Mapoly0075s0052



Description

Multidrug/pheromone exporter, ABC superfamily

Reference DB

Database ID Description
GO GO:0005524 ATP binding
GO GO:0006810 Transport
GO GO:0016021 Integral to membrane
GO GO:0016887 ATPase activity
GO GO:0042626 ATPase activity, coupled to transmembrane movement of substances
GO GO:0055085 Transmembrane transport
KOG KOG0055 Multidrug/pheromone exporter, ABC superfamily
OrthoMCL OG5_126596
PFAM PF00005 ABC transporter
PFAM PF00664 ABC transporter transmembrane region
PANTHER PTHR24221 FAMILY NOT NAMED
PANTHER PTHR24221:SF138

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpABCB2 Auxin transport Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0075s0052.1 scaffold_75:694748..703944  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0075s0052.1  

Gene structure:

mRNA scaffold_75:694748..703944  ( + strand )
five_prime_UTR scaffold_75:694748..695964  ( + strand )
CDS scaffold_75:695965..696432  ( + strand )
CDS scaffold_75:697127..697181  ( + strand )
CDS scaffold_75:697525..697700  ( + strand )
CDS scaffold_75:697975..698175  ( + strand )
CDS scaffold_75:698544..698803  ( + strand )
CDS scaffold_75:699198..699514  ( + strand )
CDS scaffold_75:699787..700010  ( + strand )
CDS scaffold_75:700199..700614  ( + strand )
CDS scaffold_75:700819..701261  ( + strand )
CDS scaffold_75:701459..701700  ( + strand )
CDS scaffold_75:702043..703260  ( + strand )
three_prime_UTR scaffold_75:703261..703944  ( + strand )

Sequences:

