACAAGTTTACCACCCTTATATCTGCGCATACCAATACTTCCTAGAAGTCCAACTTAGAAGTAAAGAAGATTGTAATTTTTAGAATTCCAACTTATAAATAAAGAAGATTGTAATACCTCTATGTAGACAAAATCATATTTGTGCTCTAGTTATCTTTCAAATTTAACATACTTGATATAAAAAAGGGATGTTAAATTCACCCCGAGTTGTTAAATTCACCCCGTCACTTTTCATGGCAACAAGACATGTCAGAAATTATTGTTTCTTCTCGTCGCGTCGAGGATTGGTTTCGGACTCTCTTTCTCATTTTCTTTTTCTCCACTGTGCACAAGCTGCTTTCTGTGGTGATTCTTGATATGCATATGGAGGAAATAACGGAATCGGCTGCTGCATGGTTTATTGTCCGAAAGTATCGTGCTGGATCTTAGAGCTGAATCTGCCCTTGGATGTGACCCTGATCAAATTTAAAAGAGATACTGACTAAATTCAGAAGAGAGATGCAACGTGTGAGAACTTGGGTGATGAATTTAACAATCACCAATATAAATATATCAATATATAAATTTCATCAAGTCCAACGATGTACCGAGAGTGTAAACCTCTCTCTTCTCTCTTCGTTTCTCTTGTGTACATATGACAATAAGCACTTGGTTTAGTAGGTATGGAGAAACACTCTCTTGTACTGCATTTTTCATTTTGATTCACGCGCATAATTATATTTTTATTAACTAGATAAGATCTAATTTTTTACATAAATGAAATCTATCCTCCCATAATGATGATGTGGTTTTCTTCTCCACCTTAACTTTCCAACTTTCTCAAAGCTACTTTGAAGACTTAAGTTTATATTAGTGAATGGAATAGTAAGCTTTCAGTTACAATTTCATTGATGCCGGTCACTCTTGTAAGAGACCTATCATGTCGACAATTAAATAGTTCCTACTATTTATCTCATTTTCATCTCCTTGTTTTTATGTGTATGCAATAAAATGTAGTCATGGTTTGTTTACCCTAGCTGGCATTTGTGATCATTGATTCTCTTGCATGTTACATCTCAACGATCTAAACCTTTAAAGTAACGTAGTTAGACTAGAACACAGTATCCTACTCAGATTTGGAAAAGACTGGCTGAAAGATAGAATTGTAATGGTTGCAAATGGGAATGGTATGTAGTAAATTCAGTAGATATTAGTCATCGAGATTGAGTGCAAAGCATTATATCCTTTGGGTATCTTGAAATAAGTGATGTTCTTGGGGAGTTCAACTCCTTCTTCGAGTCCGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGAAGCACATGAACATCAGAGTGATCCCGTGGCATACTGTCGATAGATTCATCTATACATTTTTCACATAAAAATCTGGATGATAAGCATTATATCCTGCTCTAGCTGGTGCAACACATCAACAACAGAGTGATCCCGTGGCATACTGTCGATAGATTCATGTATACATTTTTCACATAAAAATCTAGATGCAAAGCATTATATACTTTGGGGATCTTGAAATAAGTGATGTTACTGGGGAGTTCAACAGCTTCTTCGAGTCGGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGCAGCACATCAACAACATATAGATTTTTCACATAAAAATCTGGATGCATGGGAATAGAATGATGACTTTATAATAATCTTTTCCATTAGATTCTTGATTTGAAAAAATGATTCATAGGGAATGGTTCTTGGAAATCTGACTATAATATTTTTTTTGGAAATCTGACTAATATTTCAGAAAACTCTACCGTCACTAGGAGTGACACGGTAGAGTTTTCTGAAGAACTGTTTGTTCACTTGCTGAACAAACAGTTAGCACTAAACAACATCAGTGAGCACTAAACAACAGGCTTTTTCTTGCATGATACTAGATATTGCATACTATTGACTGCGGTTGAAACTAATCCCAACAATTTTTTTTGGTTTGAAATTCAACCATACTTTAAATATTCGCTAATTTACTGTTCGGTCCCTCTCGCTCCTCTCGCTCCCCTTCCCTTCGATTCCTGTCCGTAGCACCCCTCGCCTCTTTCCTCTTGTGGGTGGAGTGAGTGGGGGCGCCAGGCGAGCACGAGACAGGATCAGACCAGAGTGGGTGCGGTGTTCCTGTCAGAAGGTTTCTTCCTTTCCACTGCTCTGTTCTTCTCTGCTCCTCCCTCTGCTCCGTTCCGTCATCCTCTTCATCTTCTTCCTCTTCCTCTCCTTCTCCTGCCGCTGCTGCATCTTGAAAATCCGTCCGGAGTAAGGTCGCGAGTTAGGCTGCGCGTAGTTTTATATGTGGACGGTGGGGGAAGTTTTTCCAGCTCGAACGGAGATCCTCGCGGGGCTTCTTGAGCTTCATTTCGATCACTGGTGAGCGTCTAGCTCTGTACTGACCACTTTCCTGTGATGTTGATGATAATGATGATTATCACTCAAGTCTGTGTCTGTCGCTGGGTCGTTTGTCTGAGTTCCCTGCGGTCACTCTTGACTCCATAAGGTGCCAGTGCGGGGGTGTGCACTCAGTATAGTATAGGATGCTGCGATGATTGGGAAAAGAAACGAAGAGTGGAAATGGAAAAGCTTGGCTCGAAATCTCCCTGGCGCCGTTGCCTCTGCTCTGATTTCTTTCTCGAATCAACTGTGTGTATTCTTGATATGTTCGTCTCTTAGAACATCTTTTCTGAGAGCATCCCGTCTGTTTGCTGAGTTTCTTCCTATGTTGGCATCATGGCTTAGGATTCTGTGATTTCTCTTCCTCCGATCCTATTCTTGTATTATAGCTTTTAATCTTCCCTGGCTCGCTCGCTCTCTCCCTCCTTGTTTTGTGATGCTAGTTTTGCTAGGGGTGTGTAGATTAATGATGTTGTTAAGTTCTTAGTTTGCACAATATTGCAGTATTTTCATCCTTGGTTTTGGAGTAGTACATTTACATTCTTCATTACAATTGTGCTTAAATTACCATTAACAACTAGACTGAGTATCCAATTCTTCTGTTTTGTGTTTGGGATTGAAGTAATTGTTAATTTTCTTGACAATTGATAGGGATTGTAATATTGAGTCCCATAGTGAATTGCATAAGATCCATAGTGAATTATAAATGAATATATATACTGTTCAAGATACAGTCAATATACGTATTTGTAAATCACCATGGGTCGATTGAGATGCAATGCTTTTAATGCATTTACAAAATTAAATATTTCTCAAATTTCACCTCAATTTTCTATCAAGTTTTTATTTGCTGATGGTATCAATTGATTATGTCATTTCTTACCATAGACAGTATCAAAGTAATGGGTTATATCTTATGGTTTTCTTATCTTTAGCGATCAAATTTTTTTTTAAACTTCTCAATACTTATAGATGCTTTGTTGAACATATTTAATCGTGGTGAATGAATATGTACGCTTCAAAATGTAGGCTTCGCAACTAACGGATAATATTTTGTTTCAGACCAATCTTTGAAATCTCTGCTTTGTATATGAAATCTGCTTATATTTTATATAGGGGAATGTTAAAACAACCACATAAATTGTTCACATGATTTGTCAAAAACAATTTTTTTCGCATAAAAGCTCAAATATCAGCTGCGAGTGTGTTTTTGACTTCCCCCTCCTTCCTGTGCAAAAAACACCTTCAGAGTTGTTATCTCACAGGGATCATTGCAATAGTTTCAGTCAGTAGTCAATAGTCATTGTTCTTGAAGTGTGTACGTAGAAGTTTGATTGTGTCTTCTGCATATATGCAGCAATATGTAACAAAAATATGCTTGGAGATGATACTTGGGCTTGTGTGCGAAATATCAATTTTTGACAGGAGACTCGTCCGTGGTAGTTTTAACATTGGATGTGATCGTTTAACATTCCCCTTTGTATATTGCTTAACCCATTATGTTGGAACTTTTTCCAACATAATTGTTTGATAGTTTGAACAGATAGGCGAAATTGAAATCCTTTTTTCCCTTGGTTGAAGATTTTATTTTTACTCTCTCTGATCTCTATGCTTCTCATTCAAAGGTCTGGGTATATGAAAGGTAATCCGTTTAGGATTTATATGGATATATCTGAATGAATGCCTCCACGGGGTAGTATTTAGATAACAATCTTGTAATTTACATAATAACATTGTAATCATCATGTTTTCATTGGTTTGGTAATATCAATAATATAGCTAATAATAGTTTGATAGCAAGAACATGAAGTAATGCGACATCAGATGCTACTGGTATTTGTATATCGGTGCGGAAATTGTATGTGATGTATGACGTATCTCATATTACAGTAGCCTCCCGTTTGAACGGGAGGCTACTGTAATATGCATCAATAGTACGCATCATTTTCCCCAAAAAATAGTTCCAAAAAATAGGGTTCAGATTTATTTAGTTCAACGTGTCATATATTTTCATTTGGCGCAAGTTTTGAAGATTCTTGCGTTTGAAACCTGATTTTTGGTATATATTTTCGGCATTAGAAGGCTGTATTTGGGTAGTAAGCCATAAAACATAAGCGAGTATCTTCCGTATTGTATAAGTTTTTAGCACCATATTGGTAGTCTAAGGCTTCCAGCAATCCATGATTGGATTTGTTGAATTAAGCTCTCTCTTCGTGAAGCATCACCTTTTGCAACCCTCGGCGATTTGTGATTGACTGAGACATCAGCCATTACCATGATTCCTTAAACTCTGTTTCTGAAATGGGTAAACTCAATGCAATACTTTTCGCTTTGGCGACGGCGGAATAGATAGATTGGACGTATTCTGTATTAACAGAATGGTAAGCATGTCTTTTAGCTTGGTGAAACAACCAACACAGGATTGAAAAGTGTTATCTTTAGCTTCATAGATATCAAGACAGATCGCTTTAGGGTTTGCTCACACATTTCTGATAGCTGCTTCACTAGCATCGGGCCAGAGCCCTTTTACTGGGAGTATCGTGGTAAGTTTTCAAATGATCGATAAGAGCTGGTTGGTGTTTCCAGGTTGTTTACCCTAGTGATAACTATCTGAGATAAATTAAGTATGGAGTTTTCATCATCCTCATCAGATTTTGTTGTTTCGAGCTTTTTCAAGTGCTCTTGTATTAGTCCCGTCACCACTTCAGCTGGCTAGCTTCAAATATTTGCCGAAGCCATACAGTAAGACAGAAAAATATGCAACTCCACTATCTCTTCTAGTTACTTAATTGGGTCAAGTGGCCTCCATTCCTCGGATTTTTAACCGAGAATCATCTCATATGCAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGTATGTTTGGATTATATGCGACCTCATCCATGCTTGTAAGTCCTTATCATTTGGTTGCAAGTTTGGTTATGGTGAAGAGTCCATACTCCTGGTGGTTATGGTGAACAATGGCAGTATAACAGTACAATCATTAATGCTCAAGTTGAATATTGAACTGCATGTAATCTCCTGATAACCTGCTCCTTTGGTTGGTTTTTTTGGGTTCAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGTAAGCTTTCCGTGGGCTTTATCATTCTTCTCGACATTGATCAGTTATATGCTGAAGTTGTTACTTGGTGTTCATGATTTCCAAATTCGAGCAATGTCTTGGATCCGCACGAAGGTGTTCATTTAAACATCACTCGATGTTTCTTTTTTTGTTTATTGTAGGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAGTACGTCAAATGGGCTTCTTATCTACTAGTCTTTGTCTATCAGTGTATCATATTTCTCCGTGTGGAATCTCTGCTACACTTACAACGATAGGACTCCTTGACAACACTACTTCATGCTACTAATGTGTTTGGCTTTATGTTCAGCAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGGTTGGTTTTGTCTTGGAGACTGCCCTAACATTTCGACATGGTTGCATGAAGTATCTGCTTGATTGTTGGGGATCTCTTTCCAAGCCCCTTTACAATTATCAGTAAATTTCTGATGTGGTTGGGAAGAGTAGGTACTAGAGTATAATAAGCTGCCTCTGGTCGTGACTAAAATACAGTTTTGGTCAATACGTGATTCTCTTACAATGTTGCCATCTACTATTCTCTTGAAACCATCCACTCTTTGCAGTGGCTCTCATGGATGCATTATCTTCTGGCCTTCTGTGTACCATCCCCAACTTGAGTCTCCTAGTTTTTTTGTTAGTCTTCAAAATTGCTTGATATTGTTGTGTTCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGTATGTTTTGTCACTTAGTTTCACACTTTACGCGGAGTTCAAGTTTGTGTCGTATACTTGGTGGTTTGCATGTTGTCCATTTATAACTGGAGAGAGGATCTATTCTGGACTTGACCACTCATTTCACTATTTACTATTATTGAAGTGATTGTGGAGGATTATCATGGGGTTGATACTGATCTTTCGTTCACTTGAGTCTTCACTGTCGAAATCATGATTTAGATGTTTTGGTATGATCAAACTGAATGTAGTCAACGCATCTTCGTCTTCTGAGATTAAATTTGCGATGGATGATGCGAGTTACATACATGCAGTATATCCTGAAAAGAACGCTAGAATTGATTGTGTGACTTCCCGTTGTGCAGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTAGAGTTTCATAGAGGTGGTCTTTATTGTGTGCTAAAATCTTATAACGTATAAATATGTGATCAGACCTAGCATGGTTGTTGCTTGATTTAGCTATGTTGTTAAAGAAATCATACACTGTCCAAAAGTTCTAGCGAGAGCATGCATCAAGTACAAAGCATTAGATTCAACCTTTAACCCATTTTATTTTCATTTTCTCGCAAGGCGCAGATAATTGAAAATTTTACCTTTGTATTTTTTCAAAGTAGCAAGAGTTCACAACCTTTAGGCTGAATCCGTTCTTTGAATTGATCGTAAATGATGAAGTGTGAAGTGCATAGGGGTTAGAATTTATTGCCTAATCGAAGACAAGTAATTTCTTTTTTCCTGTTTGTGTTTTTGGGATTACTTACAGTTATTCTCCTTTATATTGCTGAGTTTTAGAATTGTCTGTTCCAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGTTTGTTTTAATGCTCGAATATTCAGGGGAATAACACACTCAGCTGAGATCTTGATAGTTGTCTCAGTTTAGTCGTCCTTTTGTTGCTGTTAACTTGAGCATGTGGTTTGCAAGTTAGAGTGTTCAAAGGAAGGTCGTCGTAGGTTGATCTAGAAATCTGGGAGATGATCGCGAAGACAATGTCTGCAAACTTCATCAGAATCAAGTCAGAAATAGAGGAGCTAATTTTCTCGAGCAATATTTCCATTTTCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGTACGTCGTGCGTAATGAACCATGTTGACCTCCTTGGACGAATGGACGGAATGACCTTGAAGTAGTCAACCAGAACTTATTCAGAAGGCTTTCTCTGTTTTGGTGCTGATCAATTTCTTCGATGTCGACATGTCTTTATGAAATGCAATGGCCATCGTTGATCAACAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGTGAGGTCCTATATGCTTCTCTAAGCATTTGGGTGGTTTCTTGAGCAAAGGACGCAGCTATGTTTTGAGGTCCCTTCTTGTCTTTCTAACCGCCGAGTACAATTGGCTGGTTCCGTGAGCTCAGCACCTCGCTATCTGTTGTATCTTTCTTGTTTCTCCTTCAACGTGAAGATGATGGTTCAGATTTAATCCGGTCATGTTCTTCACAATTCTTATTTCTTGCTGAGTTTGTCTTTACGTCATACAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGGTAAGGAGTTTAGAAGAAACCGTCAGTAGGAAGCTGTCTAGTGATATTGATTCACACCTTGATTATTGTTATATTTACCTGATAAATTCTGTTGTTTCCGCTTTTGAGAATTGTGTTTAAAGTACACAGTCTGAACCTCATTTTCTTTTGCCTTCGATGGACAAACTTATTTCTATGTTTTTGACAGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACGTAAGTAAAAGACAGAACTAGCTAAGACAAAAGTTTCTGCAAGTCTGGGGTTGTTTATTTTATTACAATTACATGATGTGCAAGTTGACTTTTGGAAAAACTTTTCGAGATCAATCGCTCACTCTGTGTCTTAACGTCTGTTGAATATAGTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGTGAGCTTTCCAATTCTGTTATTCTGTTTTTCTTCTCTTGACCAGCTTGCCGCCAAAGCTGCGTGGTGAACTTTCATTTCTTGTAAAGAGACATCGAGAACTGATTCATTTGGACAATATAAAGCAAAAGGCAGTATGAGTAGTGGTCGGAGTCGGTGATGGCAGTCTTTGCCACCTCATATTCTGAGTTTTCACGGGATTACAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGGTAACTATCTAGTCTGAACGCCCTTGAGGATAACCACGAGGACGTATTCGATGCTTAAGTAAATGATAACCTCTTGCATATTTTACTCATTCATGTGGCCGTTATCCCAACCCTGTTGTATTATAGGAGTATCTGAAATTTGATTCTTTCTTTCATGACCTTTACAGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGGTAATTACATGCCAAACGTAGTAAGCTCTAGCTTCACAGCTTGTGTGGTCAAACCGCCTGGATGTTCTCTGTATGTAGGTAGTCCCATTTGTCAAAAACACGCAACAAATCTGCCGAGGAAAGTAGAACAACAATGCAATATTTACGTATTCTTGTTAGAAATTAGACACGTTTTACATTTATATTTTTTCAAGGAAAGTTGATCTCATGATTTCAAGCTTGCTTCGTTGTTTTTAACCCACATTCATCTTGAATTGAATACATTTTCTGGTTTAAGTGCTAAAACTTGGTGGGAAAAATCTAATTTGTTCTTCCTGGGAACAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGGC

mRNA

>Mapoly0075s0051.7
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAACAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGGC

CDS

>Mapoly0075s0051.7
ATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAACAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGAATTTGCTTCATGTACTCGTCACTTGA

Protein

>Mapoly0075s0051.7
MGAGAGAAAAIENEPSPRRAAIEKAQAELRREVAVREERRRELEFLEKGGELLDFFSAANFALPPSSPTDPLADQLLSSEGEGGHASVALTNGDSVENSVGTSLCVGRSSEGGGDLCPGEDFLSAVIEPLTPWEGKGRASRTGSTSLRSHSDVNLKRESEGSGGGRAAVKGQAYSRRNRPRSNRFGNGHTPTRDVEKAGEVGVLPSIEIKGSPAPPVIFEEVTEENETMVDKKLQVLPAPTLLYNSHASTQLGPVTTKVIEDLEATHLPTGKSFEQNSVKAVHAADDALQTGREFQIHDLAASSCGSLQRSSDLREDVCTGIVVKDELVVVGDLKKVDQTSLSPHVEKNVDSRDGGAVSQPSEQVLGNNQAASDKACGLPSMVEDESAIVMIMDESLGSRTSKNECKDKSTVVSETKGDRVIDRSTIITKHGPDSMLTPTIDDKTSVLREVSCTMQLTPKSLDTSENKSIISRKTTSTASSGAPDLIQNDKARIDDPPSDARVEVKVEEGLSEVGTRLSTVDTQVESGHDVKSICVVSLPQEEIKSESQSTPVSAGSNRAGFRTPNSNTASINKFPGVVLPWEKERDPNVRAEAERHKADLSAKARKAHEDYILEEAEIIKKSKKDTAEWAKRSPHLEPARRKSHWDYLLQEMAWMANDFMQERLWKLASATQFCRWIAEQRGQSSVLQLAGIKQRQERVARVLANAINEFWRSVEYIIHKDKRLTLSSLENQESVVAMKEDSEAVPMDVDIPSIPEGSTQRVEKLPSRSRKPLPVQNYAIRFLKESMGSDVGAQAEAPCTPERISEANSVLDPLWEDQFPEEPLFYLVPDGASRAYRILIETERSSLEIEHEQTLHDHAAAIADAEAVAEAAANADFNVSLSVGEGQPLSVLSSPMKGLRAEEDELGGQFLPNALSSIAKKKRKNILKSNASKGEGISSSGPTHRPPIAPGLDSTAVVQSPLVTGKRSLSVGPGNIVGNVGSIPTKRMRSVSSARQRVMGTASPNSFPSPGGLLQRTIFSSGALNSHQDEVRNLCDDTATRIEADATTVSVKNGLGAGCNNSFVNSKSKKKKKTKHFSGQLSSVNAVKGDGAPSVNTASSTKQTPEAEHRSVFDQLKRKGDQVNAASVELDTGGIGSSADTPETPSSQGQQPSKKAKVSKQASDLNPEAAAAAISTAATQSGSLVANTSSTSKLLRQNSNRDRNRKTKSTKVPLTQPAGIGIPWSTIEDQAIFALVHDLGPNWELVSDVLSSSSQLKGIFRKPKQCKERYKSLLDRMSVGEGGDSPEDPSTSQPHPSTLPGIPKGSARVLLQRIQGPMEEDTLKVHLEHIVRVVHKFRALKPPTEEQKLLVQPHASHLNAITQFCANGYPTPSDLCEITAAAPELGGPAYQLPGQHLPGVLAAGSGIRPATNGLPVLPSASNLHMGVPAVAPSTTAASAARDVHRLAAIRPFSPEDAQRVRYHRAMAAARGLSVSGPTVTAGLPMMGLPSPSDCPVPLLGSGNNNIGMMGGISRGMSLSRPGLPGMGSPGVPGIGPPPLGSVLSTGGVGIVSAGPTVGPTVVPQQVNLIRRSREQQLVRPGRSNEDQRRFIEELKHQAAQGNTQAATALSSLGSEVTREMMAVQAQPFQQLQHQNHQQQQQQQQYLAARMAKERQMQQQQKQRLLQQQLQQPQQPSSLQPQLQTQMQQQQMHGMSQQHVLPQQSHLSQQQHLLSSQQHNLQKQQSQQGPQQTGTLSSPSLQPTTIPSMQSNHQQHQTLLQPQQQAPPLGQVQQLPVQSKLQPPKQAQKHPHLQQASQVVQQQPPRGSKGVVRGNMLVQALPGSGQSSMLPGNVSAGSQPQQVAGQQIAHSMQGQRHLMPLAKPLSQTSTQVMTGQSAHMQAQQNQSMAGPVPQGSLGGSQKVVSQQPTQLGTMPSKQLQPSPLPSALPSQQQSPAPPLPTQQQQTSPPAAQQPQIGSSQQLQVQQRRPSQQAQIQSAQRRIQQRQPVASVGAPMIGVLGKNGSSTQQGQVPAQMSSQPGHVTYTQGSSMAVPMSMMSASSGASGLSSSGSPSSSGVHSTPWKPGQVVSPMSSGFYNLSRSGSPGAAQLPSIVSSSGMHLASSNGNSGMSITGSGPPHGVIVGSLSQPLQVGSGGHGLKMGLVTGSNPRGVSTTLQGGTQRSIQHHGNLPASPAIGATQQVRSPVPASSAGMMPVSALGTNTVAGVSSSGSMAYQANSSSLSGHSTAISNSMHMFSVQPRQSHAGSAAATTPAVPMKSPPTSGTSQTSAVSPSSPAPNLLHVLVT

Mapoly0075s0051.8  

Gene structure:

mRNA scaffold_75:641574..665394  ( - strand )
three_prime_UTR scaffold_75:641574..642323  ( - strand )
CDS scaffold_75:642324..642350  ( - strand )
CDS scaffold_75:642627..642743  ( - strand )
CDS scaffold_75:643068..645041  ( - strand )
CDS scaffold_75:645209..645641  ( - strand )
CDS scaffold_75:645847..646056  ( - strand )
CDS scaffold_75:646207..646289  ( - strand )
CDS scaffold_75:646477..646593  ( - strand )
CDS scaffold_75:646841..646981  ( - strand )
CDS scaffold_75:647150..647230  ( - strand )
CDS scaffold_75:647484..647540  ( - strand )
CDS scaffold_75:647979..648205  ( - strand )
CDS scaffold_75:648571..648631  ( - strand )
CDS scaffold_75:648986..649021  ( - strand )
CDS scaffold_75:649169..649927  ( - strand )
CDS scaffold_75:650089..650172  ( - strand )
CDS scaffold_75:650380..650574  ( - strand )
CDS scaffold_75:657671..657955  ( - strand )
CDS scaffold_75:661720..661842  ( - strand )
CDS scaffold_75:662002..663628  ( - strand )
CDS scaffold_75:663929..664020  ( - strand )
CDS scaffold_75:664281..664335  ( - strand )
CDS scaffold_75:664437..664525  ( - strand )
five_prime_UTR scaffold_75:664526..664680  ( - strand )
five_prime_UTR scaffold_75:664916..665394  ( - strand )

Sequences:

Gene

>Mapoly0075s0051.8
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTATGAATTTAGGGTTCGCAGAGAGATAGGAAAAGGCTTTGTTTGCAAAATATGTGAGTGCTATATTTTCGCTTGCGAAGAGTGAGTTTGATCGATCGAAAAGCACTGACCCTTTCTAACGCGATAAATTCGCTAGAAACAATACTGTTTTTTTTGGGGTATTTGTTTTCGTATTATTTTTCCCCGACGTTTTTCTCGCTTGGTTACGACTCTGTGGATTTGTGCAATTTGGCAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGGTTGGGCGTTGTATCACTGTACTATGGAACACTCGGCAATTTCAATTGCTTTACTTGCATTTCACTTAGAAAGTAACCTCTTGGTCTTTGGTTGGTCACAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGTATGTTTACTGTATTGTAGCTTGCTTAGTTTTTTGAACGAAGAAGTTTCAAATGTTTAGATTTTTAAAAAATATAATTAAGTGCATGTATTTAGCTCAACTTGCAAATTACAGAGAGGTAGATCTTGATGGTTTAGTGTCATCACTAGTGTTTTAAGTTGCACAGGCTGTTCAAAAGTGGAATCTGAATACGTTGTTTTCTGTATCCATTTTGTTTGCTTTTCTTTCTGCTTATGTTCTCAATAAGCTTATTCGTGCAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGGTTCTTACATGACTTGGATTGCTTATGAAGATGGAAATTTTTAAGAGCACTAGAAGAGTGTAGAACTTTCACTATTGACTGCCTATGTATTTTCGACGTTGACTGTTGAGGTGTATTTGTGAATTGATCTGTTCAAAAGTGTTCATTCGAGCCCAAGTTACTGTCAAATCAAAGGGCCTCGTTGTACCGTTCAGGTTATGTCTACGTGTAGTTTTTGCAGACGATGGTTGTGAAGAAAACAAGTGTTGCCTATACATTGTGCATAAGACAGAATTGACCTCACATATGTCTTTTTGGCAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGGTACTGTGGATGTGTTCTTCCTCATGAGTTTATACATTGAAGGTCTAACTAGTGTTCATGGTTCAAGCTCGGCGCTTTCTGGTTTCTTCTCAATTGTCAAGTTATGATTTCAGTACAAGTCTCAACTACTAATGAGTTCAGATTTGATATATTTCCCAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGTGCATTTCTTCCTTTGATTGTGTTATAGTAGTCTCTCTCGTTTTGGAACTGGGATGGTTCATGTACGCTTTTGCGTTAAGCATGCGCAAGAACTTTCTCTTATCCCACAAGTTTGATGTTAACTAGTCATTGATACTACATAGTCACATACATTTTCTGACTACCAAGCTATCGATTTACATTTTTCTTCCATTGGCAAGTTAGCGTCGCGTACTCTCAACCTCCATCGAACTCCAGTGTATGAAAGATCTTTTCTTTGGGCTGCATCTAGGTTGCATCCAGTCGTTGTATTCACAACAGAATTTAATGGAGTGGAACATATTTCAACCATAGTCCCGCTAATCGCATTGAGAACTTTACTTGATATTGCTGGGCAAATATTGTATTGTATATCAAAACAATTAGTAAAAGAAAATTAACAGGGGAACTCTAGAGTTCTAAGACAACAGCTCTCCCTATCAAGATCATTTGCGCATGATCATGTACGTCAATACTCCTAGTGTTTTGTTAAAGTGTCCAGAACTGTAAGTCATTAAAGTTTCTCATTCTCATTACCATTGTTTCAGTCCTGTACTAGACACGGACTCTGTCAAAATCGTTGAACGTATTCACTTGAAAATAGTCACTGTATTTAGCTGTTTAACGCCAGCCTTAGCTGGTTTCATCCACCGGATATCGGTGGCCGTATTTTTCTCGCCCGAGCCTATCGACCCCCCGGCTATGTAACAATTGTGGTCATGAATCCAGCGTTGCTAGTGGAGTCCAAGAGTTGTGTTTTACCCTACTCCTGGAACGAGTAGGAGATGAGTAGTAATTGCTTGTGAACCATGCGGTTGATCATGCACGTGATAGCTCCTAGTGTTTTGGTAAAGTTTATGGAACTGTATATCCTAAGCTTATCTTATCATATTTACCATTGTTTCAGTCTCCTGTACTACACGGGATGGTTGAACATCGTTGAACGTATTCGCTTGAAAGTACACACTTCAACAGTTTCACACCAGACAGTTCTGCTTTTATCCATTGTAATATTGATGGCTTTGATTGTCGCGCCCGAGCCATATCAGACACGGTCAGAGCCATGTAGCCAATGTGCTCATGATTTTAGCGTTGCTAGTGGAGTCCAAGCGTTGGAATTTACACAATTCTTGGAAAGAGAAGAAGAAGAGTATTCCTTGCGTGTTAACCTTGCGGTTGATCATGTACATCGTAGCTCCCAGTGTTTTGGTAAAGTTTCTGGTACTGCTAAAAAGTTTCTCATTTTTATTACCATTGTTACAATCCTGCTGTACCAGAGACCGGATGGGGGAAAATCGTTGAACGCACTCGCTTGAAGGTAGGCACGTCAAGTGTTTTATGCCAGACACCGTTGCTTTTATCCATTGGATATCGATGCTCGTAATCCTTGCACCCAAGCCTTATAGACCTGGTCACGACCATGCAGCTGATGTGGTCATGATTCTAGGGTAGCTAGTGGAGTCCAAGAGTTGTGTTTCATGCAACTTTGGGAAGGGAGAAAATTACTTGATGGGACCCCTGCGGAACACAAAAGACTTGCTGATACACAACACGATTCATTTTACCAGATGGGACCACCCTACGGCCATGCAGCATTGGGTGACGTATCGGGTGACGGCAGCCCACCGTCACCCAATACGAGTTCTGGGTTAGGTACAACCAGTGGGTGGATCAATCAGAAACTTTGACTCCAGTCCTTTGAAAGAAACAGCCCCTAACTTAAGTCCCTCAAGTCCTCACGAAGTTAAGCGGTAACGGTACACAACATAAATTTGACAGTAACAGTAACTACATTCCTTCTGATAGACATACGCATGGGGACTTCGATCTCGTTTGCAACGTTATGATACCAACATAACAGCATCATGGTCTTGAGTTTGATGATTGCAACGCAATTTTCTGAAAGAAGCTACATCCAAAGATGTCGAAAGTTTACACTGCAAGTTAGCTTACTTAGTGTATCGGTTGTGAATCCTTTCAAACACAGTTTCTACTTGTATGCAAGCGACGCTCCCATCGCATCCGTCAGAGGCTTCATCAAGAGATCATTCCTTGCACAGACGAGACCCTCAATCTGGAATCTCTGCTTTGCGTGTAAGTTCAGTAAAGTTCCTGGAGCCCCTGGGTCCCAAGCTTTCGTCTGGGGATGCTGGAAGATTCTGCCATGGCTACACAAAGCTTGATTATCGTTCCTACTACTGTCAGGCTCACTGAATTGATCGTGAACAAAGTTCAGTGATGACGCTAAGGAATCACTGAATTGTGACGGGTTTTGCTGCACCTCAAGATAGTTATACGCTCTTTTCATACAGGGATTACAAGCACTGTGCCCTTTTGGCGTGGTTGATTGACCTCTTATAAGTAACCCAAAGTGAATCGATTTCCACGCAATGCAAATTCTTCATTCTGTCATATTGAGCCAGCCTATTCCTAGACTGGTTCTTCGTTCTTATTCGACGTGGTGGAAGGACGTAGGTATTCCATCTGGTAAAATGAATCGTGTTGGGTCCCAGCAAAAGCATTTGCTGGTACCCAACACTCCGGTGGTGCAGGCTTTACTCCGGTGGAAGTAACGGCCGTATACACTTCTCATCCCATGATGCATCTCACGGATAGAAGTGCAGAACTGTATCTACATCGGTCCTCTTCTAATGCAGATTACACTGGAACAGCTACGAGAGACTTTCTCTCCCTCACACACAACTCGACTTCTAACTTTCGTTTTTATTGACCTTTGTTTATGCATATCGTAGAGGTATTACCCTTCAGTTGTAAATATAGAGTTTTCCTTATCAGTTTTGATCAGGTTGTGTCTGCGAGATATCTTCTAATATTTGGTCAATAGCGCACAGAAAAACAAAAAAAAACATGTGAATATTGTTGAGCTTCACTCGTGTGTTTCAAATTAACCTCTGGGTAGCTAAGTTAAGTTTAGTTAGCTCACCGCCTGGAGTGGGGTATTTAACCCCAGATCTTCTCGACTGTAATCACTCTCTTCACATGTTAACTATATGCGCTGTATTGCACGCGCTCACTTTGACTGCACAACTATGTTGTGATTTCACCGTAGATGCTTAGAGTCACTGCGATCAGGTCTTCAAAATCGGACCCGCTCAGATCTTGCTGTACAGATTCACATCAACCGTGTACTGGAGATAGACAAACGATCCAAGGACGCATGGAAGCATATCGCTTTTGAGACAATTAGGTCTGAGGTCAGAAGCCCATATTCTAAGGGGTCAGTCCTACAAGGGCGAGTGGAAGGGGTTGAAAGGTCTGAAAACAGTAAGCACATCTAATTATAAGGCAGATAATGGATGGAGAAGAATTCTTGTGTGATGTGGTTTTAGTTCATTGCCACGCAAAAGGTAAAATCAGCTACATACCCCGTGAGACATCTACCAGCCAATCAAAGACACCACATGTTTGACAGTCTAATATTCGTGGATACATCTTGTTGATGTTTGTAGGTTAATCCTCGTAGTTTCATAGTATATCTTTCTGACTTATGGTGAACTAATAAATACATGTTATGGTGCTTTCCTCTAAATTCGTCTTTTTACTCAACACAGTGCTATCTTGCTCTTATGTATTATTGCTCTACCATGCGTTTCTATGTGGGCAATGCCTGTTTTTTTTACGTGGATGTGTTGGAGAACACATTTTGTAACTCACAAATTAAATTTAAGCTATACCATGTTCGGATTTAAGAATATAATGCATGGTTGTATTGTTCTGATCGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGTATTCTTTCTTGATATACATAGTGATCTATTTTGTTTCAATTTGATTCAGCTCAACATCCCCATCCATAGTAACGGAAATTGATTCCATTTTACATGGTGGACTTAACATATTGACTAGATTGTATTTCCTTCATATTGGGAGTAATTACAATTCGTTCTCACAAGTTTGATTATTTTCGTGTTCAGCATTACATTGATCACTCTTATAGTCAACTTCATGAATCCGTACTAAGAGCAATCAATGCAACTTTCTTCCACCTAAGTACTCGAGTCATCCGGTGATATATTGAATCCTTCTGTTATTGAGTGTGGTTGTTTGTGGTCTGGTTTGGTCAAGTATTGTGAGCTTCTTGTTGCTTCATTTTGATTTTTAATAAAAAAATGTCTTATATTAAACTTCTGATCGATCACTTGTTTGTTTGAATGTAGAATATAGTTTAACTTGACTAAATAAAGATATGGCTGTATATGTTGTAGGAAATTTTGAACACTATATTGGCCTTTCAATCATGTTATGTGAAGGATTGGAATTCATCAAAGTCGCTTATTTTAATTCGCTATAATTCATAGTTTAGGCAAAAACAGTGTTTAGTGTCGGTGGTGGTCATATTGATACTTGTGGAATATTTTAGTATTGTGTGATCGTTATCGTGGTCTGTTTGTTATTCTGAATTTTTGGTTGAACTTGGTCAGATTCGGTTGGATGAATCTTTACAGAAATTGTAGAAAGGTAGTGTAAAAAGGTCGGTTAGATTCATCTAACCTGAAGACATTGGAGGTAAGGTCTGGATATGAGATTAACCTTCCCTTGATGGAATTAATATGAGATGTTGACTGAGGTGTTGTTTTTTTTAGATATTGAGATCTTGGTTCATACCTTTTTCTTGCTAGAATGTCCCGCTCTTCCTTCCTATCTTCTATAGTTGACTAGTTGTTACAATTCTCATATACAACTTTGCTGTAAAGTGCTTGGTAGATCATATCACAATATTGAAACTGATAGAATGGATTGATCAATATGTCTTATGGTGAATGTCATAATATTCGTCATGATCATGACTGGTATGATGATTCAGTAGTAATCAGTAGTAATCGTGCGGAAATTGTCGCGGTAGGATTCGTTTACATTTTCGCGTTTGTAGGTGTATTTCTAGACCCCATGTATCCAACTCGAACCAGAATGTTATGATGGGTATTTGTTTGGTATTTATAATGACTTTATGTGTTGAATTTGGTGGTCCTAGAAAACAAAATTTAATTCAACCTATTTTTGTTCAATGATAATTAACTCCCAATATTATGGTAGGAAAAACTGCGCGTGTAGATATAGGTATTTTATTATTCCTTCTTGGATTTAAGTTAGTTAAATATACCAATTTGACATTTACATTCATGTAATCCTCCCATCAAAAACAGACACAAGATCATGTCGTGTCATCGATGCAGTAATCCATGCAGCCAGATATACGAGATAAACACAAATTGTAGAGTGCTGCAATAATTCATCCTTCGAGCATTCTTTATTCTAGAGAGCTGCAAGAATTCTCTGCTTTTGGGCTGATTATACAATCCTTATATTGAATTATTACTTCTCATTTGGAATACACTGTGTGCACTACATGGAATTCCAGTCGAGTTTTGCGTGAGATAAGCTAATAGCAAACCTGGAGGTTGACTATGTTCTGAGTTTGAAGATCATATATATATATCACTCTCTCTCGACTTTTATATTGCGAGTTGTACAAATTTTGTTTTCAATACGATAAAAAACTGTATTTTCAGATATAACTAGATCCAACTACTAAAACACACAAGTTTACCACCCTTATATCTGCGCATACCAATACTTCCTAGAAGTCCAACTTAGAAGTAAAGAAGATTGTAATTTTTAGAATTCCAACTTATAAATAAAGAAGATTGTAATACCTCTATGTAGACAAAATCATATTTGTGCTCTAGTTATCTTTCAAATTTAACATACTTGATATAAAAAAGGGATGTTAAATTCACCCCGAGTTGTTAAATTCACCCCGTCACTTTTCATGGCAACAAGACATGTCAGAAATTATTGTTTCTTCTCGTCGCGTCGAGGATTGGTTTCGGACTCTCTTTCTCATTTTCTTTTTCTCCACTGTGCACAAGCTGCTTTCTGTGGTGATTCTTGATATGCATATGGAGGAAATAACGGAATCGGCTGCTGCATGGTTTATTGTCCGAAAGTATCGTGCTGGATCTTAGAGCTGAATCTGCCCTTGGATGTGACCCTGATCAAATTTAAAAGAGATACTGACTAAATTCAGAAGAGAGATGCAACGTGTGAGAACTTGGGTGATGAATTTAACAATCACCAATATAAATATATCAATATATAAATTTCATCAAGTCCAACGATGTACCGAGAGTGTAAACCTCTCTCTTCTCTCTTCGTTTCTCTTGTGTACATATGACAATAAGCACTTGGTTTAGTAGGTATGGAGAAACACTCTCTTGTACTGCATTTTTCATTTTGATTCACGCGCATAATTATATTTTTATTAACTAGATAAGATCTAATTTTTTACATAAATGAAATCTATCCTCCCATAATGATGATGTGGTTTTCTTCTCCACCTTAACTTTCCAACTTTCTCAAAGCTACTTTGAAGACTTAAGTTTATATTAGTGAATGGAATAGTAAGCTTTCAGTTACAATTTCATTGATGCCGGTCACTCTTGTAAGAGACCTATCATGTCGACAATTAAATAGTTCCTACTATTTATCTCATTTTCATCTCCTTGTTTTTATGTGTATGCAATAAAATGTAGTCATGGTTTGTTTACCCTAGCTGGCATTTGTGATCATTGATTCTCTTGCATGTTACATCTCAACGATCTAAACCTTTAAAGTAACGTAGTTAGACTAGAACACAGTATCCTACTCAGATTTGGAAAAGACTGGCTGAAAGATAGAATTGTAATGGTTGCAAATGGGAATGGTATGTAGTAAATTCAGTAGATATTAGTCATCGAGATTGAGTGCAAAGCATTATATCCTTTGGGTATCTTGAAATAAGTGATGTTCTTGGGGAGTTCAACTCCTTCTTCGAGTCCGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGAAGCACATGAACATCAGAGTGATCCCGTGGCATACTGTCGATAGATTCATCTATACATTTTTCACATAAAAATCTGGATGATAAGCATTATATCCTGCTCTAGCTGGTGCAACACATCAACAACAGAGTGATCCCGTGGCATACTGTCGATAGATTCATGTATACATTTTTCACATAAAAATCTAGATGCAAAGCATTATATACTTTGGGGATCTTGAAATAAGTGATGTTACTGGGGAGTTCAACAGCTTCTTCGAGTCGGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGCAGCACATCAACAACATATAGATTTTTCACATAAAAATCTGGATGCATGGGAATAGAATGATGACTTTATAATAATCTTTTCCATTAGATTCTTGATTTGAAAAAATGATTCATAGGGAATGGTTCTTGGAAATCTGACTATAATATTTTTTTTGGAAATCTGACTAATATTTCAGAAAACTCTACCGTCACTAGGAGTGACACGGTAGAGTTTTCTGAAGAACTGTTTGTTCACTTGCTGAACAAACAGTTAGCACTAAACAACATCAGTGAGCACTAAACAACAGGCTTTTTCTTGCATGATACTAGATATTGCATACTATTGACTGCGGTTGAAACTAATCCCAACAATTTTTTTTGGTTTGAAATTCAACCATACTTTAAATATTCGCTAATTTACTGTTCGGTCCCTCTCGCTCCTCTCGCTCCCCTTCCCTTCGATTCCTGTCCGTAGCACCCCTCGCCTCTTTCCTCTTGTGGGTGGAGTGAGTGGGGGCGCCAGGCGAGCACGAGACAGGATCAGACCAGAGTGGGTGCGGTGTTCCTGTCAGAAGGTTTCTTCCTTTCCACTGCTCTGTTCTTCTCTGCTCCTCCCTCTGCTCCGTTCCGTCATCCTCTTCATCTTCTTCCTCTTCCTCTCCTTCTCCTGCCGCTGCTGCATCTTGAAAATCCGTCCGGAGTAAGGTCGCGAGTTAGGCTGCGCGTAGTTTTATATGTGGACGGTGGGGGAAGTTTTTCCAGCTCGAACGGAGATCCTCGCGGGGCTTCTTGAGCTTCATTTCGATCACTGGTGAGCGTCTAGCTCTGTACTGACCACTTTCCTGTGATGTTGATGATAATGATGATTATCACTCAAGTCTGTGTCTGTCGCTGGGTCGTTTGTCTGAGTTCCCTGCGGTCACTCTTGACTCCATAAGGTGCCAGTGCGGGGGTGTGCACTCAGTATAGTATAGGATGCTGCGATGATTGGGAAAAGAAACGAAGAGTGGAAATGGAAAAGCTTGGCTCGAAATCTCCCTGGCGCCGTTGCCTCTGCTCTGATTTCTTTCTCGAATCAACTGTGTGTATTCTTGATATGTTCGTCTCTTAGAACATCTTTTCTGAGAGCATCCCGTCTGTTTGCTGAGTTTCTTCCTATGTTGGCATCATGGCTTAGGATTCTGTGATTTCTCTTCCTCCGATCCTATTCTTGTATTATAGCTTTTAATCTTCCCTGGCTCGCTCGCTCTCTCCCTCCTTGTTTTGTGATGCTAGTTTTGCTAGGGGTGTGTAGATTAATGATGTTGTTAAGTTCTTAGTTTGCACAATATTGCAGTATTTTCATCCTTGGTTTTGGAGTAGTACATTTACATTCTTCATTACAATTGTGCTTAAATTACCATTAACAACTAGACTGAGTATCCAATTCTTCTGTTTTGTGTTTGGGATTGAAGTAATTGTTAATTTTCTTGACAATTGATAGGGATTGTAATATTGAGTCCCATAGTGAATTGCATAAGATCCATAGTGAATTATAAATGAATATATATACTGTTCAAGATACAGTCAATATACGTATTTGTAAATCACCATGGGTCGATTGAGATGCAATGCTTTTAATGCATTTACAAAATTAAATATTTCTCAAATTTCACCTCAATTTTCTATCAAGTTTTTATTTGCTGATGGTATCAATTGATTATGTCATTTCTTACCATAGACAGTATCAAAGTAATGGGTTATATCTTATGGTTTTCTTATCTTTAGCGATCAAATTTTTTTTTAAACTTCTCAATACTTATAGATGCTTTGTTGAACATATTTAATCGTGGTGAATGAATATGTACGCTTCAAAATGTAGGCTTCGCAACTAACGGATAATATTTTGTTTCAGACCAATCTTTGAAATCTCTGCTTTGTATATGAAATCTGCTTATATTTTATATAGGGGAATGTTAAAACAACCACATAAATTGTTCACATGATTTGTCAAAAACAATTTTTTTCGCATAAAAGCTCAAATATCAGCTGCGAGTGTGTTTTTGACTTCCCCCTCCTTCCTGTGCAAAAAACACCTTCAGAGTTGTTATCTCACAGGGATCATTGCAATAGTTTCAGTCAGTAGTCAATAGTCATTGTTCTTGAAGTGTGTACGTAGAAGTTTGATTGTGTCTTCTGCATATATGCAGCAATATGTAACAAAAATATGCTTGGAGATGATACTTGGGCTTGTGTGCGAAATATCAATTTTTGACAGGAGACTCGTCCGTGGTAGTTTTAACATTGGATGTGATCGTTTAACATTCCCCTTTGTATATTGCTTAACCCATTATGTTGGAACTTTTTCCAACATAATTGTTTGATAGTTTGAACAGATAGGCGAAATTGAAATCCTTTTTTCCCTTGGTTGAAGATTTTATTTTTACTCTCTCTGATCTCTATGCTTCTCATTCAAAGGTCTGGGTATATGAAAGGTAATCCGTTTAGGATTTATATGGATATATCTGAATGAATGCCTCCACGGGGTAGTATTTAGATAACAATCTTGTAATTTACATAATAACATTGTAATCATCATGTTTTCATTGGTTTGGTAATATCAATAATATAGCTAATAATAGTTTGATAGCAAGAACATGAAGTAATGCGACATCAGATGCTACTGGTATTTGTATATCGGTGCGGAAATTGTATGTGATGTATGACGTATCTCATATTACAGTAGCCTCCCGTTTGAACGGGAGGCTACTGTAATATGCATCAATAGTACGCATCATTTTCCCCAAAAAATAGTTCCAAAAAATAGGGTTCAGATTTATTTAGTTCAACGTGTCATATATTTTCATTTGGCGCAAGTTTTGAAGATTCTTGCGTTTGAAACCTGATTTTTGGTATATATTTTCGGCATTAGAAGGCTGTATTTGGGTAGTAAGCCATAAAACATAAGCGAGTATCTTCCGTATTGTATAAGTTTTTAGCACCATATTGGTAGTCTAAGGCTTCCAGCAATCCATGATTGGATTTGTTGAATTAAGCTCTCTCTTCGTGAAGCATCACCTTTTGCAACCCTCGGCGATTTGTGATTGACTGAGACATCAGCCATTACCATGATTCCTTAAACTCTGTTTCTGAAATGGGTAAACTCAATGCAATACTTTTCGCTTTGGCGACGGCGGAATAGATAGATTGGACGTATTCTGTATTAACAGAATGGTAAGCATGTCTTTTAGCTTGGTGAAACAACCAACACAGGATTGAAAAGTGTTATCTTTAGCTTCATAGATATCAAGACAGATCGCTTTAGGGTTTGCTCACACATTTCTGATAGCTGCTTCACTAGCATCGGGCCAGAGCCCTTTTACTGGGAGTATCGTGGTAAGTTTTCAAATGATCGATAAGAGCTGGTTGGTGTTTCCAGGTTGTTTACCCTAGTGATAACTATCTGAGATAAATTAAGTATGGAGTTTTCATCATCCTCATCAGATTTTGTTGTTTCGAGCTTTTTCAAGTGCTCTTGTATTAGTCCCGTCACCACTTCAGCTGGCTAGCTTCAAATATTTGCCGAAGCCATACAGTAAGACAGAAAAATATGCAACTCCACTATCTCTTCTAGTTACTTAATTGGGTCAAGTGGCCTCCATTCCTCGGATTTTTAACCGAGAATCATCTCATATGCAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGTATGTTTGGATTATATGCGACCTCATCCATGCTTGTAAGTCCTTATCATTTGGTTGCAAGTTTGGTTATGGTGAAGAGTCCATACTCCTGGTGGTTATGGTGAACAATGGCAGTATAACAGTACAATCATTAATGCTCAAGTTGAATATTGAACTGCATGTAATCTCCTGATAACCTGCTCCTTTGGTTGGTTTTTTTGGGTTCAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGTAAGCTTTCCGTGGGCTTTATCATTCTTCTCGACATTGATCAGTTATATGCTGAAGTTGTTACTTGGTGTTCATGATTTCCAAATTCGAGCAATGTCTTGGATCCGCACGAAGGTGTTCATTTAAACATCACTCGATGTTTCTTTTTTTGTTTATTGTAGGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAGTACGTCAAATGGGCTTCTTATCTACTAGTCTTTGTCTATCAGTGTATCATATTTCTCCGTGTGGAATCTCTGCTACACTTACAACGATAGGACTCCTTGACAACACTACTTCATGCTACTAATGTGTTTGGCTTTATGTTCAGCAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGGTTGGTTTTGTCTTGGAGACTGCCCTAACATTTCGACATGGTTGCATGAAGTATCTGCTTGATTGTTGGGGATCTCTTTCCAAGCCCCTTTACAATTATCAGTAAATTTCTGATGTGGTTGGGAAGAGTAGGTACTAGAGTATAATAAGCTGCCTCTGGTCGTGACTAAAATACAGTTTTGGTCAATACGTGATTCTCTTACAATGTTGCCATCTACTATTCTCTTGAAACCATCCACTCTTTGCAGTGGCTCTCATGGATGCATTATCTTCTGGCCTTCTGTGTACCATCCCCAACTTGAGTCTCCTAGTTTTTTTGTTAGTCTTCAAAATTGCTTGATATTGTTGTGTTCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGTATGTTTTGTCACTTAGTTTCACACTTTACGCGGAGTTCAAGTTTGTGTCGTATACTTGGTGGTTTGCATGTTGTCCATTTATAACTGGAGAGAGGATCTATTCTGGACTTGACCACTCATTTCACTATTTACTATTATTGAAGTGATTGTGGAGGATTATCATGGGGTTGATACTGATCTTTCGTTCACTTGAGTCTTCACTGTCGAAATCATGATTTAGATGTTTTGGTATGATCAAACTGAATGTAGTCAACGCATCTTCGTCTTCTGAGATTAAATTTGCGATGGATGATGCGAGTTACATACATGCAGTATATCCTGAAAAGAACGCTAGAATTGATTGTGTGACTTCCCGTTGTGCAGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTAGAGTTTCATAGAGGTGGTCTTTATTGTGTGCTAAAATCTTATAACGTATAAATATGTGATCAGACCTAGCATGGTTGTTGCTTGATTTAGCTATGTTGTTAAAGAAATCATACACTGTCCAAAAGTTCTAGCGAGAGCATGCATCAAGTACAAAGCATTAGATTCAACCTTTAACCCATTTTATTTTCATTTTCTCGCAAGGCGCAGATAATTGAAAATTTTACCTTTGTATTTTTTCAAAGTAGCAAGAGTTCACAACCTTTAGGCTGAATCCGTTCTTTGAATTGATCGTAAATGATGAAGTGTGAAGTGCATAGGGGTTAGAATTTATTGCCTAATCGAAGACAAGTAATTTCTTTTTTCCTGTTTGTGTTTTTGGGATTACTTACAGTTATTCTCCTTTATATTGCTGAGTTTTAGAATTGTCTGTTCCAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGTTTGTTTTAATGCTCGAATATTCAGGGGAATAACACACTCAGCTGAGATCTTGATAGTTGTCTCAGTTTAGTCGTCCTTTTGTTGCTGTTAACTTGAGCATGTGGTTTGCAAGTTAGAGTGTTCAAAGGAAGGTCGTCGTAGGTTGATCTAGAAATCTGGGAGATGATCGCGAAGACAATGTCTGCAAACTTCATCAGAATCAAGTCAGAAATAGAGGAGCTAATTTTCTCGAGCAATATTTCCATTTTCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGTACGTCGTGCGTAATGAACCATGTTGACCTCCTTGGACGAATGGACGGAATGACCTTGAAGTAGTCAACCAGAACTTATTCAGAAGGCTTTCTCTGTTTTGGTGCTGATCAATTTCTTCGATGTCGACATGTCTTTATGAAATGCAATGGCCATCGTTGATCAACAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGTGAGGTCCTATATGCTTCTCTAAGCATTTGGGTGGTTTCTTGAGCAAAGGACGCAGCTATGTTTTGAGGTCCCTTCTTGTCTTTCTAACCGCCGAGTACAATTGGCTGGTTCCGTGAGCTCAGCACCTCGCTATCTGTTGTATCTTTCTTGTTTCTCCTTCAACGTGAAGATGATGGTTCAGATTTAATCCGGTCATGTTCTTCACAATTCTTATTTCTTGCTGAGTTTGTCTTTACGTCATACAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGGTAAGGAGTTTAGAAGAAACCGTCAGTAGGAAGCTGTCTAGTGATATTGATTCACACCTTGATTATTGTTATATTTACCTGATAAATTCTGTTGTTTCCGCTTTTGAGAATTGTGTTTAAAGTACACAGTCTGAACCTCATTTTCTTTTGCCTTCGATGGACAAACTTATTTCTATGTTTTTGACAGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACGTAAGTAAAAGACAGAACTAGCTAAGACAAAAGTTTCTGCAAGTCTGGGGTTGTTTATTTTATTACAATTACATGATGTGCAAGTTGACTTTTGGAAAAACTTTTCGAGATCAATCGCTCACTCTGTGTCTTAACGTCTGTTGAATATAGTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGTGAGCTTTCCAATTCTGTTATTCTGTTTTTCTTCTCTTGACCAGCTTGCCGCCAAAGCTGCGTGGTGAACTTTCATTTCTTGTAAAGAGACATCGAGAACTGATTCATTTGGACAATATAAAGCAAAAGGCAGTATGAGTAGTGGTCGGAGTCGGTGATGGCAGTCTTTGCCACCTCATATTCTGAGTTTTCACGGGATTACAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGGTAACTATCTAGTCTGAACGCCCTTGAGGATAACCACGAGGACGTATTCGATGCTTAAGTAAATGATAACCTCTTGCATATTTTACTCATTCATGTGGCCGTTATCCCAACCCTGTTGTATTATAGGAGTATCTGAAATTTGATTCTTTCTTTCATGACCTTTACAGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGGTAATTACATGCCAAACGTAGTAAGCTCTAGCTTCACAGCTTGTGTGGTCAAACCGCCTGGATGTTCTCTGTATGTAGGTAGTCCCATTTGTCAAAAACACGCAACAAATCTGCCGAGGAAAGTAGAACAACAATGCAATATTTACGTATTCTTGTTAGAAATTAGACACGTTTTACATTTATATTTTTTCAAGGAAAGTTGATCTCATGATTTCAAGCTTGCTTCGTTGTTTTTAACCCACATTCATCTTGAATTGAATACATTTTCTGGTTTAAGTGCTAAAACTTGGTGGGAAAAATCTAATTTGTTCTTCCTGGGAACAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGGC

mRNA

>Mapoly0075s0051.8
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGGC

CDS

>Mapoly0075s0051.8
ATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGAATTTGCTTCATGTACTCGTCACTTGA

Protein

>Mapoly0075s0051.8
MGAGAGAAAAIENEPSPRRAAIEKAQAELRREVAVREERRRELEFLEKGGELLDFFSAANFALPPSSPTDPLADQLLSSEGEGGHASVALTNGDSVENSVGTSLCVGRSSEGGGDLCPGEDFLSAVIEPLTPWEGKGRASRTGSTSLRSHSDVNLKRESEGSGGGRAAVKGQAYSRRNRPRSNRFGNGHTPTRDVEKAGEVGVLPSIEIKGSPAPPVIFEEVTEENETMVDKKLQVLPAPTLLYNSHASTQLGPVTTKVIEDLEATHLPTGKSFEQNSVKAVHAADDALQTGREFQIHDLAASSCGSLQRSSDLREDVCTGIVVKDELVVVGDLKKVDQTSLSPHVEKNVDSRDGGAVSQPSEQVLGNNQAASDKACGLPSMVEDESAIVMIMDESLGSRTSKNECKDKSTVVSETKGDRVIDRSTIITKHGPDSMLTPTIDDKTSVLREVSCTMQLTPKSLDTSENKSIISRKTTSTASSGAPDLIQNDKARIDDPPSDARVEVKVEEGLSEVGTRLSTVDTQVESGHDVKSICVVSLPQEEIKSESQSTPVSAGSNRAGFRTPNSNTASINKFPGVVLPWEKERDPNVRAEAERHKADLSAKARKAHEDYILEEAEIIKKSKKDTAEWAKRSPHLEPARRKSHWDYLLQEMAWMANDFMQERLWKLASATQFCRWIAEQRGQSSVLQLAGIKQRQERVARVLANAINEFWRSVEYIIHKDKRLTLSSLENQESVVAMKEDSEAVPMDVDIPSIPEGSTQRVEKLPSRSRKPLPVQNYAIRFLKESMGSDVGAQAEAPCTPERISEANSVLDPLWEDQFPEEPLFYLVPDGASRAYRILIETERSSLEIEHEQTLHDHAAAIADAEAVAEAAANADFNVSLSVGEGQPLSVLSSPMKGLRAEEDELGGQFLPNALSSIAKKKRKNILKSNASKGEGISSSGPTHRPPIAPGLDSTAVVQSPLVTGKRSLSVGPGNIVGNVGSIPTKRMRSVSSARQRVMGTASPNSFPSPGGLLQRTIFSSGALNSHQDEVRNLCDDTATRIEADATTVSVKNGLGAGCNNSFVNSKSKKKKKTKHFSGQLSSVNAVKGDGAPSVNTASSTKTPEAEHRSVFDQLKRKGDQVNAASVELDTGGIGSSADTPETPSSQGQQPSKKAKVSKQASDLNPEAAAAAISTAATQSGSLVANTSSTSKLLRQNSNRDRNRKTKSTKVPLTQPAGIGIPWSTIEDQAIFALVHDLGPNWELVSDVLSSSSQLKGIFRKPKQCKERYKSLLDRMSVGEGGDSPEDPSTSQPHPSTLPGIPKGSARVLLQRIQGPMEEDTLKVHLEHIVRVVHKFRALKPPTEEQKLLVQPHASHLNAITQFCANGYPTPSDLCEITAAAPELGGPAYQLPGQHLPGVLAAGSGIRPATNGLPVLPSASNLHMGVPAVAPSTTAASAARDAAVYRDVHRLAAIRPFSPEDAQRVRYHRAMAAARGLSVSGPTVTAGLPMMGLPSPSDCPVPLLGSGNNNIGMMGGISRGMSLSRPGLPGMGSPGVPGIGPPPLGSVLSTGGVGIVSAGPTVGPTVVPQQVNLIRRSREQQLVRPGRSNEDQRRFIEELKHQAAQGNTQAATALSSLGSEVTREMMAVQAQPFQQLQHQNHQQQQQQQQYLAARMAKERQMQQQQKQRLLQQQLQQPQQPSSLQPQLQTQMQQQQMHGMSQQHVLPQQSHLSQQQHLLSSQQHNLQKQQSQQGPQQTGTLSSPSLQPTTIPSMQSNHQQHQTLLQPQQQAPPLGQVQQLPVQSKLQPPKQAQKHPHLQQASQVVQQQPPRGSKGVVRGNMLVQALPGSGQSSMLPGNVSAGSQPQQVAGQQIAHSMQGQRHLMPLAKPLSQTSTQVMTGQSAHMQAQQNQSMAGPVPQGSLGGSQKVVSQQPTQLGTMPSKQLQPSPLPSALPSQQQSPAPPLPTQQQQTSPPAAQQPQIGSSQQLQVQQRRPSQQAQIQSAQRRIQQRQPVASVGAPMIGVLGKNGSSTQQGQVPAQMSSQPGHVTYTQGSSMAVPMSMMSASSGASGLSSSGSPSSSGVHSTPWKPGQVVSPMSSGFYNLSRSGSPGAAQLPSIVSSSGMHLASSNGNSGMSITGSGPPHGVIVGSLSQPLQVGSGGHGLKMGLVTGSNPRGVSTTLQGGTQRSIQHHGNLPASPAIGATQQVRSPVPASSAGMMPVSALGTNTVAGVSSSGSMAYQANSSSLSGHSTAISNSMHMFSVQPRQSHAGSAAATTPAVPMKSPPTSGTSQTSAVSPSSPAPNLLHVLVT

Mapoly0075s0051.9  

Gene structure:

mRNA scaffold_75:641574..665394  ( - strand )
three_prime_UTR scaffold_75:641574..642323  ( - strand )
CDS scaffold_75:642324..642350  ( - strand )
CDS scaffold_75:642627..642743  ( - strand )
CDS scaffold_75:643068..645041  ( - strand )
CDS scaffold_75:645209..645641  ( - strand )
CDS scaffold_75:645847..646056  ( - strand )
CDS scaffold_75:646207..646289  ( - strand )
CDS scaffold_75:646477..646593  ( - strand )
CDS scaffold_75:646841..646981  ( - strand )
CDS scaffold_75:647150..647230  ( - strand )
CDS scaffold_75:647484..647540  ( - strand )
CDS scaffold_75:647979..648205  ( - strand )
CDS scaffold_75:648571..648631  ( - strand )
CDS scaffold_75:648986..649024  ( - strand )
CDS scaffold_75:649169..649927  ( - strand )
CDS scaffold_75:650089..650172  ( - strand )
CDS scaffold_75:650380..650574  ( - strand )
CDS scaffold_75:657671..657955  ( - strand )
CDS scaffold_75:661720..661842  ( - strand )
CDS scaffold_75:662002..663628  ( - strand )
CDS scaffold_75:663929..664020  ( - strand )
CDS scaffold_75:664281..664335  ( - strand )
CDS scaffold_75:664437..664525  ( - strand )
five_prime_UTR scaffold_75:664526..664680  ( - strand )
five_prime_UTR scaffold_75:664916..665394  ( - strand )

Sequences:

Gene

>Mapoly0075s0051.9
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTATGAATTTAGGGTTCGCAGAGAGATAGGAAAAGGCTTTGTTTGCAAAATATGTGAGTGCTATATTTTCGCTTGCGAAGAGTGAGTTTGATCGATCGAAAAGCACTGACCCTTTCTAACGCGATAAATTCGCTAGAAACAATACTGTTTTTTTTGGGGTATTTGTTTTCGTATTATTTTTCCCCGACGTTTTTCTCGCTTGGTTACGACTCTGTGGATTTGTGCAATTTGGCAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGGTTGGGCGTTGTATCACTGTACTATGGAACACTCGGCAATTTCAATTGCTTTACTTGCATTTCACTTAGAAAGTAACCTCTTGGTCTTTGGTTGGTCACAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGTATGTTTACTGTATTGTAGCTTGCTTAGTTTTTTGAACGAAGAAGTTTCAAATGTTTAGATTTTTAAAAAATATAATTAAGTGCATGTATTTAGCTCAACTTGCAAATTACAGAGAGGTAGATCTTGATGGTTTAGTGTCATCACTAGTGTTTTAAGTTGCACAGGCTGTTCAAAAGTGGAATCTGAATACGTTGTTTTCTGTATCCATTTTGTTTGCTTTTCTTTCTGCTTATGTTCTCAATAAGCTTATTCGTGCAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGGTTCTTACATGACTTGGATTGCTTATGAAGATGGAAATTTTTAAGAGCACTAGAAGAGTGTAGAACTTTCACTATTGACTGCCTATGTATTTTCGACGTTGACTGTTGAGGTGTATTTGTGAATTGATCTGTTCAAAAGTGTTCATTCGAGCCCAAGTTACTGTCAAATCAAAGGGCCTCGTTGTACCGTTCAGGTTATGTCTACGTGTAGTTTTTGCAGACGATGGTTGTGAAGAAAACAAGTGTTGCCTATACATTGTGCATAAGACAGAATTGACCTCACATATGTCTTTTTGGCAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGGTACTGTGGATGTGTTCTTCCTCATGAGTTTATACATTGAAGGTCTAACTAGTGTTCATGGTTCAAGCTCGGCGCTTTCTGGTTTCTTCTCAATTGTCAAGTTATGATTTCAGTACAAGTCTCAACTACTAATGAGTTCAGATTTGATATATTTCCCAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGTGCATTTCTTCCTTTGATTGTGTTATAGTAGTCTCTCTCGTTTTGGAACTGGGATGGTTCATGTACGCTTTTGCGTTAAGCATGCGCAAGAACTTTCTCTTATCCCACAAGTTTGATGTTAACTAGTCATTGATACTACATAGTCACATACATTTTCTGACTACCAAGCTATCGATTTACATTTTTCTTCCATTGGCAAGTTAGCGTCGCGTACTCTCAACCTCCATCGAACTCCAGTGTATGAAAGATCTTTTCTTTGGGCTGCATCTAGGTTGCATCCAGTCGTTGTATTCACAACAGAATTTAATGGAGTGGAACATATTTCAACCATAGTCCCGCTAATCGCATTGAGAACTTTACTTGATATTGCTGGGCAAATATTGTATTGTATATCAAAACAATTAGTAAAAGAAAATTAACAGGGGAACTCTAGAGTTCTAAGACAACAGCTCTCCCTATCAAGATCATTTGCGCATGATCATGTACGTCAATACTCCTAGTGTTTTGTTAAAGTGTCCAGAACTGTAAGTCATTAAAGTTTCTCATTCTCATTACCATTGTTTCAGTCCTGTACTAGACACGGACTCTGTCAAAATCGTTGAACGTATTCACTTGAAAATAGTCACTGTATTTAGCTGTTTAACGCCAGCCTTAGCTGGTTTCATCCACCGGATATCGGTGGCCGTATTTTTCTCGCCCGAGCCTATCGACCCCCCGGCTATGTAACAATTGTGGTCATGAATCCAGCGTTGCTAGTGGAGTCCAAGAGTTGTGTTTTACCCTACTCCTGGAACGAGTAGGAGATGAGTAGTAATTGCTTGTGAACCATGCGGTTGATCATGCACGTGATAGCTCCTAGTGTTTTGGTAAAGTTTATGGAACTGTATATCCTAAGCTTATCTTATCATATTTACCATTGTTTCAGTCTCCTGTACTACACGGGATGGTTGAACATCGTTGAACGTATTCGCTTGAAAGTACACACTTCAACAGTTTCACACCAGACAGTTCTGCTTTTATCCATTGTAATATTGATGGCTTTGATTGTCGCGCCCGAGCCATATCAGACACGGTCAGAGCCATGTAGCCAATGTGCTCATGATTTTAGCGTTGCTAGTGGAGTCCAAGCGTTGGAATTTACACAATTCTTGGAAAGAGAAGAAGAAGAGTATTCCTTGCGTGTTAACCTTGCGGTTGATCATGTACATCGTAGCTCCCAGTGTTTTGGTAAAGTTTCTGGTACTGCTAAAAAGTTTCTCATTTTTATTACCATTGTTACAATCCTGCTGTACCAGAGACCGGATGGGGGAAAATCGTTGAACGCACTCGCTTGAAGGTAGGCACGTCAAGTGTTTTATGCCAGACACCGTTGCTTTTATCCATTGGATATCGATGCTCGTAATCCTTGCACCCAAGCCTTATAGACCTGGTCACGACCATGCAGCTGATGTGGTCATGATTCTAGGGTAGCTAGTGGAGTCCAAGAGTTGTGTTTCATGCAACTTTGGGAAGGGAGAAAATTACTTGATGGGACCCCTGCGGAACACAAAAGACTTGCTGATACACAACACGATTCATTTTACCAGATGGGACCACCCTACGGCCATGCAGCATTGGGTGACGTATCGGGTGACGGCAGCCCACCGTCACCCAATACGAGTTCTGGGTTAGGTACAACCAGTGGGTGGATCAATCAGAAACTTTGACTCCAGTCCTTTGAAAGAAACAGCCCCTAACTTAAGTCCCTCAAGTCCTCACGAAGTTAAGCGGTAACGGTACACAACATAAATTTGACAGTAACAGTAACTACATTCCTTCTGATAGACATACGCATGGGGACTTCGATCTCGTTTGCAACGTTATGATACCAACATAACAGCATCATGGTCTTGAGTTTGATGATTGCAACGCAATTTTCTGAAAGAAGCTACATCCAAAGATGTCGAAAGTTTACACTGCAAGTTAGCTTACTTAGTGTATCGGTTGTGAATCCTTTCAAACACAGTTTCTACTTGTATGCAAGCGACGCTCCCATCGCATCCGTCAGAGGCTTCATCAAGAGATCATTCCTTGCACAGACGAGACCCTCAATCTGGAATCTCTGCTTTGCGTGTAAGTTCAGTAAAGTTCCTGGAGCCCCTGGGTCCCAAGCTTTCGTCTGGGGATGCTGGAAGATTCTGCCATGGCTACACAAAGCTTGATTATCGTTCCTACTACTGTCAGGCTCACTGAATTGATCGTGAACAAAGTTCAGTGATGACGCTAAGGAATCACTGAATTGTGACGGGTTTTGCTGCACCTCAAGATAGTTATACGCTCTTTTCATACAGGGATTACAAGCACTGTGCCCTTTTGGCGTGGTTGATTGACCTCTTATAAGTAACCCAAAGTGAATCGATTTCCACGCAATGCAAATTCTTCATTCTGTCATATTGAGCCAGCCTATTCCTAGACTGGTTCTTCGTTCTTATTCGACGTGGTGGAAGGACGTAGGTATTCCATCTGGTAAAATGAATCGTGTTGGGTCCCAGCAAAAGCATTTGCTGGTACCCAACACTCCGGTGGTGCAGGCTTTACTCCGGTGGAAGTAACGGCCGTATACACTTCTCATCCCATGATGCATCTCACGGATAGAAGTGCAGAACTGTATCTACATCGGTCCTCTTCTAATGCAGATTACACTGGAACAGCTACGAGAGACTTTCTCTCCCTCACACACAACTCGACTTCTAACTTTCGTTTTTATTGACCTTTGTTTATGCATATCGTAGAGGTATTACCCTTCAGTTGTAAATATAGAGTTTTCCTTATCAGTTTTGATCAGGTTGTGTCTGCGAGATATCTTCTAATATTTGGTCAATAGCGCACAGAAAAACAAAAAAAAACATGTGAATATTGTTGAGCTTCACTCGTGTGTTTCAAATTAACCTCTGGGTAGCTAAGTTAAGTTTAGTTAGCTCACCGCCTGGAGTGGGGTATTTAACCCCAGATCTTCTCGACTGTAATCACTCTCTTCACATGTTAACTATATGCGCTGTATTGCACGCGCTCACTTTGACTGCACAACTATGTTGTGATTTCACCGTAGATGCTTAGAGTCACTGCGATCAGGTCTTCAAAATCGGACCCGCTCAGATCTTGCTGTACAGATTCACATCAACCGTGTACTGGAGATAGACAAACGATCCAAGGACGCATGGAAGCATATCGCTTTTGAGACAATTAGGTCTGAGGTCAGAAGCCCATATTCTAAGGGGTCAGTCCTACAAGGGCGAGTGGAAGGGGTTGAAAGGTCTGAAAACAGTAAGCACATCTAATTATAAGGCAGATAATGGATGGAGAAGAATTCTTGTGTGATGTGGTTTTAGTTCATTGCCACGCAAAAGGTAAAATCAGCTACATACCCCGTGAGACATCTACCAGCCAATCAAAGACACCACATGTTTGACAGTCTAATATTCGTGGATACATCTTGTTGATGTTTGTAGGTTAATCCTCGTAGTTTCATAGTATATCTTTCTGACTTATGGTGAACTAATAAATACATGTTATGGTGCTTTCCTCTAAATTCGTCTTTTTACTCAACACAGTGCTATCTTGCTCTTATGTATTATTGCTCTACCATGCGTTTCTATGTGGGCAATGCCTGTTTTTTTTACGTGGATGTGTTGGAGAACACATTTTGTAACTCACAAATTAAATTTAAGCTATACCATGTTCGGATTTAAGAATATAATGCATGGTTGTATTGTTCTGATCGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGTATTCTTTCTTGATATACATAGTGATCTATTTTGTTTCAATTTGATTCAGCTCAACATCCCCATCCATAGTAACGGAAATTGATTCCATTTTACATGGTGGACTTAACATATTGACTAGATTGTATTTCCTTCATATTGGGAGTAATTACAATTCGTTCTCACAAGTTTGATTATTTTCGTGTTCAGCATTACATTGATCACTCTTATAGTCAACTTCATGAATCCGTACTAAGAGCAATCAATGCAACTTTCTTCCACCTAAGTACTCGAGTCATCCGGTGATATATTGAATCCTTCTGTTATTGAGTGTGGTTGTTTGTGGTCTGGTTTGGTCAAGTATTGTGAGCTTCTTGTTGCTTCATTTTGATTTTTAATAAAAAAATGTCTTATATTAAACTTCTGATCGATCACTTGTTTGTTTGAATGTAGAATATAGTTTAACTTGACTAAATAAAGATATGGCTGTATATGTTGTAGGAAATTTTGAACACTATATTGGCCTTTCAATCATGTTATGTGAAGGATTGGAATTCATCAAAGTCGCTTATTTTAATTCGCTATAATTCATAGTTTAGGCAAAAACAGTGTTTAGTGTCGGTGGTGGTCATATTGATACTTGTGGAATATTTTAGTATTGTGTGATCGTTATCGTGGTCTGTTTGTTATTCTGAATTTTTGGTTGAACTTGGTCAGATTCGGTTGGATGAATCTTTACAGAAATTGTAGAAAGGTAGTGTAAAAAGGTCGGTTAGATTCATCTAACCTGAAGACATTGGAGGTAAGGTCTGGATATGAGATTAACCTTCCCTTGATGGAATTAATATGAGATGTTGACTGAGGTGTTGTTTTTTTTAGATATTGAGATCTTGGTTCATACCTTTTTCTTGCTAGAATGTCCCGCTCTTCCTTCCTATCTTCTATAGTTGACTAGTTGTTACAATTCTCATATACAACTTTGCTGTAAAGTGCTTGGTAGATCATATCACAATATTGAAACTGATAGAATGGATTGATCAATATGTCTTATGGTGAATGTCATAATATTCGTCATGATCATGACTGGTATGATGATTCAGTAGTAATCAGTAGTAATCGTGCGGAAATTGTCGCGGTAGGATTCGTTTACATTTTCGCGTTTGTAGGTGTATTTCTAGACCCCATGTATCCAACTCGAACCAGAATGTTATGATGGGTATTTGTTTGGTATTTATAATGACTTTATGTGTTGAATTTGGTGGTCCTAGAAAACAAAATTTAATTCAACCTATTTTTGTTCAATGATAATTAACTCCCAATATTATGGTAGGAAAAACTGCGCGTGTAGATATAGGTATTTTATTATTCCTTCTTGGATTTAAGTTAGTTAAATATACCAATTTGACATTTACATTCATGTAATCCTCCCATCAAAAACAGACACAAGATCATGTCGTGTCATCGATGCAGTAATCCATGCAGCCAGATATACGAGATAAACACAAATTGTAGAGTGCTGCAATAATTCATCCTTCGAGCATTCTTTATTCTAGAGAGCTGCAAGAATTCTCTGCTTTTGGGCTGATTATACAATCCTTATATTGAATTATTACTTCTCATTTGGAATACACTGTGTGCACTACATGGAATTCCAGTCGAGTTTTGCGTGAGATAAGCTAATAGCAAACCTGGAGGTTGACTATGTTCTGAGTTTGAAGATCATATATATATATCACTCTCTCTCGACTTTTATATTGCGAGTTGTACAAATTTTGTTTTCAATACGATAAAAAACTGTATTTTCAGATATAACTAGATCCAACTACTAAAACACACAAGTTTACCACCCTTATATCTGCGCATACCAATACTTCCTAGAAGTCCAACTTAGAAGTAAAGAAGATTGTAATTTTTAGAATTCCAACTTATAAATAAAGAAGATTGTAATACCTCTATGTAGACAAAATCATATTTGTGCTCTAGTTATCTTTCAAATTTAACATACTTGATATAAAAAAGGGATGTTAAATTCACCCCGAGTTGTTAAATTCACCCCGTCACTTTTCATGGCAACAAGACATGTCAGAAATTATTGTTTCTTCTCGTCGCGTCGAGGATTGGTTTCGGACTCTCTTTCTCATTTTCTTTTTCTCCACTGTGCACAAGCTGCTTTCTGTGGTGATTCTTGATATGCATATGGAGGAAATAACGGAATCGGCTGCTGCATGGTTTATTGTCCGAAAGTATCGTGCTGGATCTTAGAGCTGAATCTGCCCTTGGATGTGACCCTGATCAAATTTAAAAGAGATACTGACTAAATTCAGAAGAGAGATGCAACGTGTGAGAACTTGGGTGATGAATTTAACAATCACCAATATAAATATATCAATATATAAATTTCATCAAGTCCAACGATGTACCGAGAGTGTAAACCTCTCTCTTCTCTCTTCGTTTCTCTTGTGTACATATGACAATAAGCACTTGGTTTAGTAGGTATGGAGAAACACTCTCTTGTACTGCATTTTTCATTTTGATTCACGCGCATAATTATATTTTTATTAACTAGATAAGATCTAATTTTTTACATAAATGAAATCTATCCTCCCATAATGATGATGTGGTTTTCTTCTCCACCTTAACTTTCCAACTTTCTCAAAGCTACTTTGAAGACTTAAGTTTATATTAGTGAATGGAATAGTAAGCTTTCAGTTACAATTTCATTGATGCCGGTCACTCTTGTAAGAGACCTATCATGTCGACAATTAAATAGTTCCTACTATTTATCTCATTTTCATCTCCTTGTTTTTATGTGTATGCAATAAAATGTAGTCATGGTTTGTTTACCCTAGCTGGCATTTGTGATCATTGATTCTCTTGCATGTTACATCTCAACGATCTAAACCTTTAAAGTAACGTAGTTAGACTAGAACACAGTATCCTACTCAGATTTGGAAAAGACTGGCTGAAAGATAGAATTGTAATGGTTGCAAATGGGAATGGTATGTAGTAAATTCAGTAGATATTAGTCATCGAGATTGAGTGCAAAGCATTATATCCTTTGGGTATCTTGAAATAAGTGATGTTCTTGGGGAGTTCAACTCCTTCTTCGAGTCCGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGAAGCACATGAACATCAGAGTGATCCCGTGGCATACTGTCGATAGATTCATCTATACATTTTTCACATAAAAATCTGGATGATAAGCATTATATCCTGCTCTAGCTGGTGCAACACATCAACAACAGAGTGATCCCGTGGCATACTGTCGATAGATTCATGTATACATTTTTCACATAAAAATCTAGATGCAAAGCATTATATACTTTGGGGATCTTGAAATAAGTGATGTTACTGGGGAGTTCAACAGCTTCTTCGAGTCGGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGCAGCACATCAACAACATATAGATTTTTCACATAAAAATCTGGATGCATGGGAATAGAATGATGACTTTATAATAATCTTTTCCATTAGATTCTTGATTTGAAAAAATGATTCATAGGGAATGGTTCTTGGAAATCTGACTATAATATTTTTTTTGGAAATCTGACTAATATTTCAGAAAACTCTACCGTCACTAGGAGTGACACGGTAGAGTTTTCTGAAGAACTGTTTGTTCACTTGCTGAACAAACAGTTAGCACTAAACAACATCAGTGAGCACTAAACAACAGGCTTTTTCTTGCATGATACTAGATATTGCATACTATTGACTGCGGTTGAAACTAATCCCAACAATTTTTTTTGGTTTGAAATTCAACCATACTTTAAATATTCGCTAATTTACTGTTCGGTCCCTCTCGCTCCTCTCGCTCCCCTTCCCTTCGATTCCTGTCCGTAGCACCCCTCGCCTCTTTCCTCTTGTGGGTGGAGTGAGTGGGGGCGCCAGGCGAGCACGAGACAGGATCAGACCAGAGTGGGTGCGGTGTTCCTGTCAGAAGGTTTCTTCCTTTCCACTGCTCTGTTCTTCTCTGCTCCTCCCTCTGCTCCGTTCCGTCATCCTCTTCATCTTCTTCCTCTTCCTCTCCTTCTCCTGCCGCTGCTGCATCTTGAAAATCCGTCCGGAGTAAGGTCGCGAGTTAGGCTGCGCGTAGTTTTATATGTGGACGGTGGGGGAAGTTTTTCCAGCTCGAACGGAGATCCTCGCGGGGCTTCTTGAGCTTCATTTCGATCACTGGTGAGCGTCTAGCTCTGTACTGACCACTTTCCTGTGATGTTGATGATAATGATGATTATCACTCAAGTCTGTGTCTGTCGCTGGGTCGTTTGTCTGAGTTCCCTGCGGTCACTCTTGACTCCATAAGGTGCCAGTGCGGGGGTGTGCACTCAGTATAGTATAGGATGCTGCGATGATTGGGAAAAGAAACGAAGAGTGGAAATGGAAAAGCTTGGCTCGAAATCTCCCTGGCGCCGTTGCCTCTGCTCTGATTTCTTTCTCGAATCAACTGTGTGTATTCTTGATATGTTCGTCTCTTAGAACATCTTTTCTGAGAGCATCCCGTCTGTTTGCTGAGTTTCTTCCTATGTTGGCATCATGGCTTAGGATTCTGTGATTTCTCTTCCTCCGATCCTATTCTTGTATTATAGCTTTTAATCTTCCCTGGCTCGCTCGCTCTCTCCCTCCTTGTTTTGTGATGCTAGTTTTGCTAGGGGTGTGTAGATTAATGATGTTGTTAAGTTCTTAGTTTGCACAATATTGCAGTATTTTCATCCTTGGTTTTGGAGTAGTACATTTACATTCTTCATTACAATTGTGCTTAAATTACCATTAACAACTAGACTGAGTATCCAATTCTTCTGTTTTGTGTTTGGGATTGAAGTAATTGTTAATTTTCTTGACAATTGATAGGGATTGTAATATTGAGTCCCATAGTGAATTGCATAAGATCCATAGTGAATTATAAATGAATATATATACTGTTCAAGATACAGTCAATATACGTATTTGTAAATCACCATGGGTCGATTGAGATGCAATGCTTTTAATGCATTTACAAAATTAAATATTTCTCAAATTTCACCTCAATTTTCTATCAAGTTTTTATTTGCTGATGGTATCAATTGATTATGTCATTTCTTACCATAGACAGTATCAAAGTAATGGGTTATATCTTATGGTTTTCTTATCTTTAGCGATCAAATTTTTTTTTAAACTTCTCAATACTTATAGATGCTTTGTTGAACATATTTAATCGTGGTGAATGAATATGTACGCTTCAAAATGTAGGCTTCGCAACTAACGGATAATATTTTGTTTCAGACCAATCTTTGAAATCTCTGCTTTGTATATGAAATCTGCTTATATTTTATATAGGGGAATGTTAAAACAACCACATAAATTGTTCACATGATTTGTCAAAAACAATTTTTTTCGCATAAAAGCTCAAATATCAGCTGCGAGTGTGTTTTTGACTTCCCCCTCCTTCCTGTGCAAAAAACACCTTCAGAGTTGTTATCTCACAGGGATCATTGCAATAGTTTCAGTCAGTAGTCAATAGTCATTGTTCTTGAAGTGTGTACGTAGAAGTTTGATTGTGTCTTCTGCATATATGCAGCAATATGTAACAAAAATATGCTTGGAGATGATACTTGGGCTTGTGTGCGAAATATCAATTTTTGACAGGAGACTCGTCCGTGGTAGTTTTAACATTGGATGTGATCGTTTAACATTCCCCTTTGTATATTGCTTAACCCATTATGTTGGAACTTTTTCCAACATAATTGTTTGATAGTTTGAACAGATAGGCGAAATTGAAATCCTTTTTTCCCTTGGTTGAAGATTTTATTTTTACTCTCTCTGATCTCTATGCTTCTCATTCAAAGGTCTGGGTATATGAAAGGTAATCCGTTTAGGATTTATATGGATATATCTGAATGAATGCCTCCACGGGGTAGTATTTAGATAACAATCTTGTAATTTACATAATAACATTGTAATCATCATGTTTTCATTGGTTTGGTAATATCAATAATATAGCTAATAATAGTTTGATAGCAAGAACATGAAGTAATGCGACATCAGATGCTACTGGTATTTGTATATCGGTGCGGAAATTGTATGTGATGTATGACGTATCTCATATTACAGTAGCCTCCCGTTTGAACGGGAGGCTACTGTAATATGCATCAATAGTACGCATCATTTTCCCCAAAAAATAGTTCCAAAAAATAGGGTTCAGATTTATTTAGTTCAACGTGTCATATATTTTCATTTGGCGCAAGTTTTGAAGATTCTTGCGTTTGAAACCTGATTTTTGGTATATATTTTCGGCATTAGAAGGCTGTATTTGGGTAGTAAGCCATAAAACATAAGCGAGTATCTTCCGTATTGTATAAGTTTTTAGCACCATATTGGTAGTCTAAGGCTTCCAGCAATCCATGATTGGATTTGTTGAATTAAGCTCTCTCTTCGTGAAGCATCACCTTTTGCAACCCTCGGCGATTTGTGATTGACTGAGACATCAGCCATTACCATGATTCCTTAAACTCTGTTTCTGAAATGGGTAAACTCAATGCAATACTTTTCGCTTTGGCGACGGCGGAATAGATAGATTGGACGTATTCTGTATTAACAGAATGGTAAGCATGTCTTTTAGCTTGGTGAAACAACCAACACAGGATTGAAAAGTGTTATCTTTAGCTTCATAGATATCAAGACAGATCGCTTTAGGGTTTGCTCACACATTTCTGATAGCTGCTTCACTAGCATCGGGCCAGAGCCCTTTTACTGGGAGTATCGTGGTAAGTTTTCAAATGATCGATAAGAGCTGGTTGGTGTTTCCAGGTTGTTTACCCTAGTGATAACTATCTGAGATAAATTAAGTATGGAGTTTTCATCATCCTCATCAGATTTTGTTGTTTCGAGCTTTTTCAAGTGCTCTTGTATTAGTCCCGTCACCACTTCAGCTGGCTAGCTTCAAATATTTGCCGAAGCCATACAGTAAGACAGAAAAATATGCAACTCCACTATCTCTTCTAGTTACTTAATTGGGTCAAGTGGCCTCCATTCCTCGGATTTTTAACCGAGAATCATCTCATATGCAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGTATGTTTGGATTATATGCGACCTCATCCATGCTTGTAAGTCCTTATCATTTGGTTGCAAGTTTGGTTATGGTGAAGAGTCCATACTCCTGGTGGTTATGGTGAACAATGGCAGTATAACAGTACAATCATTAATGCTCAAGTTGAATATTGAACTGCATGTAATCTCCTGATAACCTGCTCCTTTGGTTGGTTTTTTTGGGTTCAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGTAAGCTTTCCGTGGGCTTTATCATTCTTCTCGACATTGATCAGTTATATGCTGAAGTTGTTACTTGGTGTTCATGATTTCCAAATTCGAGCAATGTCTTGGATCCGCACGAAGGTGTTCATTTAAACATCACTCGATGTTTCTTTTTTTGTTTATTGTAGGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAGTACGTCAAATGGGCTTCTTATCTACTAGTCTTTGTCTATCAGTGTATCATATTTCTCCGTGTGGAATCTCTGCTACACTTACAACGATAGGACTCCTTGACAACACTACTTCATGCTACTAATGTGTTTGGCTTTATGTTCAGCAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGGTTGGTTTTGTCTTGGAGACTGCCCTAACATTTCGACATGGTTGCATGAAGTATCTGCTTGATTGTTGGGGATCTCTTTCCAAGCCCCTTTACAATTATCAGTAAATTTCTGATGTGGTTGGGAAGAGTAGGTACTAGAGTATAATAAGCTGCCTCTGGTCGTGACTAAAATACAGTTTTGGTCAATACGTGATTCTCTTACAATGTTGCCATCTACTATTCTCTTGAAACCATCCACTCTTTGCAGTGGCTCTCATGGATGCATTATCTTCTGGCCTTCTGTGTACCATCCCCAACTTGAGTCTCCTAGTTTTTTTGTTAGTCTTCAAAATTGCTTGATATTGTTGTGTTCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGTATGTTTTGTCACTTAGTTTCACACTTTACGCGGAGTTCAAGTTTGTGTCGTATACTTGGTGGTTTGCATGTTGTCCATTTATAACTGGAGAGAGGATCTATTCTGGACTTGACCACTCATTTCACTATTTACTATTATTGAAGTGATTGTGGAGGATTATCATGGGGTTGATACTGATCTTTCGTTCACTTGAGTCTTCACTGTCGAAATCATGATTTAGATGTTTTGGTATGATCAAACTGAATGTAGTCAACGCATCTTCGTCTTCTGAGATTAAATTTGCGATGGATGATGCGAGTTACATACATGCAGTATATCCTGAAAAGAACGCTAGAATTGATTGTGTGACTTCCCGTTGTGCAGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTAGAGTTTCATAGAGGTGGTCTTTATTGTGTGCTAAAATCTTATAACGTATAAATATGTGATCAGACCTAGCATGGTTGTTGCTTGATTTAGCTATGTTGTTAAAGAAATCATACACTGTCCAAAAGTTCTAGCGAGAGCATGCATCAAGTACAAAGCATTAGATTCAACCTTTAACCCATTTTATTTTCATTTTCTCGCAAGGCGCAGATAATTGAAAATTTTACCTTTGTATTTTTTCAAAGTAGCAAGAGTTCACAACCTTTAGGCTGAATCCGTTCTTTGAATTGATCGTAAATGATGAAGTGTGAAGTGCATAGGGGTTAGAATTTATTGCCTAATCGAAGACAAGTAATTTCTTTTTTCCTGTTTGTGTTTTTGGGATTACTTACAGTTATTCTCCTTTATATTGCTGAGTTTTAGAATTGTCTGTTCCAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGTTTGTTTTAATGCTCGAATATTCAGGGGAATAACACACTCAGCTGAGATCTTGATAGTTGTCTCAGTTTAGTCGTCCTTTTGTTGCTGTTAACTTGAGCATGTGGTTTGCAAGTTAGAGTGTTCAAAGGAAGGTCGTCGTAGGTTGATCTAGAAATCTGGGAGATGATCGCGAAGACAATGTCTGCAAACTTCATCAGAATCAAGTCAGAAATAGAGGAGCTAATTTTCTCGAGCAATATTTCCATTTTCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGTACGTCGTGCGTAATGAACCATGTTGACCTCCTTGGACGAATGGACGGAATGACCTTGAAGTAGTCAACCAGAACTTATTCAGAAGGCTTTCTCTGTTTTGGTGCTGATCAATTTCTTCGATGTCGACATGTCTTTATGAAATGCAATGGCCATCGTTGATCAACAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGTGAGGTCCTATATGCTTCTCTAAGCATTTGGGTGGTTTCTTGAGCAAAGGACGCAGCTATGTTTTGAGGTCCCTTCTTGTCTTTCTAACCGCCGAGTACAATTGGCTGGTTCCGTGAGCTCAGCACCTCGCTATCTGTTGTATCTTTCTTGTTTCTCCTTCAACGTGAAGATGATGGTTCAGATTTAATCCGGTCATGTTCTTCACAATTCTTATTTCTTGCTGAGTTTGTCTTTACGTCATACAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGGTAAGGAGTTTAGAAGAAACCGTCAGTAGGAAGCTGTCTAGTGATATTGATTCACACCTTGATTATTGTTATATTTACCTGATAAATTCTGTTGTTTCCGCTTTTGAGAATTGTGTTTAAAGTACACAGTCTGAACCTCATTTTCTTTTGCCTTCGATGGACAAACTTATTTCTATGTTTTTGACAGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACGTAAGTAAAAGACAGAACTAGCTAAGACAAAAGTTTCTGCAAGTCTGGGGTTGTTTATTTTATTACAATTACATGATGTGCAAGTTGACTTTTGGAAAAACTTTTCGAGATCAATCGCTCACTCTGTGTCTTAACGTCTGTTGAATATAGTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGTGAGCTTTCCAATTCTGTTATTCTGTTTTTCTTCTCTTGACCAGCTTGCCGCCAAAGCTGCGTGGTGAACTTTCATTTCTTGTAAAGAGACATCGAGAACTGATTCATTTGGACAATATAAAGCAAAAGGCAGTATGAGTAGTGGTCGGAGTCGGTGATGGCAGTCTTTGCCACCTCATATTCTGAGTTTTCACGGGATTACAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGGTAACTATCTAGTCTGAACGCCCTTGAGGATAACCACGAGGACGTATTCGATGCTTAAGTAAATGATAACCTCTTGCATATTTTACTCATTCATGTGGCCGTTATCCCAACCCTGTTGTATTATAGGAGTATCTGAAATTTGATTCTTTCTTTCATGACCTTTACAGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGGTAATTACATGCCAAACGTAGTAAGCTCTAGCTTCACAGCTTGTGTGGTCAAACCGCCTGGATGTTCTCTGTATGTAGGTAGTCCCATTTGTCAAAAACACGCAACAAATCTGCCGAGGAAAGTAGAACAACAATGCAATATTTACGTATTCTTGTTAGAAATTAGACACGTTTTACATTTATATTTTTTCAAGGAAAGTTGATCTCATGATTTCAAGCTTGCTTCGTTGTTTTTAACCCACATTCATCTTGAATTGAATACATTTTCTGGTTTAAGTGCTAAAACTTGGTGGGAAAAATCTAATTTGTTCTTCCTGGGAACAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGGC

mRNA

>Mapoly0075s0051.9
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAACAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGGC

CDS

>Mapoly0075s0051.9
ATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAACAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGAATTTGCTTCATGTACTCGTCACTTGA

Protein

>Mapoly0075s0051.9
MGAGAGAAAAIENEPSPRRAAIEKAQAELRREVAVREERRRELEFLEKGGELLDFFSAANFALPPSSPTDPLADQLLSSEGEGGHASVALTNGDSVENSVGTSLCVGRSSEGGGDLCPGEDFLSAVIEPLTPWEGKGRASRTGSTSLRSHSDVNLKRESEGSGGGRAAVKGQAYSRRNRPRSNRFGNGHTPTRDVEKAGEVGVLPSIEIKGSPAPPVIFEEVTEENETMVDKKLQVLPAPTLLYNSHASTQLGPVTTKVIEDLEATHLPTGKSFEQNSVKAVHAADDALQTGREFQIHDLAASSCGSLQRSSDLREDVCTGIVVKDELVVVGDLKKVDQTSLSPHVEKNVDSRDGGAVSQPSEQVLGNNQAASDKACGLPSMVEDESAIVMIMDESLGSRTSKNECKDKSTVVSETKGDRVIDRSTIITKHGPDSMLTPTIDDKTSVLREVSCTMQLTPKSLDTSENKSIISRKTTSTASSGAPDLIQNDKARIDDPPSDARVEVKVEEGLSEVGTRLSTVDTQVESGHDVKSICVVSLPQEEIKSESQSTPVSAGSNRAGFRTPNSNTASINKFPGVVLPWEKERDPNVRAEAERHKADLSAKARKAHEDYILEEAEIIKKSKKDTAEWAKRSPHLEPARRKSHWDYLLQEMAWMANDFMQERLWKLASATQFCRWIAEQRGQSSVLQLAGIKQRQERVARVLANAINEFWRSVEYIIHKDKRLTLSSLENQESVVAMKEDSEAVPMDVDIPSIPEGSTQRVEKLPSRSRKPLPVQNYAIRFLKESMGSDVGAQAEAPCTPERISEANSVLDPLWEDQFPEEPLFYLVPDGASRAYRILIETERSSLEIEHEQTLHDHAAAIADAEAVAEAAANADFNVSLSVGEGQPLSVLSSPMKGLRAEEDELGGQFLPNALSSIAKKKRKNILKSNASKGEGISSSGPTHRPPIAPGLDSTAVVQSPLVTGKRSLSVGPGNIVGNVGSIPTKRMRSVSSARQRVMGTASPNSFPSPGGLLQRTIFSSGALNSHQDEVRNLCDDTATRIEADATTVSVKNGLGAGCNNSFVNSKSKKKKKTKHFSGQLSSVNAVKGDGAPSVNTASSTKQTPEAEHRSVFDQLKRKGDQVNAASVELDTGGIGSSADTPETPSSQGQQPSKKAKVSKQASDLNPEAAAAAISTAATQSGSLVANTSSTSKLLRQNSNRDRNRKTKSTKVPLTQPAGIGIPWSTIEDQAIFALVHDLGPNWELVSDVLSSSSQLKGIFRKPKQCKERYKSLLDRMSVGEGGDSPEDPSTSQPHPSTLPGIPKGSARVLLQRIQGPMEEDTLKVHLEHIVRVVHKFRALKPPTEEQKLLVQPHASHLNAITQFCANGYPTPSDLCEITAAAPELGGPAYQLPGQHLPGVLAAGSGIRPATNGLPVLPSASNLHMGVPAVAPSTTAASAARDAAVYRDVHRLAAIRPFSPEDAQRVRYHRAMAAARGLSVSGPTVTAGLPMMGLPSPSDCPVPLLGSGNNNIGMMGGISRGMSLSRPGLPGMGSPGVPGIGPPPLGSVLSTGGVGIVSAGPTVGPTVVPQQVNLIRRSREQQLVRPGRSNEDQRRFIEELKHQAAQGNTQAATALSSLGSEVTREMMAVQAQPFQQLQHQNHQQQQQQQQYLAARMAKERQMQQQQKQRLLQQQLQQPQQPSSLQPQLQTQMQQQQMHGMSQQHVLPQQSHLSQQQHLLSSQQHNLQKQQSQQGPQQTGTLSSPSLQPTTIPSMQSNHQQHQTLLQPQQQAPPLGQVQQLPVQSKLQPPKQAQKHPHLQQASQVVQQQPPRGSKGVVRGNMLVQALPGSGQSSMLPGNVSAGSQPQQVAGQQIAHSMQGQRHLMPLAKPLSQTSTQVMTGQSAHMQAQQNQSMAGPVPQGSLGGSQKVVSQQPTQLGTMPSKQLQPSPLPSALPSQQQSPAPPLPTQQQQTSPPAAQQPQIGSSQQLQVQQRRPSQQAQIQSAQRRIQQRQPVASVGAPMIGVLGKNGSSTQQGQVPAQMSSQPGHVTYTQGSSMAVPMSMMSASSGASGLSSSGSPSSSGVHSTPWKPGQVVSPMSSGFYNLSRSGSPGAAQLPSIVSSSGMHLASSNGNSGMSITGSGPPHGVIVGSLSQPLQVGSGGHGLKMGLVTGSNPRGVSTTLQGGTQRSIQHHGNLPASPAIGATQQVRSPVPASSAGMMPVSALGTNTVAGVSSSGSMAYQANSSSLSGHSTAISNSMHMFSVQPRQSHAGSAAATTPAVPMKSPPTSGTSQTSAVSPSSPAPNLLHVLVT

Mapoly0075s0051.10  

Gene structure:

mRNA scaffold_75:641575..665394  ( - strand )
three_prime_UTR scaffold_75:641575..641992  ( - strand )
CDS scaffold_75:641993..642115  ( - strand )
CDS scaffold_75:642627..642743  ( - strand )
CDS scaffold_75:643068..645041  ( - strand )
CDS scaffold_75:645209..645623  ( - strand )
CDS scaffold_75:645847..646056  ( - strand )
CDS scaffold_75:646207..646289  ( - strand )
CDS scaffold_75:646477..646593  ( - strand )
CDS scaffold_75:646841..646981  ( - strand )
CDS scaffold_75:647150..647230  ( - strand )
CDS scaffold_75:647484..647540  ( - strand )
CDS scaffold_75:647979..648205  ( - strand )
CDS scaffold_75:648571..648631  ( - strand )
CDS scaffold_75:648986..649021  ( - strand )
CDS scaffold_75:649169..649927  ( - strand )
CDS scaffold_75:650089..650172  ( - strand )
CDS scaffold_75:650380..650574  ( - strand )
CDS scaffold_75:657671..657955  ( - strand )
CDS scaffold_75:661720..661842  ( - strand )
CDS scaffold_75:662002..663628  ( - strand )
CDS scaffold_75:663929..664020  ( - strand )
CDS scaffold_75:664281..664335  ( - strand )
CDS scaffold_75:664437..664525  ( - strand )
five_prime_UTR scaffold_75:664526..664680  ( - strand )
five_prime_UTR scaffold_75:664916..665394  ( - strand )

Sequences:

Gene

>Mapoly0075s0051.10
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTATGAATTTAGGGTTCGCAGAGAGATAGGAAAAGGCTTTGTTTGCAAAATATGTGAGTGCTATATTTTCGCTTGCGAAGAGTGAGTTTGATCGATCGAAAAGCACTGACCCTTTCTAACGCGATAAATTCGCTAGAAACAATACTGTTTTTTTTGGGGTATTTGTTTTCGTATTATTTTTCCCCGACGTTTTTCTCGCTTGGTTACGACTCTGTGGATTTGTGCAATTTGGCAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGGTTGGGCGTTGTATCACTGTACTATGGAACACTCGGCAATTTCAATTGCTTTACTTGCATTTCACTTAGAAAGTAACCTCTTGGTCTTTGGTTGGTCACAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGTATGTTTACTGTATTGTAGCTTGCTTAGTTTTTTGAACGAAGAAGTTTCAAATGTTTAGATTTTTAAAAAATATAATTAAGTGCATGTATTTAGCTCAACTTGCAAATTACAGAGAGGTAGATCTTGATGGTTTAGTGTCATCACTAGTGTTTTAAGTTGCACAGGCTGTTCAAAAGTGGAATCTGAATACGTTGTTTTCTGTATCCATTTTGTTTGCTTTTCTTTCTGCTTATGTTCTCAATAAGCTTATTCGTGCAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGGTTCTTACATGACTTGGATTGCTTATGAAGATGGAAATTTTTAAGAGCACTAGAAGAGTGTAGAACTTTCACTATTGACTGCCTATGTATTTTCGACGTTGACTGTTGAGGTGTATTTGTGAATTGATCTGTTCAAAAGTGTTCATTCGAGCCCAAGTTACTGTCAAATCAAAGGGCCTCGTTGTACCGTTCAGGTTATGTCTACGTGTAGTTTTTGCAGACGATGGTTGTGAAGAAAACAAGTGTTGCCTATACATTGTGCATAAGACAGAATTGACCTCACATATGTCTTTTTGGCAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGGTACTGTGGATGTGTTCTTCCTCATGAGTTTATACATTGAAGGTCTAACTAGTGTTCATGGTTCAAGCTCGGCGCTTTCTGGTTTCTTCTCAATTGTCAAGTTATGATTTCAGTACAAGTCTCAACTACTAATGAGTTCAGATTTGATATATTTCCCAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGTGCATTTCTTCCTTTGATTGTGTTATAGTAGTCTCTCTCGTTTTGGAACTGGGATGGTTCATGTACGCTTTTGCGTTAAGCATGCGCAAGAACTTTCTCTTATCCCACAAGTTTGATGTTAACTAGTCATTGATACTACATAGTCACATACATTTTCTGACTACCAAGCTATCGATTTACATTTTTCTTCCATTGGCAAGTTAGCGTCGCGTACTCTCAACCTCCATCGAACTCCAGTGTATGAAAGATCTTTTCTTTGGGCTGCATCTAGGTTGCATCCAGTCGTTGTATTCACAACAGAATTTAATGGAGTGGAACATATTTCAACCATAGTCCCGCTAATCGCATTGAGAACTTTACTTGATATTGCTGGGCAAATATTGTATTGTATATCAAAACAATTAGTAAAAGAAAATTAACAGGGGAACTCTAGAGTTCTAAGACAACAGCTCTCCCTATCAAGATCATTTGCGCATGATCATGTACGTCAATACTCCTAGTGTTTTGTTAAAGTGTCCAGAACTGTAAGTCATTAAAGTTTCTCATTCTCATTACCATTGTTTCAGTCCTGTACTAGACACGGACTCTGTCAAAATCGTTGAACGTATTCACTTGAAAATAGTCACTGTATTTAGCTGTTTAACGCCAGCCTTAGCTGGTTTCATCCACCGGATATCGGTGGCCGTATTTTTCTCGCCCGAGCCTATCGACCCCCCGGCTATGTAACAATTGTGGTCATGAATCCAGCGTTGCTAGTGGAGTCCAAGAGTTGTGTTTTACCCTACTCCTGGAACGAGTAGGAGATGAGTAGTAATTGCTTGTGAACCATGCGGTTGATCATGCACGTGATAGCTCCTAGTGTTTTGGTAAAGTTTATGGAACTGTATATCCTAAGCTTATCTTATCATATTTACCATTGTTTCAGTCTCCTGTACTACACGGGATGGTTGAACATCGTTGAACGTATTCGCTTGAAAGTACACACTTCAACAGTTTCACACCAGACAGTTCTGCTTTTATCCATTGTAATATTGATGGCTTTGATTGTCGCGCCCGAGCCATATCAGACACGGTCAGAGCCATGTAGCCAATGTGCTCATGATTTTAGCGTTGCTAGTGGAGTCCAAGCGTTGGAATTTACACAATTCTTGGAAAGAGAAGAAGAAGAGTATTCCTTGCGTGTTAACCTTGCGGTTGATCATGTACATCGTAGCTCCCAGTGTTTTGGTAAAGTTTCTGGTACTGCTAAAAAGTTTCTCATTTTTATTACCATTGTTACAATCCTGCTGTACCAGAGACCGGATGGGGGAAAATCGTTGAACGCACTCGCTTGAAGGTAGGCACGTCAAGTGTTTTATGCCAGACACCGTTGCTTTTATCCATTGGATATCGATGCTCGTAATCCTTGCACCCAAGCCTTATAGACCTGGTCACGACCATGCAGCTGATGTGGTCATGATTCTAGGGTAGCTAGTGGAGTCCAAGAGTTGTGTTTCATGCAACTTTGGGAAGGGAGAAAATTACTTGATGGGACCCCTGCGGAACACAAAAGACTTGCTGATACACAACACGATTCATTTTACCAGATGGGACCACCCTACGGCCATGCAGCATTGGGTGACGTATCGGGTGACGGCAGCCCACCGTCACCCAATACGAGTTCTGGGTTAGGTACAACCAGTGGGTGGATCAATCAGAAACTTTGACTCCAGTCCTTTGAAAGAAACAGCCCCTAACTTAAGTCCCTCAAGTCCTCACGAAGTTAAGCGGTAACGGTACACAACATAAATTTGACAGTAACAGTAACTACATTCCTTCTGATAGACATACGCATGGGGACTTCGATCTCGTTTGCAACGTTATGATACCAACATAACAGCATCATGGTCTTGAGTTTGATGATTGCAACGCAATTTTCTGAAAGAAGCTACATCCAAAGATGTCGAAAGTTTACACTGCAAGTTAGCTTACTTAGTGTATCGGTTGTGAATCCTTTCAAACACAGTTTCTACTTGTATGCAAGCGACGCTCCCATCGCATCCGTCAGAGGCTTCATCAAGAGATCATTCCTTGCACAGACGAGACCCTCAATCTGGAATCTCTGCTTTGCGTGTAAGTTCAGTAAAGTTCCTGGAGCCCCTGGGTCCCAAGCTTTCGTCTGGGGATGCTGGAAGATTCTGCCATGGCTACACAAAGCTTGATTATCGTTCCTACTACTGTCAGGCTCACTGAATTGATCGTGAACAAAGTTCAGTGATGACGCTAAGGAATCACTGAATTGTGACGGGTTTTGCTGCACCTCAAGATAGTTATACGCTCTTTTCATACAGGGATTACAAGCACTGTGCCCTTTTGGCGTGGTTGATTGACCTCTTATAAGTAACCCAAAGTGAATCGATTTCCACGCAATGCAAATTCTTCATTCTGTCATATTGAGCCAGCCTATTCCTAGACTGGTTCTTCGTTCTTATTCGACGTGGTGGAAGGACGTAGGTATTCCATCTGGTAAAATGAATCGTGTTGGGTCCCAGCAAAAGCATTTGCTGGTACCCAACACTCCGGTGGTGCAGGCTTTACTCCGGTGGAAGTAACGGCCGTATACACTTCTCATCCCATGATGCATCTCACGGATAGAAGTGCAGAACTGTATCTACATCGGTCCTCTTCTAATGCAGATTACACTGGAACAGCTACGAGAGACTTTCTCTCCCTCACACACAACTCGACTTCTAACTTTCGTTTTTATTGACCTTTGTTTATGCATATCGTAGAGGTATTACCCTTCAGTTGTAAATATAGAGTTTTCCTTATCAGTTTTGATCAGGTTGTGTCTGCGAGATATCTTCTAATATTTGGTCAATAGCGCACAGAAAAACAAAAAAAAACATGTGAATATTGTTGAGCTTCACTCGTGTGTTTCAAATTAACCTCTGGGTAGCTAAGTTAAGTTTAGTTAGCTCACCGCCTGGAGTGGGGTATTTAACCCCAGATCTTCTCGACTGTAATCACTCTCTTCACATGTTAACTATATGCGCTGTATTGCACGCGCTCACTTTGACTGCACAACTATGTTGTGATTTCACCGTAGATGCTTAGAGTCACTGCGATCAGGTCTTCAAAATCGGACCCGCTCAGATCTTGCTGTACAGATTCACATCAACCGTGTACTGGAGATAGACAAACGATCCAAGGACGCATGGAAGCATATCGCTTTTGAGACAATTAGGTCTGAGGTCAGAAGCCCATATTCTAAGGGGTCAGTCCTACAAGGGCGAGTGGAAGGGGTTGAAAGGTCTGAAAACAGTAAGCACATCTAATTATAAGGCAGATAATGGATGGAGAAGAATTCTTGTGTGATGTGGTTTTAGTTCATTGCCACGCAAAAGGTAAAATCAGCTACATACCCCGTGAGACATCTACCAGCCAATCAAAGACACCACATGTTTGACAGTCTAATATTCGTGGATACATCTTGTTGATGTTTGTAGGTTAATCCTCGTAGTTTCATAGTATATCTTTCTGACTTATGGTGAACTAATAAATACATGTTATGGTGCTTTCCTCTAAATTCGTCTTTTTACTCAACACAGTGCTATCTTGCTCTTATGTATTATTGCTCTACCATGCGTTTCTATGTGGGCAATGCCTGTTTTTTTTACGTGGATGTGTTGGAGAACACATTTTGTAACTCACAAATTAAATTTAAGCTATACCATGTTCGGATTTAAGAATATAATGCATGGTTGTATTGTTCTGATCGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGTATTCTTTCTTGATATACATAGTGATCTATTTTGTTTCAATTTGATTCAGCTCAACATCCCCATCCATAGTAACGGAAATTGATTCCATTTTACATGGTGGACTTAACATATTGACTAGATTGTATTTCCTTCATATTGGGAGTAATTACAATTCGTTCTCACAAGTTTGATTATTTTCGTGTTCAGCATTACATTGATCACTCTTATAGTCAACTTCATGAATCCGTACTAAGAGCAATCAATGCAACTTTCTTCCACCTAAGTACTCGAGTCATCCGGTGATATATTGAATCCTTCTGTTATTGAGTGTGGTTGTTTGTGGTCTGGTTTGGTCAAGTATTGTGAGCTTCTTGTTGCTTCATTTTGATTTTTAATAAAAAAATGTCTTATATTAAACTTCTGATCGATCACTTGTTTGTTTGAATGTAGAATATAGTTTAACTTGACTAAATAAAGATATGGCTGTATATGTTGTAGGAAATTTTGAACACTATATTGGCCTTTCAATCATGTTATGTGAAGGATTGGAATTCATCAAAGTCGCTTATTTTAATTCGCTATAATTCATAGTTTAGGCAAAAACAGTGTTTAGTGTCGGTGGTGGTCATATTGATACTTGTGGAATATTTTAGTATTGTGTGATCGTTATCGTGGTCTGTTTGTTATTCTGAATTTTTGGTTGAACTTGGTCAGATTCGGTTGGATGAATCTTTACAGAAATTGTAGAAAGGTAGTGTAAAAAGGTCGGTTAGATTCATCTAACCTGAAGACATTGGAGGTAAGGTCTGGATATGAGATTAACCTTCCCTTGATGGAATTAATATGAGATGTTGACTGAGGTGTTGTTTTTTTTAGATATTGAGATCTTGGTTCATACCTTTTTCTTGCTAGAATGTCCCGCTCTTCCTTCCTATCTTCTATAGTTGACTAGTTGTTACAATTCTCATATACAACTTTGCTGTAAAGTGCTTGGTAGATCATATCACAATATTGAAACTGATAGAATGGATTGATCAATATGTCTTATGGTGAATGTCATAATATTCGTCATGATCATGACTGGTATGATGATTCAGTAGTAATCAGTAGTAATCGTGCGGAAATTGTCGCGGTAGGATTCGTTTACATTTTCGCGTTTGTAGGTGTATTTCTAGACCCCATGTATCCAACTCGAACCAGAATGTTATGATGGGTATTTGTTTGGTATTTATAATGACTTTATGTGTTGAATTTGGTGGTCCTAGAAAACAAAATTTAATTCAACCTATTTTTGTTCAATGATAATTAACTCCCAATATTATGGTAGGAAAAACTGCGCGTGTAGATATAGGTATTTTATTATTCCTTCTTGGATTTAAGTTAGTTAAATATACCAATTTGACATTTACATTCATGTAATCCTCCCATCAAAAACAGACACAAGATCATGTCGTGTCATCGATGCAGTAATCCATGCAGCCAGATATACGAGATAAACACAAATTGTAGAGTGCTGCAATAATTCATCCTTCGAGCATTCTTTATTCTAGAGAGCTGCAAGAATTCTCTGCTTTTGGGCTGATTATACAATCCTTATATTGAATTATTACTTCTCATTTGGAATACACTGTGTGCACTACATGGAATTCCAGTCGAGTTTTGCGTGAGATAAGCTAATAGCAAACCTGGAGGTTGACTATGTTCTGAGTTTGAAGATCATATATATATATCACTCTCTCTCGACTTTTATATTGCGAGTTGTACAAATTTTGTTTTCAATACGATAAAAAACTGTATTTTCAGATATAACTAGATCCAACTACTAAAACACACAAGTTTACCACCCTTATATCTGCGCATACCAATACTTCCTAGAAGTCCAACTTAGAAGTAAAGAAGATTGTAATTTTTAGAATTCCAACTTATAAATAAAGAAGATTGTAATACCTCTATGTAGACAAAATCATATTTGTGCTCTAGTTATCTTTCAAATTTAACATACTTGATATAAAAAAGGGATGTTAAATTCACCCCGAGTTGTTAAATTCACCCCGTCACTTTTCATGGCAACAAGACATGTCAGAAATTATTGTTTCTTCTCGTCGCGTCGAGGATTGGTTTCGGACTCTCTTTCTCATTTTCTTTTTCTCCACTGTGCACAAGCTGCTTTCTGTGGTGATTCTTGATATGCATATGGAGGAAATAACGGAATCGGCTGCTGCATGGTTTATTGTCCGAAAGTATCGTGCTGGATCTTAGAGCTGAATCTGCCCTTGGATGTGACCCTGATCAAATTTAAAAGAGATACTGACTAAATTCAGAAGAGAGATGCAACGTGTGAGAACTTGGGTGATGAATTTAACAATCACCAATATAAATATATCAATATATAAATTTCATCAAGTCCAACGATGTACCGAGAGTGTAAACCTCTCTCTTCTCTCTTCGTTTCTCTTGTGTACATATGACAATAAGCACTTGGTTTAGTAGGTATGGAGAAACACTCTCTTGTACTGCATTTTTCATTTTGATTCACGCGCATAATTATATTTTTATTAACTAGATAAGATCTAATTTTTTACATAAATGAAATCTATCCTCCCATAATGATGATGTGGTTTTCTTCTCCACCTTAACTTTCCAACTTTCTCAAAGCTACTTTGAAGACTTAAGTTTATATTAGTGAATGGAATAGTAAGCTTTCAGTTACAATTTCATTGATGCCGGTCACTCTTGTAAGAGACCTATCATGTCGACAATTAAATAGTTCCTACTATTTATCTCATTTTCATCTCCTTGTTTTTATGTGTATGCAATAAAATGTAGTCATGGTTTGTTTACCCTAGCTGGCATTTGTGATCATTGATTCTCTTGCATGTTACATCTCAACGATCTAAACCTTTAAAGTAACGTAGTTAGACTAGAACACAGTATCCTACTCAGATTTGGAAAAGACTGGCTGAAAGATAGAATTGTAATGGTTGCAAATGGGAATGGTATGTAGTAAATTCAGTAGATATTAGTCATCGAGATTGAGTGCAAAGCATTATATCCTTTGGGTATCTTGAAATAAGTGATGTTCTTGGGGAGTTCAACTCCTTCTTCGAGTCCGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGAAGCACATGAACATCAGAGTGATCCCGTGGCATACTGTCGATAGATTCATCTATACATTTTTCACATAAAAATCTGGATGATAAGCATTATATCCTGCTCTAGCTGGTGCAACACATCAACAACAGAGTGATCCCGTGGCATACTGTCGATAGATTCATGTATACATTTTTCACATAAAAATCTAGATGCAAAGCATTATATACTTTGGGGATCTTGAAATAAGTGATGTTACTGGGGAGTTCAACAGCTTCTTCGAGTCGGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGCAGCACATCAACAACATATAGATTTTTCACATAAAAATCTGGATGCATGGGAATAGAATGATGACTTTATAATAATCTTTTCCATTAGATTCTTGATTTGAAAAAATGATTCATAGGGAATGGTTCTTGGAAATCTGACTATAATATTTTTTTTGGAAATCTGACTAATATTTCAGAAAACTCTACCGTCACTAGGAGTGACACGGTAGAGTTTTCTGAAGAACTGTTTGTTCACTTGCTGAACAAACAGTTAGCACTAAACAACATCAGTGAGCACTAAACAACAGGCTTTTTCTTGCATGATACTAGATATTGCATACTATTGACTGCGGTTGAAACTAATCCCAACAATTTTTTTTGGTTTGAAATTCAACCATACTTTAAATATTCGCTAATTTACTGTTCGGTCCCTCTCGCTCCTCTCGCTCCCCTTCCCTTCGATTCCTGTCCGTAGCACCCCTCGCCTCTTTCCTCTTGTGGGTGGAGTGAGTGGGGGCGCCAGGCGAGCACGAGACAGGATCAGACCAGAGTGGGTGCGGTGTTCCTGTCAGAAGGTTTCTTCCTTTCCACTGCTCTGTTCTTCTCTGCTCCTCCCTCTGCTCCGTTCCGTCATCCTCTTCATCTTCTTCCTCTTCCTCTCCTTCTCCTGCCGCTGCTGCATCTTGAAAATCCGTCCGGAGTAAGGTCGCGAGTTAGGCTGCGCGTAGTTTTATATGTGGACGGTGGGGGAAGTTTTTCCAGCTCGAACGGAGATCCTCGCGGGGCTTCTTGAGCTTCATTTCGATCACTGGTGAGCGTCTAGCTCTGTACTGACCACTTTCCTGTGATGTTGATGATAATGATGATTATCACTCAAGTCTGTGTCTGTCGCTGGGTCGTTTGTCTGAGTTCCCTGCGGTCACTCTTGACTCCATAAGGTGCCAGTGCGGGGGTGTGCACTCAGTATAGTATAGGATGCTGCGATGATTGGGAAAAGAAACGAAGAGTGGAAATGGAAAAGCTTGGCTCGAAATCTCCCTGGCGCCGTTGCCTCTGCTCTGATTTCTTTCTCGAATCAACTGTGTGTATTCTTGATATGTTCGTCTCTTAGAACATCTTTTCTGAGAGCATCCCGTCTGTTTGCTGAGTTTCTTCCTATGTTGGCATCATGGCTTAGGATTCTGTGATTTCTCTTCCTCCGATCCTATTCTTGTATTATAGCTTTTAATCTTCCCTGGCTCGCTCGCTCTCTCCCTCCTTGTTTTGTGATGCTAGTTTTGCTAGGGGTGTGTAGATTAATGATGTTGTTAAGTTCTTAGTTTGCACAATATTGCAGTATTTTCATCCTTGGTTTTGGAGTAGTACATTTACATTCTTCATTACAATTGTGCTTAAATTACCATTAACAACTAGACTGAGTATCCAATTCTTCTGTTTTGTGTTTGGGATTGAAGTAATTGTTAATTTTCTTGACAATTGATAGGGATTGTAATATTGAGTCCCATAGTGAATTGCATAAGATCCATAGTGAATTATAAATGAATATATATACTGTTCAAGATACAGTCAATATACGTATTTGTAAATCACCATGGGTCGATTGAGATGCAATGCTTTTAATGCATTTACAAAATTAAATATTTCTCAAATTTCACCTCAATTTTCTATCAAGTTTTTATTTGCTGATGGTATCAATTGATTATGTCATTTCTTACCATAGACAGTATCAAAGTAATGGGTTATATCTTATGGTTTTCTTATCTTTAGCGATCAAATTTTTTTTTAAACTTCTCAATACTTATAGATGCTTTGTTGAACATATTTAATCGTGGTGAATGAATATGTACGCTTCAAAATGTAGGCTTCGCAACTAACGGATAATATTTTGTTTCAGACCAATCTTTGAAATCTCTGCTTTGTATATGAAATCTGCTTATATTTTATATAGGGGAATGTTAAAACAACCACATAAATTGTTCACATGATTTGTCAAAAACAATTTTTTTCGCATAAAAGCTCAAATATCAGCTGCGAGTGTGTTTTTGACTTCCCCCTCCTTCCTGTGCAAAAAACACCTTCAGAGTTGTTATCTCACAGGGATCATTGCAATAGTTTCAGTCAGTAGTCAATAGTCATTGTTCTTGAAGTGTGTACGTAGAAGTTTGATTGTGTCTTCTGCATATATGCAGCAATATGTAACAAAAATATGCTTGGAGATGATACTTGGGCTTGTGTGCGAAATATCAATTTTTGACAGGAGACTCGTCCGTGGTAGTTTTAACATTGGATGTGATCGTTTAACATTCCCCTTTGTATATTGCTTAACCCATTATGTTGGAACTTTTTCCAACATAATTGTTTGATAGTTTGAACAGATAGGCGAAATTGAAATCCTTTTTTCCCTTGGTTGAAGATTTTATTTTTACTCTCTCTGATCTCTATGCTTCTCATTCAAAGGTCTGGGTATATGAAAGGTAATCCGTTTAGGATTTATATGGATATATCTGAATGAATGCCTCCACGGGGTAGTATTTAGATAACAATCTTGTAATTTACATAATAACATTGTAATCATCATGTTTTCATTGGTTTGGTAATATCAATAATATAGCTAATAATAGTTTGATAGCAAGAACATGAAGTAATGCGACATCAGATGCTACTGGTATTTGTATATCGGTGCGGAAATTGTATGTGATGTATGACGTATCTCATATTACAGTAGCCTCCCGTTTGAACGGGAGGCTACTGTAATATGCATCAATAGTACGCATCATTTTCCCCAAAAAATAGTTCCAAAAAATAGGGTTCAGATTTATTTAGTTCAACGTGTCATATATTTTCATTTGGCGCAAGTTTTGAAGATTCTTGCGTTTGAAACCTGATTTTTGGTATATATTTTCGGCATTAGAAGGCTGTATTTGGGTAGTAAGCCATAAAACATAAGCGAGTATCTTCCGTATTGTATAAGTTTTTAGCACCATATTGGTAGTCTAAGGCTTCCAGCAATCCATGATTGGATTTGTTGAATTAAGCTCTCTCTTCGTGAAGCATCACCTTTTGCAACCCTCGGCGATTTGTGATTGACTGAGACATCAGCCATTACCATGATTCCTTAAACTCTGTTTCTGAAATGGGTAAACTCAATGCAATACTTTTCGCTTTGGCGACGGCGGAATAGATAGATTGGACGTATTCTGTATTAACAGAATGGTAAGCATGTCTTTTAGCTTGGTGAAACAACCAACACAGGATTGAAAAGTGTTATCTTTAGCTTCATAGATATCAAGACAGATCGCTTTAGGGTTTGCTCACACATTTCTGATAGCTGCTTCACTAGCATCGGGCCAGAGCCCTTTTACTGGGAGTATCGTGGTAAGTTTTCAAATGATCGATAAGAGCTGGTTGGTGTTTCCAGGTTGTTTACCCTAGTGATAACTATCTGAGATAAATTAAGTATGGAGTTTTCATCATCCTCATCAGATTTTGTTGTTTCGAGCTTTTTCAAGTGCTCTTGTATTAGTCCCGTCACCACTTCAGCTGGCTAGCTTCAAATATTTGCCGAAGCCATACAGTAAGACAGAAAAATATGCAACTCCACTATCTCTTCTAGTTACTTAATTGGGTCAAGTGGCCTCCATTCCTCGGATTTTTAACCGAGAATCATCTCATATGCAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGTATGTTTGGATTATATGCGACCTCATCCATGCTTGTAAGTCCTTATCATTTGGTTGCAAGTTTGGTTATGGTGAAGAGTCCATACTCCTGGTGGTTATGGTGAACAATGGCAGTATAACAGTACAATCATTAATGCTCAAGTTGAATATTGAACTGCATGTAATCTCCTGATAACCTGCTCCTTTGGTTGGTTTTTTTGGGTTCAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGTAAGCTTTCCGTGGGCTTTATCATTCTTCTCGACATTGATCAGTTATATGCTGAAGTTGTTACTTGGTGTTCATGATTTCCAAATTCGAGCAATGTCTTGGATCCGCACGAAGGTGTTCATTTAAACATCACTCGATGTTTCTTTTTTTGTTTATTGTAGGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAGTACGTCAAATGGGCTTCTTATCTACTAGTCTTTGTCTATCAGTGTATCATATTTCTCCGTGTGGAATCTCTGCTACACTTACAACGATAGGACTCCTTGACAACACTACTTCATGCTACTAATGTGTTTGGCTTTATGTTCAGCAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGGTTGGTTTTGTCTTGGAGACTGCCCTAACATTTCGACATGGTTGCATGAAGTATCTGCTTGATTGTTGGGGATCTCTTTCCAAGCCCCTTTACAATTATCAGTAAATTTCTGATGTGGTTGGGAAGAGTAGGTACTAGAGTATAATAAGCTGCCTCTGGTCGTGACTAAAATACAGTTTTGGTCAATACGTGATTCTCTTACAATGTTGCCATCTACTATTCTCTTGAAACCATCCACTCTTTGCAGTGGCTCTCATGGATGCATTATCTTCTGGCCTTCTGTGTACCATCCCCAACTTGAGTCTCCTAGTTTTTTTGTTAGTCTTCAAAATTGCTTGATATTGTTGTGTTCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGTATGTTTTGTCACTTAGTTTCACACTTTACGCGGAGTTCAAGTTTGTGTCGTATACTTGGTGGTTTGCATGTTGTCCATTTATAACTGGAGAGAGGATCTATTCTGGACTTGACCACTCATTTCACTATTTACTATTATTGAAGTGATTGTGGAGGATTATCATGGGGTTGATACTGATCTTTCGTTCACTTGAGTCTTCACTGTCGAAATCATGATTTAGATGTTTTGGTATGATCAAACTGAATGTAGTCAACGCATCTTCGTCTTCTGAGATTAAATTTGCGATGGATGATGCGAGTTACATACATGCAGTATATCCTGAAAAGAACGCTAGAATTGATTGTGTGACTTCCCGTTGTGCAGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTAGAGTTTCATAGAGGTGGTCTTTATTGTGTGCTAAAATCTTATAACGTATAAATATGTGATCAGACCTAGCATGGTTGTTGCTTGATTTAGCTATGTTGTTAAAGAAATCATACACTGTCCAAAAGTTCTAGCGAGAGCATGCATCAAGTACAAAGCATTAGATTCAACCTTTAACCCATTTTATTTTCATTTTCTCGCAAGGCGCAGATAATTGAAAATTTTACCTTTGTATTTTTTCAAAGTAGCAAGAGTTCACAACCTTTAGGCTGAATCCGTTCTTTGAATTGATCGTAAATGATGAAGTGTGAAGTGCATAGGGGTTAGAATTTATTGCCTAATCGAAGACAAGTAATTTCTTTTTTCCTGTTTGTGTTTTTGGGATTACTTACAGTTATTCTCCTTTATATTGCTGAGTTTTAGAATTGTCTGTTCCAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGTTTGTTTTAATGCTCGAATATTCAGGGGAATAACACACTCAGCTGAGATCTTGATAGTTGTCTCAGTTTAGTCGTCCTTTTGTTGCTGTTAACTTGAGCATGTGGTTTGCAAGTTAGAGTGTTCAAAGGAAGGTCGTCGTAGGTTGATCTAGAAATCTGGGAGATGATCGCGAAGACAATGTCTGCAAACTTCATCAGAATCAAGTCAGAAATAGAGGAGCTAATTTTCTCGAGCAATATTTCCATTTTCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGTACGTCGTGCGTAATGAACCATGTTGACCTCCTTGGACGAATGGACGGAATGACCTTGAAGTAGTCAACCAGAACTTATTCAGAAGGCTTTCTCTGTTTTGGTGCTGATCAATTTCTTCGATGTCGACATGTCTTTATGAAATGCAATGGCCATCGTTGATCAACAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGTGAGGTCCTATATGCTTCTCTAAGCATTTGGGTGGTTTCTTGAGCAAAGGACGCAGCTATGTTTTGAGGTCCCTTCTTGTCTTTCTAACCGCCGAGTACAATTGGCTGGTTCCGTGAGCTCAGCACCTCGCTATCTGTTGTATCTTTCTTGTTTCTCCTTCAACGTGAAGATGATGGTTCAGATTTAATCCGGTCATGTTCTTCACAATTCTTATTTCTTGCTGAGTTTGTCTTTACGTCATACAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGGTAAGGAGTTTAGAAGAAACCGTCAGTAGGAAGCTGTCTAGTGATATTGATTCACACCTTGATTATTGTTATATTTACCTGATAAATTCTGTTGTTTCCGCTTTTGAGAATTGTGTTTAAAGTACACAGTCTGAACCTCATTTTCTTTTGCCTTCGATGGACAAACTTATTTCTATGTTTTTGACAGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACGTAAGTAAAAGACAGAACTAGCTAAGACAAAAGTTTCTGCAAGTCTGGGGTTGTTTATTTTATTACAATTACATGATGTGCAAGTTGACTTTTGGAAAAACTTTTCGAGATCAATCGCTCACTCTGTGTCTTAACGTCTGTTGAATATAGTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGTGAGCTTTCCAATTCTGTTATTCTGTTTTTCTTCTCTTGACCAGCTTGCCGCCAAAGCTGCGTGGTGAACTTTCATTTCTTGTAAAGAGACATCGAGAACTGATTCATTTGGACAATATAAAGCAAAAGGCAGTATGAGTAGTGGTCGGAGTCGGTGATGGCAGTCTTTGCCACCTCATATTCTGAGTTTTCACGGGATTACAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGGTAACTATCTAGTCTGAACGCCCTTGAGGATAACCACGAGGACGTATTCGATGCTTAAGTAAATGATAACCTCTTGCATATTTTACTCATTCATGTGGCCGTTATCCCAACCCTGTTGTATTATAGGAGTATCTGAAATTTGATTCTTTCTTTCATGACCTTTACAGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGGTAATTACATGCCAAACGTAGTAAGCTCTAGCTTCACAGCTTGTGTGGTCAAACCGCCTGGATGTTCTCTGTATGTAGGTAGTCCCATTTGTCAAAAACACGCAACAAATCTGCCGAGGAAAGTAGAACAACAATGCAATATTTACGTATTCTTGTTAGAAATTAGACACGTTTTACATTTATATTTTTTCAAGGAAAGTTGATCTCATGATTTCAAGCTTGCTTCGTTGTTTTTAACCCACATTCATCTTGAATTGAATACATTTTCTGGTTTAAGTGCTAAAACTTGGTGGGAAAAATCTAATTTGTTCTTCCTGGGAACAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

mRNA

>Mapoly0075s0051.10
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

CDS

>Mapoly0075s0051.10
ATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAG

Protein

>Mapoly0075s0051.10
MGAGAGAAAAIENEPSPRRAAIEKAQAELRREVAVREERRRELEFLEKGGELLDFFSAANFALPPSSPTDPLADQLLSSEGEGGHASVALTNGDSVENSVGTSLCVGRSSEGGGDLCPGEDFLSAVIEPLTPWEGKGRASRTGSTSLRSHSDVNLKRESEGSGGGRAAVKGQAYSRRNRPRSNRFGNGHTPTRDVEKAGEVGVLPSIEIKGSPAPPVIFEEVTEENETMVDKKLQVLPAPTLLYNSHASTQLGPVTTKVIEDLEATHLPTGKSFEQNSVKAVHAADDALQTGREFQIHDLAASSCGSLQRSSDLREDVCTGIVVKDELVVVGDLKKVDQTSLSPHVEKNVDSRDGGAVSQPSEQVLGNNQAASDKACGLPSMVEDESAIVMIMDESLGSRTSKNECKDKSTVVSETKGDRVIDRSTIITKHGPDSMLTPTIDDKTSVLREVSCTMQLTPKSLDTSENKSIISRKTTSTASSGAPDLIQNDKARIDDPPSDARVEVKVEEGLSEVGTRLSTVDTQVESGHDVKSICVVSLPQEEIKSESQSTPVSAGSNRAGFRTPNSNTASINKFPGVVLPWEKERDPNVRAEAERHKADLSAKARKAHEDYILEEAEIIKKSKKDTAEWAKRSPHLEPARRKSHWDYLLQEMAWMANDFMQERLWKLASATQFCRWIAEQRGQSSVLQLAGIKQRQERVARVLANAINEFWRSVEYIIHKDKRLTLSSLENQESVVAMKEDSEAVPMDVDIPSIPEGSTQRVEKLPSRSRKPLPVQNYAIRFLKESMGSDVGAQAEAPCTPERISEANSVLDPLWEDQFPEEPLFYLVPDGASRAYRILIETERSSLEIEHEQTLHDHAAAIADAEAVAEAAANADFNVSLSVGEGQPLSVLSSPMKGLRAEEDELGGQFLPNALSSIAKKKRKNILKSNASKGEGISSSGPTHRPPIAPGLDSTAVVQSPLVTGKRSLSVGPGNIVGNVGSIPTKRMRSVSSARQRVMGTASPNSFPSPGGLLQRTIFSSGALNSHQDEVRNLCDDTATRIEADATTVSVKNGLGAGCNNSFVNSKSKKKKKTKHFSGQLSSVNAVKGDGAPSVNTASSTKTPEAEHRSVFDQLKRKGDQVNAASVELDTGGIGSSADTPETPSSQGQQPSKKAKVSKQASDLNPEAAAAAISTAATQSGSLVANTSSTSKLLRQNSNRDRNRKTKSTKVPLTQPAGIGIPWSTIEDQAIFALVHDLGPNWELVSDVLSSSSQLKGIFRKPKQCKERYKSLLDRMSVGEGGDSPEDPSTSQPHPSTLPGIPKGSARVLLQRIQGPMEEDTLKVHLEHIVRVVHKFRALKPPTEEQKLLVQPHASHLNAITQFCANGYPTPSDLCEITAAAPELGGPAYQLPGQHLPGVLAAGSGIRPATNGLPVLPSASNLHMGVPAVAPSTTAASAARDVHRLAAIRPFSPEDAQRVRYHRAMAAARGLSVSGPTVTAGLPMMGLPSPSDCPVPLLGSGNNNIGMMGGISRGMSLSRPGLPGMGSPGVPGIGPPPLGSVLSTGGVGIVSAGPTVGPTVVPQQVNLIRRSREQQLVRPGRSNEDQRRFIEELKHQAAQGNTQAATALSSLGSEVTREMMAVQAQPFQQLQHQNHQQQQQQQQYLAARMAKERQMQQQQKQRLLQQQLQQPQQPSSLQPQLQTQMQQQQMHGMSQQHVLPQQSHLSQQQHLLSSQQHNLQKQQSQQGPQQTGTLSSPSLQPTTIPSMQSNHQQHQTLLQPQQQAPPLGQVQQLPVQSKLQPPKQAQKHPHLQQASQVVQQQPPRGSKGVVRGNMLVQALPGSGQSSMLPGNVSAGSQPQQVAGQQIAHSMQGQRHLMPLAKPLSQTSTQVMTGQSAHMQAQQNQSMAGPVPQGSLGGSQKVVSQQPTQLGTMPSKQLQPSPLPSALPSQQQSPAPPLPTQQQQTSPPAAQQPQIGSSQQLQVQQRRPSQQAQIQSAQRRIQQRQPVASVGAPMIGVLGKNGSSTQQGQVPAQMSSQPGHVTYTQGSSMAVPMSMMSASSGASGLSSSGSPSSSGVHSTPWKPGQVVSPMSSGFYNLSRSGSPGAAQLPSIVSSSGMHLASSNGNSGMSITGSGPPHGVIVGSLSQPLQVGSGGHGLKMGLVTGSNPRGVSTTLQGGTQRSIQHHGNLPASPAIGATQQVRSPVPASSAGMMPVSALGTNTVAGVSSSGSMAYQANSSSLSGHSTAISNSMHMFSVQPRQSHAGSAAATTPAVPMKSPPTSGTSQTSAVSPSSPAPGGIQDFKREGAAGNHQDQSLEAVDKLLRKIGDVEYYKTLA

Mapoly0075s0051.11  

Gene structure:

mRNA scaffold_75:641575..665394  ( - strand )
three_prime_UTR scaffold_75:641575..641992  ( - strand )
CDS scaffold_75:641993..642115  ( - strand )
CDS scaffold_75:642627..642743  ( - strand )
CDS scaffold_75:643068..645041  ( - strand )
CDS scaffold_75:645209..645641  ( - strand )
CDS scaffold_75:645847..646056  ( - strand )
CDS scaffold_75:646207..646289  ( - strand )
CDS scaffold_75:646477..646593  ( - strand )
CDS scaffold_75:646841..646981  ( - strand )
CDS scaffold_75:647150..647230  ( - strand )
CDS scaffold_75:647484..647540  ( - strand )
CDS scaffold_75:647979..648205  ( - strand )
CDS scaffold_75:648571..648631  ( - strand )
CDS scaffold_75:648986..649021  ( - strand )
CDS scaffold_75:649169..649927  ( - strand )
CDS scaffold_75:650089..650172  ( - strand )
CDS scaffold_75:650380..650574  ( - strand )
CDS scaffold_75:657671..657955  ( - strand )
CDS scaffold_75:661720..661842  ( - strand )
CDS scaffold_75:662002..663628  ( - strand )
CDS scaffold_75:663929..664020  ( - strand )
CDS scaffold_75:664281..664335  ( - strand )
CDS scaffold_75:664437..664525  ( - strand )
five_prime_UTR scaffold_75:664526..664680  ( - strand )
five_prime_UTR scaffold_75:664916..665394  ( - strand )

Sequences:

Gene

>Mapoly0075s0051.11
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTATGAATTTAGGGTTCGCAGAGAGATAGGAAAAGGCTTTGTTTGCAAAATATGTGAGTGCTATATTTTCGCTTGCGAAGAGTGAGTTTGATCGATCGAAAAGCACTGACCCTTTCTAACGCGATAAATTCGCTAGAAACAATACTGTTTTTTTTGGGGTATTTGTTTTCGTATTATTTTTCCCCGACGTTTTTCTCGCTTGGTTACGACTCTGTGGATTTGTGCAATTTGGCAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGGTTGGGCGTTGTATCACTGTACTATGGAACACTCGGCAATTTCAATTGCTTTACTTGCATTTCACTTAGAAAGTAACCTCTTGGTCTTTGGTTGGTCACAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGTATGTTTACTGTATTGTAGCTTGCTTAGTTTTTTGAACGAAGAAGTTTCAAATGTTTAGATTTTTAAAAAATATAATTAAGTGCATGTATTTAGCTCAACTTGCAAATTACAGAGAGGTAGATCTTGATGGTTTAGTGTCATCACTAGTGTTTTAAGTTGCACAGGCTGTTCAAAAGTGGAATCTGAATACGTTGTTTTCTGTATCCATTTTGTTTGCTTTTCTTTCTGCTTATGTTCTCAATAAGCTTATTCGTGCAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGGTTCTTACATGACTTGGATTGCTTATGAAGATGGAAATTTTTAAGAGCACTAGAAGAGTGTAGAACTTTCACTATTGACTGCCTATGTATTTTCGACGTTGACTGTTGAGGTGTATTTGTGAATTGATCTGTTCAAAAGTGTTCATTCGAGCCCAAGTTACTGTCAAATCAAAGGGCCTCGTTGTACCGTTCAGGTTATGTCTACGTGTAGTTTTTGCAGACGATGGTTGTGAAGAAAACAAGTGTTGCCTATACATTGTGCATAAGACAGAATTGACCTCACATATGTCTTTTTGGCAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGGTACTGTGGATGTGTTCTTCCTCATGAGTTTATACATTGAAGGTCTAACTAGTGTTCATGGTTCAAGCTCGGCGCTTTCTGGTTTCTTCTCAATTGTCAAGTTATGATTTCAGTACAAGTCTCAACTACTAATGAGTTCAGATTTGATATATTTCCCAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGTGCATTTCTTCCTTTGATTGTGTTATAGTAGTCTCTCTCGTTTTGGAACTGGGATGGTTCATGTACGCTTTTGCGTTAAGCATGCGCAAGAACTTTCTCTTATCCCACAAGTTTGATGTTAACTAGTCATTGATACTACATAGTCACATACATTTTCTGACTACCAAGCTATCGATTTACATTTTTCTTCCATTGGCAAGTTAGCGTCGCGTACTCTCAACCTCCATCGAACTCCAGTGTATGAAAGATCTTTTCTTTGGGCTGCATCTAGGTTGCATCCAGTCGTTGTATTCACAACAGAATTTAATGGAGTGGAACATATTTCAACCATAGTCCCGCTAATCGCATTGAGAACTTTACTTGATATTGCTGGGCAAATATTGTATTGTATATCAAAACAATTAGTAAAAGAAAATTAACAGGGGAACTCTAGAGTTCTAAGACAACAGCTCTCCCTATCAAGATCATTTGCGCATGATCATGTACGTCAATACTCCTAGTGTTTTGTTAAAGTGTCCAGAACTGTAAGTCATTAAAGTTTCTCATTCTCATTACCATTGTTTCAGTCCTGTACTAGACACGGACTCTGTCAAAATCGTTGAACGTATTCACTTGAAAATAGTCACTGTATTTAGCTGTTTAACGCCAGCCTTAGCTGGTTTCATCCACCGGATATCGGTGGCCGTATTTTTCTCGCCCGAGCCTATCGACCCCCCGGCTATGTAACAATTGTGGTCATGAATCCAGCGTTGCTAGTGGAGTCCAAGAGTTGTGTTTTACCCTACTCCTGGAACGAGTAGGAGATGAGTAGTAATTGCTTGTGAACCATGCGGTTGATCATGCACGTGATAGCTCCTAGTGTTTTGGTAAAGTTTATGGAACTGTATATCCTAAGCTTATCTTATCATATTTACCATTGTTTCAGTCTCCTGTACTACACGGGATGGTTGAACATCGTTGAACGTATTCGCTTGAAAGTACACACTTCAACAGTTTCACACCAGACAGTTCTGCTTTTATCCATTGTAATATTGATGGCTTTGATTGTCGCGCCCGAGCCATATCAGACACGGTCAGAGCCATGTAGCCAATGTGCTCATGATTTTAGCGTTGCTAGTGGAGTCCAAGCGTTGGAATTTACACAATTCTTGGAAAGAGAAGAAGAAGAGTATTCCTTGCGTGTTAACCTTGCGGTTGATCATGTACATCGTAGCTCCCAGTGTTTTGGTAAAGTTTCTGGTACTGCTAAAAAGTTTCTCATTTTTATTACCATTGTTACAATCCTGCTGTACCAGAGACCGGATGGGGGAAAATCGTTGAACGCACTCGCTTGAAGGTAGGCACGTCAAGTGTTTTATGCCAGACACCGTTGCTTTTATCCATTGGATATCGATGCTCGTAATCCTTGCACCCAAGCCTTATAGACCTGGTCACGACCATGCAGCTGATGTGGTCATGATTCTAGGGTAGCTAGTGGAGTCCAAGAGTTGTGTTTCATGCAACTTTGGGAAGGGAGAAAATTACTTGATGGGACCCCTGCGGAACACAAAAGACTTGCTGATACACAACACGATTCATTTTACCAGATGGGACCACCCTACGGCCATGCAGCATTGGGTGACGTATCGGGTGACGGCAGCCCACCGTCACCCAATACGAGTTCTGGGTTAGGTACAACCAGTGGGTGGATCAATCAGAAACTTTGACTCCAGTCCTTTGAAAGAAACAGCCCCTAACTTAAGTCCCTCAAGTCCTCACGAAGTTAAGCGGTAACGGTACACAACATAAATTTGACAGTAACAGTAACTACATTCCTTCTGATAGACATACGCATGGGGACTTCGATCTCGTTTGCAACGTTATGATACCAACATAACAGCATCATGGTCTTGAGTTTGATGATTGCAACGCAATTTTCTGAAAGAAGCTACATCCAAAGATGTCGAAAGTTTACACTGCAAGTTAGCTTACTTAGTGTATCGGTTGTGAATCCTTTCAAACACAGTTTCTACTTGTATGCAAGCGACGCTCCCATCGCATCCGTCAGAGGCTTCATCAAGAGATCATTCCTTGCACAGACGAGACCCTCAATCTGGAATCTCTGCTTTGCGTGTAAGTTCAGTAAAGTTCCTGGAGCCCCTGGGTCCCAAGCTTTCGTCTGGGGATGCTGGAAGATTCTGCCATGGCTACACAAAGCTTGATTATCGTTCCTACTACTGTCAGGCTCACTGAATTGATCGTGAACAAAGTTCAGTGATGACGCTAAGGAATCACTGAATTGTGACGGGTTTTGCTGCACCTCAAGATAGTTATACGCTCTTTTCATACAGGGATTACAAGCACTGTGCCCTTTTGGCGTGGTTGATTGACCTCTTATAAGTAACCCAAAGTGAATCGATTTCCACGCAATGCAAATTCTTCATTCTGTCATATTGAGCCAGCCTATTCCTAGACTGGTTCTTCGTTCTTATTCGACGTGGTGGAAGGACGTAGGTATTCCATCTGGTAAAATGAATCGTGTTGGGTCCCAGCAAAAGCATTTGCTGGTACCCAACACTCCGGTGGTGCAGGCTTTACTCCGGTGGAAGTAACGGCCGTATACACTTCTCATCCCATGATGCATCTCACGGATAGAAGTGCAGAACTGTATCTACATCGGTCCTCTTCTAATGCAGATTACACTGGAACAGCTACGAGAGACTTTCTCTCCCTCACACACAACTCGACTTCTAACTTTCGTTTTTATTGACCTTTGTTTATGCATATCGTAGAGGTATTACCCTTCAGTTGTAAATATAGAGTTTTCCTTATCAGTTTTGATCAGGTTGTGTCTGCGAGATATCTTCTAATATTTGGTCAATAGCGCACAGAAAAACAAAAAAAAACATGTGAATATTGTTGAGCTTCACTCGTGTGTTTCAAATTAACCTCTGGGTAGCTAAGTTAAGTTTAGTTAGCTCACCGCCTGGAGTGGGGTATTTAACCCCAGATCTTCTCGACTGTAATCACTCTCTTCACATGTTAACTATATGCGCTGTATTGCACGCGCTCACTTTGACTGCACAACTATGTTGTGATTTCACCGTAGATGCTTAGAGTCACTGCGATCAGGTCTTCAAAATCGGACCCGCTCAGATCTTGCTGTACAGATTCACATCAACCGTGTACTGGAGATAGACAAACGATCCAAGGACGCATGGAAGCATATCGCTTTTGAGACAATTAGGTCTGAGGTCAGAAGCCCATATTCTAAGGGGTCAGTCCTACAAGGGCGAGTGGAAGGGGTTGAAAGGTCTGAAAACAGTAAGCACATCTAATTATAAGGCAGATAATGGATGGAGAAGAATTCTTGTGTGATGTGGTTTTAGTTCATTGCCACGCAAAAGGTAAAATCAGCTACATACCCCGTGAGACATCTACCAGCCAATCAAAGACACCACATGTTTGACAGTCTAATATTCGTGGATACATCTTGTTGATGTTTGTAGGTTAATCCTCGTAGTTTCATAGTATATCTTTCTGACTTATGGTGAACTAATAAATACATGTTATGGTGCTTTCCTCTAAATTCGTCTTTTTACTCAACACAGTGCTATCTTGCTCTTATGTATTATTGCTCTACCATGCGTTTCTATGTGGGCAATGCCTGTTTTTTTTACGTGGATGTGTTGGAGAACACATTTTGTAACTCACAAATTAAATTTAAGCTATACCATGTTCGGATTTAAGAATATAATGCATGGTTGTATTGTTCTGATCGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGTATTCTTTCTTGATATACATAGTGATCTATTTTGTTTCAATTTGATTCAGCTCAACATCCCCATCCATAGTAACGGAAATTGATTCCATTTTACATGGTGGACTTAACATATTGACTAGATTGTATTTCCTTCATATTGGGAGTAATTACAATTCGTTCTCACAAGTTTGATTATTTTCGTGTTCAGCATTACATTGATCACTCTTATAGTCAACTTCATGAATCCGTACTAAGAGCAATCAATGCAACTTTCTTCCACCTAAGTACTCGAGTCATCCGGTGATATATTGAATCCTTCTGTTATTGAGTGTGGTTGTTTGTGGTCTGGTTTGGTCAAGTATTGTGAGCTTCTTGTTGCTTCATTTTGATTTTTAATAAAAAAATGTCTTATATTAAACTTCTGATCGATCACTTGTTTGTTTGAATGTAGAATATAGTTTAACTTGACTAAATAAAGATATGGCTGTATATGTTGTAGGAAATTTTGAACACTATATTGGCCTTTCAATCATGTTATGTGAAGGATTGGAATTCATCAAAGTCGCTTATTTTAATTCGCTATAATTCATAGTTTAGGCAAAAACAGTGTTTAGTGTCGGTGGTGGTCATATTGATACTTGTGGAATATTTTAGTATTGTGTGATCGTTATCGTGGTCTGTTTGTTATTCTGAATTTTTGGTTGAACTTGGTCAGATTCGGTTGGATGAATCTTTACAGAAATTGTAGAAAGGTAGTGTAAAAAGGTCGGTTAGATTCATCTAACCTGAAGACATTGGAGGTAAGGTCTGGATATGAGATTAACCTTCCCTTGATGGAATTAATATGAGATGTTGACTGAGGTGTTGTTTTTTTTAGATATTGAGATCTTGGTTCATACCTTTTTCTTGCTAGAATGTCCCGCTCTTCCTTCCTATCTTCTATAGTTGACTAGTTGTTACAATTCTCATATACAACTTTGCTGTAAAGTGCTTGGTAGATCATATCACAATATTGAAACTGATAGAATGGATTGATCAATATGTCTTATGGTGAATGTCATAATATTCGTCATGATCATGACTGGTATGATGATTCAGTAGTAATCAGTAGTAATCGTGCGGAAATTGTCGCGGTAGGATTCGTTTACATTTTCGCGTTTGTAGGTGTATTTCTAGACCCCATGTATCCAACTCGAACCAGAATGTTATGATGGGTATTTGTTTGGTATTTATAATGACTTTATGTGTTGAATTTGGTGGTCCTAGAAAACAAAATTTAATTCAACCTATTTTTGTTCAATGATAATTAACTCCCAATATTATGGTAGGAAAAACTGCGCGTGTAGATATAGGTATTTTATTATTCCTTCTTGGATTTAAGTTAGTTAAATATACCAATTTGACATTTACATTCATGTAATCCTCCCATCAAAAACAGACACAAGATCATGTCGTGTCATCGATGCAGTAATCCATGCAGCCAGATATACGAGATAAACACAAATTGTAGAGTGCTGCAATAATTCATCCTTCGAGCATTCTTTATTCTAGAGAGCTGCAAGAATTCTCTGCTTTTGGGCTGATTATACAATCCTTATATTGAATTATTACTTCTCATTTGGAATACACTGTGTGCACTACATGGAATTCCAGTCGAGTTTTGCGTGAGATAAGCTAATAGCAAACCTGGAGGTTGACTATGTTCTGAGTTTGAAGATCATATATATATATCACTCTCTCTCGACTTTTATATTGCGAGTTGTACAAATTTTGTTTTCAATACGATAAAAAACTGTATTTTCAGATATAACTAGATCCAACTACTAAAACACACAAGTTTACCACCCTTATATCTGCGCATACCAATACTTCCTAGAAGTCCAACTTAGAAGTAAAGAAGATTGTAATTTTTAGAATTCCAACTTATAAATAAAGAAGATTGTAATACCTCTATGTAGACAAAATCATATTTGTGCTCTAGTTATCTTTCAAATTTAACATACTTGATATAAAAAAGGGATGTTAAATTCACCCCGAGTTGTTAAATTCACCCCGTCACTTTTCATGGCAACAAGACATGTCAGAAATTATTGTTTCTTCTCGTCGCGTCGAGGATTGGTTTCGGACTCTCTTTCTCATTTTCTTTTTCTCCACTGTGCACAAGCTGCTTTCTGTGGTGATTCTTGATATGCATATGGAGGAAATAACGGAATCGGCTGCTGCATGGTTTATTGTCCGAAAGTATCGTGCTGGATCTTAGAGCTGAATCTGCCCTTGGATGTGACCCTGATCAAATTTAAAAGAGATACTGACTAAATTCAGAAGAGAGATGCAACGTGTGAGAACTTGGGTGATGAATTTAACAATCACCAATATAAATATATCAATATATAAATTTCATCAAGTCCAACGATGTACCGAGAGTGTAAACCTCTCTCTTCTCTCTTCGTTTCTCTTGTGTACATATGACAATAAGCACTTGGTTTAGTAGGTATGGAGAAACACTCTCTTGTACTGCATTTTTCATTTTGATTCACGCGCATAATTATATTTTTATTAACTAGATAAGATCTAATTTTTTACATAAATGAAATCTATCCTCCCATAATGATGATGTGGTTTTCTTCTCCACCTTAACTTTCCAACTTTCTCAAAGCTACTTTGAAGACTTAAGTTTATATTAGTGAATGGAATAGTAAGCTTTCAGTTACAATTTCATTGATGCCGGTCACTCTTGTAAGAGACCTATCATGTCGACAATTAAATAGTTCCTACTATTTATCTCATTTTCATCTCCTTGTTTTTATGTGTATGCAATAAAATGTAGTCATGGTTTGTTTACCCTAGCTGGCATTTGTGATCATTGATTCTCTTGCATGTTACATCTCAACGATCTAAACCTTTAAAGTAACGTAGTTAGACTAGAACACAGTATCCTACTCAGATTTGGAAAAGACTGGCTGAAAGATAGAATTGTAATGGTTGCAAATGGGAATGGTATGTAGTAAATTCAGTAGATATTAGTCATCGAGATTGAGTGCAAAGCATTATATCCTTTGGGTATCTTGAAATAAGTGATGTTCTTGGGGAGTTCAACTCCTTCTTCGAGTCCGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGAAGCACATGAACATCAGAGTGATCCCGTGGCATACTGTCGATAGATTCATCTATACATTTTTCACATAAAAATCTGGATGATAAGCATTATATCCTGCTCTAGCTGGTGCAACACATCAACAACAGAGTGATCCCGTGGCATACTGTCGATAGATTCATGTATACATTTTTCACATAAAAATCTAGATGCAAAGCATTATATACTTTGGGGATCTTGAAATAAGTGATGTTACTGGGGAGTTCAACAGCTTCTTCGAGTCGGCACATGTAACTATTGGTTGTGCCTGCACTGCTCTAGCTGGTGCAGCACATCAACAACATATAGATTTTTCACATAAAAATCTGGATGCATGGGAATAGAATGATGACTTTATAATAATCTTTTCCATTAGATTCTTGATTTGAAAAAATGATTCATAGGGAATGGTTCTTGGAAATCTGACTATAATATTTTTTTTGGAAATCTGACTAATATTTCAGAAAACTCTACCGTCACTAGGAGTGACACGGTAGAGTTTTCTGAAGAACTGTTTGTTCACTTGCTGAACAAACAGTTAGCACTAAACAACATCAGTGAGCACTAAACAACAGGCTTTTTCTTGCATGATACTAGATATTGCATACTATTGACTGCGGTTGAAACTAATCCCAACAATTTTTTTTGGTTTGAAATTCAACCATACTTTAAATATTCGCTAATTTACTGTTCGGTCCCTCTCGCTCCTCTCGCTCCCCTTCCCTTCGATTCCTGTCCGTAGCACCCCTCGCCTCTTTCCTCTTGTGGGTGGAGTGAGTGGGGGCGCCAGGCGAGCACGAGACAGGATCAGACCAGAGTGGGTGCGGTGTTCCTGTCAGAAGGTTTCTTCCTTTCCACTGCTCTGTTCTTCTCTGCTCCTCCCTCTGCTCCGTTCCGTCATCCTCTTCATCTTCTTCCTCTTCCTCTCCTTCTCCTGCCGCTGCTGCATCTTGAAAATCCGTCCGGAGTAAGGTCGCGAGTTAGGCTGCGCGTAGTTTTATATGTGGACGGTGGGGGAAGTTTTTCCAGCTCGAACGGAGATCCTCGCGGGGCTTCTTGAGCTTCATTTCGATCACTGGTGAGCGTCTAGCTCTGTACTGACCACTTTCCTGTGATGTTGATGATAATGATGATTATCACTCAAGTCTGTGTCTGTCGCTGGGTCGTTTGTCTGAGTTCCCTGCGGTCACTCTTGACTCCATAAGGTGCCAGTGCGGGGGTGTGCACTCAGTATAGTATAGGATGCTGCGATGATTGGGAAAAGAAACGAAGAGTGGAAATGGAAAAGCTTGGCTCGAAATCTCCCTGGCGCCGTTGCCTCTGCTCTGATTTCTTTCTCGAATCAACTGTGTGTATTCTTGATATGTTCGTCTCTTAGAACATCTTTTCTGAGAGCATCCCGTCTGTTTGCTGAGTTTCTTCCTATGTTGGCATCATGGCTTAGGATTCTGTGATTTCTCTTCCTCCGATCCTATTCTTGTATTATAGCTTTTAATCTTCCCTGGCTCGCTCGCTCTCTCCCTCCTTGTTTTGTGATGCTAGTTTTGCTAGGGGTGTGTAGATTAATGATGTTGTTAAGTTCTTAGTTTGCACAATATTGCAGTATTTTCATCCTTGGTTTTGGAGTAGTACATTTACATTCTTCATTACAATTGTGCTTAAATTACCATTAACAACTAGACTGAGTATCCAATTCTTCTGTTTTGTGTTTGGGATTGAAGTAATTGTTAATTTTCTTGACAATTGATAGGGATTGTAATATTGAGTCCCATAGTGAATTGCATAAGATCCATAGTGAATTATAAATGAATATATATACTGTTCAAGATACAGTCAATATACGTATTTGTAAATCACCATGGGTCGATTGAGATGCAATGCTTTTAATGCATTTACAAAATTAAATATTTCTCAAATTTCACCTCAATTTTCTATCAAGTTTTTATTTGCTGATGGTATCAATTGATTATGTCATTTCTTACCATAGACAGTATCAAAGTAATGGGTTATATCTTATGGTTTTCTTATCTTTAGCGATCAAATTTTTTTTTAAACTTCTCAATACTTATAGATGCTTTGTTGAACATATTTAATCGTGGTGAATGAATATGTACGCTTCAAAATGTAGGCTTCGCAACTAACGGATAATATTTTGTTTCAGACCAATCTTTGAAATCTCTGCTTTGTATATGAAATCTGCTTATATTTTATATAGGGGAATGTTAAAACAACCACATAAATTGTTCACATGATTTGTCAAAAACAATTTTTTTCGCATAAAAGCTCAAATATCAGCTGCGAGTGTGTTTTTGACTTCCCCCTCCTTCCTGTGCAAAAAACACCTTCAGAGTTGTTATCTCACAGGGATCATTGCAATAGTTTCAGTCAGTAGTCAATAGTCATTGTTCTTGAAGTGTGTACGTAGAAGTTTGATTGTGTCTTCTGCATATATGCAGCAATATGTAACAAAAATATGCTTGGAGATGATACTTGGGCTTGTGTGCGAAATATCAATTTTTGACAGGAGACTCGTCCGTGGTAGTTTTAACATTGGATGTGATCGTTTAACATTCCCCTTTGTATATTGCTTAACCCATTATGTTGGAACTTTTTCCAACATAATTGTTTGATAGTTTGAACAGATAGGCGAAATTGAAATCCTTTTTTCCCTTGGTTGAAGATTTTATTTTTACTCTCTCTGATCTCTATGCTTCTCATTCAAAGGTCTGGGTATATGAAAGGTAATCCGTTTAGGATTTATATGGATATATCTGAATGAATGCCTCCACGGGGTAGTATTTAGATAACAATCTTGTAATTTACATAATAACATTGTAATCATCATGTTTTCATTGGTTTGGTAATATCAATAATATAGCTAATAATAGTTTGATAGCAAGAACATGAAGTAATGCGACATCAGATGCTACTGGTATTTGTATATCGGTGCGGAAATTGTATGTGATGTATGACGTATCTCATATTACAGTAGCCTCCCGTTTGAACGGGAGGCTACTGTAATATGCATCAATAGTACGCATCATTTTCCCCAAAAAATAGTTCCAAAAAATAGGGTTCAGATTTATTTAGTTCAACGTGTCATATATTTTCATTTGGCGCAAGTTTTGAAGATTCTTGCGTTTGAAACCTGATTTTTGGTATATATTTTCGGCATTAGAAGGCTGTATTTGGGTAGTAAGCCATAAAACATAAGCGAGTATCTTCCGTATTGTATAAGTTTTTAGCACCATATTGGTAGTCTAAGGCTTCCAGCAATCCATGATTGGATTTGTTGAATTAAGCTCTCTCTTCGTGAAGCATCACCTTTTGCAACCCTCGGCGATTTGTGATTGACTGAGACATCAGCCATTACCATGATTCCTTAAACTCTGTTTCTGAAATGGGTAAACTCAATGCAATACTTTTCGCTTTGGCGACGGCGGAATAGATAGATTGGACGTATTCTGTATTAACAGAATGGTAAGCATGTCTTTTAGCTTGGTGAAACAACCAACACAGGATTGAAAAGTGTTATCTTTAGCTTCATAGATATCAAGACAGATCGCTTTAGGGTTTGCTCACACATTTCTGATAGCTGCTTCACTAGCATCGGGCCAGAGCCCTTTTACTGGGAGTATCGTGGTAAGTTTTCAAATGATCGATAAGAGCTGGTTGGTGTTTCCAGGTTGTTTACCCTAGTGATAACTATCTGAGATAAATTAAGTATGGAGTTTTCATCATCCTCATCAGATTTTGTTGTTTCGAGCTTTTTCAAGTGCTCTTGTATTAGTCCCGTCACCACTTCAGCTGGCTAGCTTCAAATATTTGCCGAAGCCATACAGTAAGACAGAAAAATATGCAACTCCACTATCTCTTCTAGTTACTTAATTGGGTCAAGTGGCCTCCATTCCTCGGATTTTTAACCGAGAATCATCTCATATGCAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGTATGTTTGGATTATATGCGACCTCATCCATGCTTGTAAGTCCTTATCATTTGGTTGCAAGTTTGGTTATGGTGAAGAGTCCATACTCCTGGTGGTTATGGTGAACAATGGCAGTATAACAGTACAATCATTAATGCTCAAGTTGAATATTGAACTGCATGTAATCTCCTGATAACCTGCTCCTTTGGTTGGTTTTTTTGGGTTCAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGTAAGCTTTCCGTGGGCTTTATCATTCTTCTCGACATTGATCAGTTATATGCTGAAGTTGTTACTTGGTGTTCATGATTTCCAAATTCGAGCAATGTCTTGGATCCGCACGAAGGTGTTCATTTAAACATCACTCGATGTTTCTTTTTTTGTTTATTGTAGGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAGTACGTCAAATGGGCTTCTTATCTACTAGTCTTTGTCTATCAGTGTATCATATTTCTCCGTGTGGAATCTCTGCTACACTTACAACGATAGGACTCCTTGACAACACTACTTCATGCTACTAATGTGTTTGGCTTTATGTTCAGCAGACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGGTTGGTTTTGTCTTGGAGACTGCCCTAACATTTCGACATGGTTGCATGAAGTATCTGCTTGATTGTTGGGGATCTCTTTCCAAGCCCCTTTACAATTATCAGTAAATTTCTGATGTGGTTGGGAAGAGTAGGTACTAGAGTATAATAAGCTGCCTCTGGTCGTGACTAAAATACAGTTTTGGTCAATACGTGATTCTCTTACAATGTTGCCATCTACTATTCTCTTGAAACCATCCACTCTTTGCAGTGGCTCTCATGGATGCATTATCTTCTGGCCTTCTGTGTACCATCCCCAACTTGAGTCTCCTAGTTTTTTTGTTAGTCTTCAAAATTGCTTGATATTGTTGTGTTCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGTATGTTTTGTCACTTAGTTTCACACTTTACGCGGAGTTCAAGTTTGTGTCGTATACTTGGTGGTTTGCATGTTGTCCATTTATAACTGGAGAGAGGATCTATTCTGGACTTGACCACTCATTTCACTATTTACTATTATTGAAGTGATTGTGGAGGATTATCATGGGGTTGATACTGATCTTTCGTTCACTTGAGTCTTCACTGTCGAAATCATGATTTAGATGTTTTGGTATGATCAAACTGAATGTAGTCAACGCATCTTCGTCTTCTGAGATTAAATTTGCGATGGATGATGCGAGTTACATACATGCAGTATATCCTGAAAAGAACGCTAGAATTGATTGTGTGACTTCCCGTTGTGCAGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTAGAGTTTCATAGAGGTGGTCTTTATTGTGTGCTAAAATCTTATAACGTATAAATATGTGATCAGACCTAGCATGGTTGTTGCTTGATTTAGCTATGTTGTTAAAGAAATCATACACTGTCCAAAAGTTCTAGCGAGAGCATGCATCAAGTACAAAGCATTAGATTCAACCTTTAACCCATTTTATTTTCATTTTCTCGCAAGGCGCAGATAATTGAAAATTTTACCTTTGTATTTTTTCAAAGTAGCAAGAGTTCACAACCTTTAGGCTGAATCCGTTCTTTGAATTGATCGTAAATGATGAAGTGTGAAGTGCATAGGGGTTAGAATTTATTGCCTAATCGAAGACAAGTAATTTCTTTTTTCCTGTTTGTGTTTTTGGGATTACTTACAGTTATTCTCCTTTATATTGCTGAGTTTTAGAATTGTCTGTTCCAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGTTTGTTTTAATGCTCGAATATTCAGGGGAATAACACACTCAGCTGAGATCTTGATAGTTGTCTCAGTTTAGTCGTCCTTTTGTTGCTGTTAACTTGAGCATGTGGTTTGCAAGTTAGAGTGTTCAAAGGAAGGTCGTCGTAGGTTGATCTAGAAATCTGGGAGATGATCGCGAAGACAATGTCTGCAAACTTCATCAGAATCAAGTCAGAAATAGAGGAGCTAATTTTCTCGAGCAATATTTCCATTTTCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGTACGTCGTGCGTAATGAACCATGTTGACCTCCTTGGACGAATGGACGGAATGACCTTGAAGTAGTCAACCAGAACTTATTCAGAAGGCTTTCTCTGTTTTGGTGCTGATCAATTTCTTCGATGTCGACATGTCTTTATGAAATGCAATGGCCATCGTTGATCAACAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGTGAGGTCCTATATGCTTCTCTAAGCATTTGGGTGGTTTCTTGAGCAAAGGACGCAGCTATGTTTTGAGGTCCCTTCTTGTCTTTCTAACCGCCGAGTACAATTGGCTGGTTCCGTGAGCTCAGCACCTCGCTATCTGTTGTATCTTTCTTGTTTCTCCTTCAACGTGAAGATGATGGTTCAGATTTAATCCGGTCATGTTCTTCACAATTCTTATTTCTTGCTGAGTTTGTCTTTACGTCATACAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGGTAAGGAGTTTAGAAGAAACCGTCAGTAGGAAGCTGTCTAGTGATATTGATTCACACCTTGATTATTGTTATATTTACCTGATAAATTCTGTTGTTTCCGCTTTTGAGAATTGTGTTTAAAGTACACAGTCTGAACCTCATTTTCTTTTGCCTTCGATGGACAAACTTATTTCTATGTTTTTGACAGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACGTAAGTAAAAGACAGAACTAGCTAAGACAAAAGTTTCTGCAAGTCTGGGGTTGTTTATTTTATTACAATTACATGATGTGCAAGTTGACTTTTGGAAAAACTTTTCGAGATCAATCGCTCACTCTGTGTCTTAACGTCTGTTGAATATAGTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGTGAGCTTTCCAATTCTGTTATTCTGTTTTTCTTCTCTTGACCAGCTTGCCGCCAAAGCTGCGTGGTGAACTTTCATTTCTTGTAAAGAGACATCGAGAACTGATTCATTTGGACAATATAAAGCAAAAGGCAGTATGAGTAGTGGTCGGAGTCGGTGATGGCAGTCTTTGCCACCTCATATTCTGAGTTTTCACGGGATTACAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGGTAACTATCTAGTCTGAACGCCCTTGAGGATAACCACGAGGACGTATTCGATGCTTAAGTAAATGATAACCTCTTGCATATTTTACTCATTCATGTGGCCGTTATCCCAACCCTGTTGTATTATAGGAGTATCTGAAATTTGATTCTTTCTTTCATGACCTTTACAGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGGTAATTACATGCCAAACGTAGTAAGCTCTAGCTTCACAGCTTGTGTGGTCAAACCGCCTGGATGTTCTCTGTATGTAGGTAGTCCCATTTGTCAAAAACACGCAACAAATCTGCCGAGGAAAGTAGAACAACAATGCAATATTTACGTATTCTTGTTAGAAATTAGACACGTTTTACATTTATATTTTTTCAAGGAAAGTTGATCTCATGATTTCAAGCTTGCTTCGTTGTTTTTAACCCACATTCATCTTGAATTGAATACATTTTCTGGTTTAAGTGCTAAAACTTGGTGGGAAAAATCTAATTTGTTCTTCCTGGGAACAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGTAATACCTGCCAGTAACACTATCAGTTCTTCAGTTGCGGAACCTAGTCCTCCGTAATCATTTATCTGTCCATTGTAATTCACCCACCCCTGTATTCTTGGGCTAACCTACCATAAAGGTTGTACACATCCTTGAGCCTTCTTTCGGAGAGGAGCTCGACTAGAAAATTTCATTTAGAAAGCAGTTTTGGTAGGTAATTCTCGGCTCAAATTTGTTTCTTGGAACGGTTTGGCACTCACGAGCCCGGAAGATGCGTTTGTAAATTCTCCTGCACAGAATTTGCTTCATGTACTCGTCACTTGAAGTTTGAAAGCTCGTTGGGCATTGGCAATGTAACAAAATGATAACGTTTCATTACATCTCGAATAACACACTTTACGTGTGTGTGAAAGGTACATATCATCTGAATGTGGCCATCCTTCATGTATGATTTGAAGTCATTGAATGGTTGGTGAATGCCCTAGCCGCCGTTCTTCACGGTATTTACGATTGTGCATATGCAAGGTCCCAGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

mRNA

>Mapoly0075s0051.11
GAAGTGCGGTTCCGAGTCCCACGACACCAGCAGGCGACGACGGGACGGGTCTGGACGACGAGGCTCACATCAGGGGCCAGGGTCACGAACGACAGCAGCCGAGCCAACCCTCGATACACCGAAACCCACGCATTGATTGCAAATCAGCAAAGTGTGCAAAGTTTTCACTAGCATGCATACACATACATATTACATAGCTACGAACAATTTGTCCCCGAAGGATTAATTATTTATAGGGCTGCAAATTTCGAAGATTGACCACGTCGCGTGAGATTGGAAAATTTTAGATCGATGTCGCGAATTCGAGCGGAATGAATGAAGTGGTGACGGAGGATTTTATGATTGACTTGGACGACGAGAATGGTGGTGATTTGTGCGACGACCTGTCCCGTACTGTGGCCCGTCGTACGTGCAGAGAACGAGGTTTCTTGTGTGGGTCACCTCGGGCAGAGATGCGGTTTTCAGCTCACTTGTGAGAGGTAAAAAATTCCGTGAGAGGTTGTAGAGGAGATTTTGACGGGAGATTTTCTTGGCGAGAACGTGGGATTTGTTTTCAGAGCTGGGACCTCGAGCAAGTGGAGACCCTGGAGTAGAGCCAGGGTCAGCTTACATAGTCAATGCAGAGCAGGGTTCCATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAGTTGGAGACAAAGTTTCTTGGCATTCTGCCAAATCATGATGATGTCTTCGTTCTGAACTGGATTTGCAAAGTTTTCCTCAACGAAGGATGGTAGTGGGGGCGACTACCCTCTCTTGCCCCACCTTGGAACGGGTTAACTTCATCAGTCGTGTGCGCAGGCTACCCTCCCTGGGTCGAACTGTAATTTTTCACTAACTGAATGATCAACACTTTGTCCAGTGATGTACATAATTAAAATTCAGTTACTCGAATTTTTTTGATAATTTTCCAAGATGCCTGCTGGTTTGAAGGGAACTTGTTTCAAAGTGTAACTTTGAGGTTGTTTAGGGTTAAACTATCTACTAACTTTTTAACGTACATACCTTGTAGACTTGAGTACATGTTTGTAAGTTTTGTAGACATTCTACTCTGAAAATGGG

CDS

>Mapoly0075s0051.11
ATGGGCGCAGGAGCTGGTGCTGCAGCCGCCATAGAAAACGAACCTTCTCCACGACGAGCAGCCATTGAGAAAGCACAAGCAGAACTCAGACGAGAGGTTGCTGTGCGAGAAGAGCGGCGAAGGGAATTAGAGTTTCTGGAGAAGGGAGGTGAACTCCTGGATTTTTTCAGTGCTGCAAATTTTGCACTCCCACCTTCTTCACCGACCGATCCACTGGCTGACCAGTTGCTGTCAAGTGAGGGGGAGGGTGGCCATGCATCAGTAGCCCTTACCAATGGCGATTCTGTGGAAAACAGCGTGGGCACTAGTCTTTGTGTCGGAAGAAGCTCAGAAGGTGGAGGTGATCTCTGCCCTGGAGAAGATTTTTTGAGCGCTGTCATTGAACCACTAACCCCGTGGGAAGGCAAAGGTCGAGCTTCAAGAACAGGATCCACCTCTTTACGATCTCATTCTGATGTGAACTTGAAACGGGAGAGTGAAGGCTCTGGTGGTGGCCGAGCTGCAGTAAAGGGTCAAGCTTACTCCAGAAGAAATCGCCCAAGAAGTAACCGCTTCGGTAATGGACATACACCCACAAGGGATGTGGAAAAAGCGGGCGAGGTTGGTGTACTCCCTTCCATTGAAATCAAGGGATCACCTGCACCGCCTGTGATTTTTGAAGAGGTCACTGAAGAAAATGAGACCATGGTGGATAAAAAATTGCAGGTGCTACCAGCTCCTACACTGCTCTATAACTCTCACGCTAGCACTCAGTTAGGGCCGGTAACTACGAAGGTGATTGAGGATTTGGAGGCTACCCATTTACCTACAGGAAAGTCGTTTGAGCAGAATTCTGTAAAAGCTGTGCATGCAGCTGATGACGCTCTTCAAACAGGAAGGGAATTTCAGATTCATGATCTTGCTGCTAGTAGTTGTGGTTCTCTACAACGGAGCAGCGATTTAAGGGAAGATGTTTGTACAGGAATTGTTGTAAAGGATGAGCTTGTGGTAGTCGGTGATTTGAAAAAGGTGGATCAGACTTCATTAAGTCCACATGTGGAGAAAAATGTAGATTCGAGGGACGGTGGTGCTGTGTCACAGCCTTCAGAACAGGTACTAGGCAACAACCAAGCGGCTTCAGATAAGGCCTGTGGTCTCCCGAGTATGGTAGAGGATGAGAGTGCCATCGTTATGATCATGGATGAGAGCTTGGGTTCTCGAACATCAAAGAATGAATGTAAAGATAAGTCTACAGTAGTTTCAGAAACTAAGGGTGATAGGGTCATAGATAGAAGTACAATTATCACCAAGCACGGTCCTGACTCCATGTTGACACCTACTATTGATGATAAGACATCTGTACTACGTGAAGTATCCTGTACAATGCAACTTACCCCAAAAAGTTTGGATACCTCCGAAAACAAGAGCATTATTTCCAGGAAGACCACCTCGACAGCGAGCAGTGGTGCCCCAGACCTTATACAAAACGATAAAGCAAGGATAGATGATCCGCCTTCTGATGCACGAGTGGAGGTCAAGGTTGAAGAAGGTCTATCCGAAGTTGGAACAAGGTTGTCTACTGTGGATACCCAAGTTGAAAGTGGACATGATGTGAAAAGCATCTGTGTGGTCTCCTTACCACAGGAAGAGATTAAATCTGAAAGTCAGTCCACTCCTGTATCTGCAGGGTCCAATCGTGCTGGTTTCCGCACTCCAAATTCCAACACAGCCTCAATTAACAAATTTCCTGGTGTTGTGCTTCCCTGGGAGAAGGAAAGGGACCCAAATGTCAGAGCAGAAGCAGAACGGCATAAAGCAGATCTTTCTGCGAAAGCGAGAAAGGCGCATGAAGACTATATCTTAGAGGAGGCAGAAATTATCAAGAAATCTAAGAAAGACACGGCGGAGTGGGCCAAACGGAGCCCTCATTTAGAACCCGCAAGGCGAAAGTCTCATTGGGATTACTTGCTGCAGGAGATGGCTTGGATGGCTAACGACTTCATGCAGGAGCGTTTGTGGAAATTGGCCTCGGCTACACAATTCTGTCGATGGATTGCGGAACAAAGAGGTCAATCCTCTGTTTTGCAACTAGCAGGAATAAAGCAAAGGCAAGAAAGAGTTGCACGAGTTCTTGCTAATGCGATTAATGAATTCTGGAGATCAGTCGAGTATATTATACATAAAGACAAGAGATTGACTTTATCATCCTTGGAAAATCAAGAGAGTGTGGTTGCTATGAAGGAGGACAGTGAAGCAGTACCAATGGATGTTGACATCCCTTCTATACCTGAGGGATCAACACAGCGAGTGGAGAAACTTCCGTCCAGAAGCAGGAAACCTCTTCCTGTTCAAAATTACGCAATCCGTTTTCTTAAGGAATCGATGGGGAGTGATGTTGGAGCACAGGCAGAAGCTCCTTGCACACCTGAGCGAATCTCAGAAGCTAACAGCGTCTTAGACCCATTATGGGAAGATCAATTTCCCGAGGAACCGTTGTTTTATCTGGTTCCAGATGGTGCTTCGCGAGCATATAGAATACTGATTGAGACAGAGAGGTCTTCACTTGAGATCGAGCATGAGCAGACCCTACACGATCACGCAGCTGCGATCGCTGATGCAGAAGCAGTTGCTGAGGCTGCAGCTAACGCGGACTTCAATGTGTCGTTATCTGTGGGGGAAGGTCAACCTCTATCAGTCTTGTCTTCTCCGATGAAGGGATTAAGGGCAGAGGAAGACGAACTTGGAGGGCAGTTTTTGCCCAATGCTTTAAGTAGTATAGCGAAGAAAAAACGCAAGAATATTCTTAAGTCGAATGCATCCAAAGGTGAAGGTATATCATCGTCAGGGCCCACACATCGTCCTCCAATAGCACCCGGTCTTGATAGCACCGCTGTGGTACAATCTCCTCTTGTTACCGGTAAAAGATCTCTATCAGTTGGTCCTGGGAATATAGTTGGAAATGTTGGAAGCATTCCAACCAAGCGTATGCGCTCGGTCTCTAGTGCTCGACAGCGTGTTATGGGAACAGCTAGTCCGAATTCTTTTCCCAGTCCAGGCGGTCTTTTACAAAGGACAATATTTTCGTCCGGAGCGTTGAATTCTCATCAAGATGAAGTACGCAACTTGTGTGATGACACTGCCACAAGAATTGAAGCAGATGCAACTACAGTTAGCGTGAAAAACGGATTAGGAGCTGGGTGTAACAACTCTTTTGTGAATTCAAAATCAAAGAAGAAAAAAAAGACAAAGCATTTCAGTGGGCAATTGAGTTCTGTCAATGCTGTTAAAGGAGATGGAGCTCCTTCAGTGAATACAGCTTCCTCTACCAAAACGCCTGAAGCAGAACACCGGTCGGTTTTTGATCAGTTGAAGCGGAAAGGTGATCAAGTTAATGCGGCGTCCGTTGAGCTGGATACTGGAGGAATTGGATCTTCAGCAGACACACCTGAAACGCCCAGTTCACAAGGGCAGCAGCCATCAAAGAAAGCGAAAGTTTCAAAACAAGCTTCTGATCTCAATCCTGAAGCCGCTGCAGCTGCCATCAGTACTGCAGCAACACAGTCAGGATCGTTGGTCGCTAATACATCTTCCACAAGTAAACTTTTACGACAAAATAGCAACCGAGATCGCAACAGAAAAACCAAGTCTACCAAGGTTCCCTTAACTCAGCCAGCGGGAATCGGTATTCCTTGGTCAACCATTGAAGATCAGGCTATTTTTGCCCTTGTCCATGATCTTGGACCGAATTGGGAACTAGTCAGTGATGTTCTCAGCTCCAGCTCTCAGTTGAAGGGTATATTTCGCAAACCAAAGCAGTGTAAAGAACGATACAAGTCTCTCTTGGATCGAATGTCTGTCGGAGAAGGTGGTGATAGTCCAGAAGATCCAAGCACTTCTCAACCTCACCCTTCTACTCTTCCTGGAATTCCAAAGGGAAGTGCGAGGGTTTTGTTACAGCGTATACAAGGTCCAATGGAGGAAGATACACTCAAAGTGCACCTTGAGCACATAGTGCGCGTTGTACACAAGTTCCGTGCTCTTAAACCACCGACTGAGGAGCAAAAACTACTTGTCCAACCTCATGCATCTCACTTGAATGCAATTACTCAGTTTTGCGCGAATGGTTATCCGACTCCCTCCGATCTCTGTGAGATAACTGCGGCTGCTCCAGAATTAGGTGGTCCAGCATATCAGCTGCCAGGGCAACATCTTCCAGGTGTTTTGGCAGCAGGTTCTGGAATACGTCCTGCTACCAATGGGCTACCAGTCCTTCCTAGCGCAAGTAATCTCCACATGGGAGTACCTGCTGTGGCACCCTCAACTACTGCTGCTAGTGCTGCAAGGGATGCTGCTGTATACAGGGATGTACATCGTTTGGCTGCCATACGACCTTTTTCTCCTGAAGATGCGCAACGTGTACGATATCATCGTGCGATGGCTGCTGCGCGTGGTCTTTCGGTCTCTGGACCAACCGTAACTGCTGGCCTGCCTATGATGGGTTTACCGAGTCCCAGTGACTGTCCTGTTCCTTTGTTGGGTTCAGGTAACAACAATATCGGAATGATGGGTGGAATTAGTAGAGGTATGTCCTTGTCTAGACCTGGTCTTCCAGGGATGGGCTCACCAGGTGTTCCTGGTATCGGTCCACCTCCTCTTGGCAGCGTGTTATCAACGGGAGGAGTCGGTATCGTCAGTGCAGGTCCAACCGTGGGCCCGACAGTTGTTCCTCAGCAAGTCAACCTTATAAGACGATCCCGAGAGCAGCAGCTAGTCAGGCCGGGTCGGTCTAATGAAGATCAAAGGAGATTCATCGAAGAGCTCAAGCATCAAGCTGCTCAGGGAAATACTCAAGCTGCAACGGCCTTAAGCAGCCTTGGAAGTGAGGTGACGAGGGAAATGATGGCTGTTCAAGCCCAACCGTTTCAACAGCTGCAGCATCAAAACCATCAACAGCAGCAGCAGCAGCAGCAGTACTTAGCTGCTCGAATGGCTAAAGAGCGACAAATGCAGCAGCAACAAAAACAGAGATTGCTTCAGCAACAACTTCAGCAACCTCAGCAACCATCTTCTCTGCAACCACAATTGCAGACGCAGATGCAACAACAGCAGATGCACGGAATGTCTCAGCAACATGTTCTTCCCCAACAATCACACTTGTCCCAACAACAGCACCTGCTAAGTTCACAGCAACACAACCTCCAAAAGCAGCAATCGCAGCAAGGCCCTCAACAGACTGGTACTCTTTCATCACCATCTCTGCAACCTACGACAATTCCCTCAATGCAATCAAATCATCAACAACATCAAACATTATTACAGCCTCAACAACAAGCACCACCCTTGGGCCAGGTTCAACAACTTCCTGTACAGTCGAAGTTACAACCACCCAAGCAGGCACAGAAGCATCCGCATCTGCAGCAGGCTTCACAAGTGGTGCAGCAGCAGCCACCAAGAGGTTCTAAGGGAGTTGTTCGAGGAAACATGCTAGTTCAGGCACTACCAGGCTCTGGGCAGTCAAGTATGCTACCTGGTAATGTATCTGCCGGAAGTCAGCCCCAACAAGTGGCAGGGCAGCAAATAGCCCATTCAATGCAAGGGCAGAGGCACTTGATGCCTTTGGCAAAGCCACTTTCTCAAACGTCGACGCAGGTTATGACAGGCCAATCAGCCCATATGCAAGCTCAGCAAAATCAGTCAATGGCCGGGCCTGTCCCACAAGGATCTCTCGGTGGGTCGCAGAAGGTTGTGTCTCAGCAGCCAACTCAACTGGGTACTATGCCATCCAAGCAGTTGCAACCGTCTCCATTACCAAGTGCCCTGCCATCTCAGCAGCAGTCACCTGCACCTCCCCTTCCAACGCAGCAACAACAGACATCGCCACCAGCAGCACAGCAACCACAAATTGGTTCCTCGCAGCAGTTGCAGGTTCAACAACGTCGACCGTCCCAACAAGCACAGATCCAGTCTGCGCAAAGAAGAATTCAACAACGACAACCAGTTGCAAGTGTTGGTGCACCTATGATAGGTGTCCTGGGTAAGAATGGCTCTTCAACTCAACAAGGTCAGGTTCCTGCACAAATGTCTTCTCAGCCTGGACATGTTACTTACACACAAGGATCAAGCATGGCTGTGCCTATGAGCATGATGAGTGCAAGTTCTGGTGCTTCGGGATTATCCTCATCTGGTAGCCCAAGTTCCAGTGGGGTGCACTCCACGCCGTGGAAACCTGGACAAGTAGTTTCTCCCATGTCCTCTGGATTTTATAATCTAAGTAGGAGCGGGAGCCCAGGCGCAGCTCAACTGCCTTCTATTGTTAGCTCATCAGGAATGCACTTGGCTTCTTCTAACGGAAACAGTGGAATGTCAATAACTGGTTCTGGTCCCCCCCATGGAGTCATTGTTGGTAGTCTTTCACAACCTTTGCAAGTAGGTTCTGGTGGTCATGGATTAAAGATGGGTCTGGTTACTGGATCCAACCCGAGGGGTGTATCAACTACATTGCAAGGTGGGACTCAGCGTTCAATACAACATCATGGGAACTTACCTGCCTCTCCTGCCATTGGTGCCACGCAACAAGTGAGGTCTCCTGTTCCTGCATCTTCAGCTGGAATGATGCCAGTCTCTGCTTTGGGAACGAACACTGTCGCAGGTGTTTCCTCGTCTGGATCTATGGCCTATCAAGCAAATTCAAGCTCTCTATCGGGTCATTCTACAGCAATTTCAAACTCCATGCACATGTTTTCTGTGCAGCCCCGGCAATCACATGCAGGTAGTGCAGCAGCGACTACTCCTGCTGTACCTATGAAATCTCCTCCGACTAGTGGTACCTCGCAAACAAGTGCCGTTTCTCCCAGCAGCCCAGCCCCGGGAGGAATCCAGGACTTCAAGCGGGAAGGGGCAGCAGGTAACCATCAAGACCAGTCCTTGGAAGCCGTTGATAAATTATTACGAAAAATTGGAGACGTGGAATACTATAAGACTTTAGCCTAG

Protein

>Mapoly0075s0051.11
MGAGAGAAAAIENEPSPRRAAIEKAQAELRREVAVREERRRELEFLEKGGELLDFFSAANFALPPSSPTDPLADQLLSSEGEGGHASVALTNGDSVENSVGTSLCVGRSSEGGGDLCPGEDFLSAVIEPLTPWEGKGRASRTGSTSLRSHSDVNLKRESEGSGGGRAAVKGQAYSRRNRPRSNRFGNGHTPTRDVEKAGEVGVLPSIEIKGSPAPPVIFEEVTEENETMVDKKLQVLPAPTLLYNSHASTQLGPVTTKVIEDLEATHLPTGKSFEQNSVKAVHAADDALQTGREFQIHDLAASSCGSLQRSSDLREDVCTGIVVKDELVVVGDLKKVDQTSLSPHVEKNVDSRDGGAVSQPSEQVLGNNQAASDKACGLPSMVEDESAIVMIMDESLGSRTSKNECKDKSTVVSETKGDRVIDRSTIITKHGPDSMLTPTIDDKTSVLREVSCTMQLTPKSLDTSENKSIISRKTTSTASSGAPDLIQNDKARIDDPPSDARVEVKVEEGLSEVGTRLSTVDTQVESGHDVKSICVVSLPQEEIKSESQSTPVSAGSNRAGFRTPNSNTASINKFPGVVLPWEKERDPNVRAEAERHKADLSAKARKAHEDYILEEAEIIKKSKKDTAEWAKRSPHLEPARRKSHWDYLLQEMAWMANDFMQERLWKLASATQFCRWIAEQRGQSSVLQLAGIKQRQERVARVLANAINEFWRSVEYIIHKDKRLTLSSLENQESVVAMKEDSEAVPMDVDIPSIPEGSTQRVEKLPSRSRKPLPVQNYAIRFLKESMGSDVGAQAEAPCTPERISEANSVLDPLWEDQFPEEPLFYLVPDGASRAYRILIETERSSLEIEHEQTLHDHAAAIADAEAVAEAAANADFNVSLSVGEGQPLSVLSSPMKGLRAEEDELGGQFLPNALSSIAKKKRKNILKSNASKGEGISSSGPTHRPPIAPGLDSTAVVQSPLVTGKRSLSVGPGNIVGNVGSIPTKRMRSVSSARQRVMGTASPNSFPSPGGLLQRTIFSSGALNSHQDEVRNLCDDTATRIEADATTVSVKNGLGAGCNNSFVNSKSKKKKKTKHFSGQLSSVNAVKGDGAPSVNTASSTKTPEAEHRSVFDQLKRKGDQVNAASVELDTGGIGSSADTPETPSSQGQQPSKKAKVSKQASDLNPEAAAAAISTAATQSGSLVANTSSTSKLLRQNSNRDRNRKTKSTKVPLTQPAGIGIPWSTIEDQAIFALVHDLGPNWELVSDVLSSSSQLKGIFRKPKQCKERYKSLLDRMSVGEGGDSPEDPSTSQPHPSTLPGIPKGSARVLLQRIQGPMEEDTLKVHLEHIVRVVHKFRALKPPTEEQKLLVQPHASHLNAITQFCANGYPTPSDLCEITAAAPELGGPAYQLPGQHLPGVLAAGSGIRPATNGLPVLPSASNLHMGVPAVAPSTTAASAARDAAVYRDVHRLAAIRPFSPEDAQRVRYHRAMAAARGLSVSGPTVTAGLPMMGLPSPSDCPVPLLGSGNNNIGMMGGISRGMSLSRPGLPGMGSPGVPGIGPPPLGSVLSTGGVGIVSAGPTVGPTVVPQQVNLIRRSREQQLVRPGRSNEDQRRFIEELKHQAAQGNTQAATALSSLGSEVTREMMAVQAQPFQQLQHQNHQQQQQQQQYLAARMAKERQMQQQQKQRLLQQQLQQPQQPSSLQPQLQTQMQQQQMHGMSQQHVLPQQSHLSQQQHLLSSQQHNLQKQQSQQGPQQTGTLSSPSLQPTTIPSMQSNHQQHQTLLQPQQQAPPLGQVQQLPVQSKLQPPKQAQKHPHLQQASQVVQQQPPRGSKGVVRGNMLVQALPGSGQSSMLPGNVSAGSQPQQVAGQQIAHSMQGQRHLMPLAKPLSQTSTQVMTGQSAHMQAQQNQSMAGPVPQGSLGGSQKVVSQQPTQLGTMPSKQLQPSPLPSALPSQQQSPAPPLPTQQQQTSPPAAQQPQIGSSQQLQVQQRRPSQQAQIQSAQRRIQQRQPVASVGAPMIGVLGKNGSSTQQGQVPAQMSSQPGHVTYTQGSSMAVPMSMMSASSGASGLSSSGSPSSSGVHSTPWKPGQVVSPMSSGFYNLSRSGSPGAAQLPSIVSSSGMHLASSNGNSGMSITGSGPPHGVIVGSLSQPLQVGSGGHGLKMGLVTGSNPRGVSTTLQGGTQRSIQHHGNLPASPAIGATQQVRSPVPASSAGMMPVSALGTNTVAGVSSSGSMAYQANSSSLSGHSTAISNSMHMFSVQPRQSHAGSAAATTPAVPMKSPPTSGTSQTSAVSPSSPAPGGIQDFKREGAAGNHQDQSLEAVDKLLRKIGDVEYYKTLA

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>