Gene

>Mapoly0075s0052.1
CCAGTGTGAGAGGGCTAGAAGGTGGCGGAACTGATCTGATGAGCAGTAGCGTCCTTGCCTTTATTCTGGAGGTATGCATGGGCATTGGCATGGTGAGACAGGTGGAGAGAAGGTCTGCTTTTCGCAGAGCCATGGTGCGCGTTTTCAGAGCCGAGCTTGCTGACATCTTCGTTCTCGACCGCTTTCTCCGTGCCGCTGCCTGAAATTGCGTGTCATGTCTTTTCAGCATACTGTAGTTGCTTCAGGGCAAAGCGCGGTGTGCGGAGAGCCGGAGTGAGAGGCGGGAGCCAATCAGAGAACACAGGCTCTGTGTTGAGAACTTGAGCTGCACTGCGTGAACGAGAAGAGAGTAGCGGTAATATCGTCTGCATGCAGTCCTGCGTCTGCCTCTTTCCAGGATCGTCATAGATCCAGGGAGCGAAGTCCTTCGAGCTGACTGCTCCGTCCCTGTGTCCGCACGTATTCTGTGCCCCTTGTTGTGTCTCTGAACCCCTAGTGTACTTTGGCTTGACACCCGACATTCCATTTCAGACACATTTTGCTTCATTGTATTCGAGAACCTCGTCAACGATGCCGGTGCACACGTCTCCCTCTTCGTCCTGTTGATCGTTCTGGTCATGTGACACCAGCTCATTTGACGAATATGTGTCTTGCACCGCCCTTACATTCCTGAACCTTTCCAGATTGCTGGAGAGTTTCTTGTCTTGTGTCCATGAACGTGAGCTTTTCTTCGTAGACTTACTCTCGTGGTATACTGTCAAAGGAGTTGGCCGCCACTTTGCATACCTCTCATTGCATTTGCTCCTTTCAATCTTCGGGTGTCAATCTGCAAGATGGAGACCTTTCTAGCGCTTGTCGGTTAAGCTTCAGCACTGCAAGCCTCCAACAGCTCCTTGACAGTATGACAAACTGCAAGCAAACAGAGATTCTGATTTAAAATACGGCATTCTGCGTGCCTTCCTGTAAACGTTCCATGTGTTTTTCTCCTCATAGTAAACCTGTGTCACAGAAATGGCCGAGATAATTTGTTTGTCTCAGTGATGCTCTTTACGAAGAAATCTTCAGGCAATTTTGCTCTCTTGCTGAGCATACAGGTTCTGCTTCCATTGGTAATGCACTGCATTCCAATGAAGCTGGGCCTCTTTCTCTTTCGCTGCTGAGCACTTCTGGGTTCTTCAAATATTCAGTCCAGCCGCCAAAATTTTTCTAAGTCGGGAATGCAATTTGGAGCTGGCCTGAAGGACGGACAAATGAGCAGGTACAGCGAAAACCATGATAGCCGTGGCGAGAGGCCTCGAAAAGAGCCCTCTGACAATGGAGGCTCTTTCCTTGGTATGGGACAACAGGTATATCCAGGGCATCCGAATTCCCAACAGCCTCCTAAGTTCGACGAGGCGATAGAGATGGTCAGATCGCAGCAGGAAAAAGACGTGGATCGCGGTGTTGACAGTGCCGAGAACAATGAAGCTGAGAAGAAGAAGAAAGAAAAGAAGCCGAGCGTGTCGTACTACAAGCTTTATTCTTTCTCTGATCCTTTTGACTGGCTGCTAATTTTTTTGGGTACGGGCGGAGCCTGCGCGCATGGAGCCGCAATTCCCGTTTTCTTCATATTTTTCGGTAAACTTATCGATGCATTTGGAGTTAACTACAATCGCCCAGACCTCATGGCAGAGGAAGTGAGAAAGGTGCATTCCTGTAGCTGATGCTAATCACTTTGAGGTTATATTGTACATAGCTTTAAATTCAGAATAAATCTTTCTCGATAACCTCAGATTGGAGAACTTAGCTCGTACCGCTCTAGCAAGACGAAGATCACTTGTTTCCAAGCGTTTCATTTCCAACGCCACAGCTAGAATTAGCGTGGACGGTGTACGGGTATTCTTGATGCACCAGCTTGTATCCACAGTCGGGCCCGAGAGTTTCTTCAAGTGAAGCTTCTGAAAGTTCTATCCTGAAGATATGCATTTCTGCGTTGTAAATCCTCTAAAACTGTAATTCGAGTTACCTCCAGTCCAGTAATAACGATCATGCTTCGCTAGAAAAATAGCCCATTCAGCCTTAAGAAGCGGAAGAATTGAGAAAATTGTGAATTATCCTCCCTGTGTCATGTTGCCACTTGAGTCAGAGTCGAGCTATTTCAGTTTAAACTGGGGAGGTTTCTCCCGGCGTCACGAGCGTTTTCGTTTGCCCACTCCCTTGTCCTCCATCGGTCGTCTCTCTGGACACACAATTTATGGGCTGAGTGGTGAACTTTTTCAAAACAAGAGTGTTGCCCCTAGCACTAAAAGCAGGTTCTGTACACGCTCTCTCACTCCCAAGTGCTCTTCTTTTGGTACACAATACTTGCCTACATTTACAATTGTGCCGTCTGCTGTGCAGTATTCCCTGTACTTCGTCATACTTGGAGGCGTTGTCATGATTGCCGCTTGGCTCGGTAAGCACTCAATTATTACCTGCATGCACATTTTCGCCTTCTCCAAGCGTGAAGAGTAGGTCCGCTCTTTCCAGTAAATTTGCTGGTTTTGTGGCTTCTAGCGGAGTACGTCTAAGATTTGTACAGAATCTTTAAATCTAAACATGTTCCTCACTTACTTATGTTCCCTCCCTGTTTCATCATACAAATGCACGAGTTTGGACATTGTTCTTTTGCACACTGGCTTCAAGCTGTTTTTTCGTTAAACAACGGGATGGGAGTCCCTAGGAGCTGGTCCAGTCTTTGCGAAGTTGGAACTGTTTCTTGACTTTTTCGTCGTATCGGTTTTTGTACCACCGTGCAGAGGTCGCCTGCTGGATGTGGACAGGTGAAAGACAGTCCGCTAAAATGAGGGCAAAGTATCTGAAGGCAATGCTTAGTCAGGACGTGGGTTTTTTCGATACAGATATCACCACCGGTGAAATTGTTAGCAGAATCTCGAGTGATACCATTCTGGTTCAGGAAGCCATCAGTGAAAAGGTTTGTTACGAATTTAAACCATTGTTTTGGTCTTATGCTTACTACTTGAATTTACCTTAGTTCTGCAGACGGCGAACTCCACCCTTCGTTAAATTGCCACCCATTTCTTTGATATTTGTTACTGCTTACGTAGTGCCGAAACGCCAAATGAATTGATAAACTGCAACCAACAGTTACCGAAGTATTTCTGGTTTGGTCCCCGGCTCCTAGAATCACTTTCTTCCAAGGTATGTGATTTCTTACAGTATTCGGTTGACTAAACTCTTATTTGCAGGCTGGAAACTACGTACACTACATGGCTAGGTTTGTCGCAGGATTTGCAGTGGGATTCACCTCTGTGTGGCAGCTCACACTGGTCACACTAGCAGTTGTACCTCTCATTGCCGTGGCAGGAGGAGCCTATGCTGTGACAATGATCGGACTAACCAGCAAAAGTCAAAAGGCCTACGCTAAAGCTGGAGAAATAGCAGAGCAGGTAACTCTCTGTCTTGATCCAATATATGGAACGTTTCCATCATTGCAAGGTGAATACGTTGAAGCAGCAAAACAAGTGTGCAAACAGTGAAGTGCAAAGCTGTCGCTCTTCAATGAAATATGGATCTGCTCAAAGATGAAGAAATTAATAGTATCGAGGGCAGAACTGTTGGACACTTTCATCTAGCTGCTTGCGCCGTTCACAAATTCGGTTACAAGATAGTTGTTAAATTCCCGGAGTCGGTTTCGTCCCTACCCTTTTTAATGCAAAGTCGTACATGAAGAAGCTCCACAAGGTGAAAGTTCAGTACATATCTCAGGCTGATTTTGTACATGCCACTAACTTACAATTCACTTCGATCTTCTCAGGCCATCGCCCAGATTCGGACCGTGTACGCATTTGTAGGAGAGGCGAGGTCGGTCGAATCTTACTCAGAAGCACTTAAAACCACCTTGAAACTTGGGAGAAAGGGAGGGATGGCTAAGGGTCTGGGAGTTGGGTTCACCTATGGATTACTATTTGGAGCCTGGGCTCTTCTCCTGTGGTATGCAAGTTTACTCGTTATGGATGGGAAAACCAACGGGGGCCAAGCATTTACAACCATTCTCAACGTCATTATCAGCGGGATGTAAGTTGCAACCTCAGCAAGTCTACTGTGACGCTGTTCTAGAACAAGAAGGCTTATCAATCAGGGCCAACCAGATTGATATAGTTTCAACATAGTTCACATATTGAAATTAGAAGATATTCCTGTCGCAGAACTTCATTTGGTTATATAACAGGCGTTTGACGAGAATTAGGCAGTGGATTCCTTGTTTTCCTCGGAAAGCAGGTTGTTTCCCGTTTACTCAGTGCTTACAGCTAGAATGTTAACGTGTGTGCTACCCTCTTCGATATTTGATCCTATTATGTAGCAACTAATTACAACTTCTCGAGCTCCGTAGAGGTAGTGCGCCTGTGTTTCTCTTTATTCATCACTAGAACTCGTTACTCTCTACTTACAGTGTTTCCACCGTGTACAGTGCACTTGGCCAGGCTGCGCCTAATCTTACGACGTTTGGAAAGGGAAAGGCTGCGGGCTACAATATTTTGGAGATGATCAAGAGGAAGCCCGCAGTAAATGCCAACTTTTTGGACGGACGAACGTTACCACATGTCGAAGGACAAATAGAACTGCGGGATATTACGTTCAGCTATCCTTCACGTCCTGATCAGATGATCTTTCAGAATTTTAATCTCACTATCCCTGCAGGAGCCACTGTAGCGATTGTGGGTAGCAGTGGGTCTGGGAAGAGCACAGTCATAGCTCTAATTGAGAGGTTCTACGACCCCATATCTGGTAAGAACTAACATAATTGCAGTCGGTTTGTTTATTACTTGTTTAATTCTACACTATTAATTCTACATCAGGCATTGCGTGTAGAAGGGTAAGCAGATGAGGCGTGTCGTTCAAGCGTATGCCTCTTTTTGCTGCTTATCACTTTGATATGTAATCGTTTCTCCAGTTGGGGTTTGTCCTCTTTTCTCACAAGTGTGATTAGAACTGTCAAAACAGTACATCTGCTCATTTTCCTTCCAACGCTGACAGCTCTTGTTTGTACCTTATGAAAGGTAGTATATTTCTCGACGGTGCCGACATCCAGTCCTTACAACTGAAATGGTTAAGAGATCAGCTTGGACTCGTGAACCAAGAACCCGCGTTATTTGCGACAACCATTCTAAATAACATTTTATATGGGAAAGACGGTGCAACCATGCAAGAGGTCGAAGATGCGGCCAAAGCTGCCAATGCTCACTCTTTCATCATGACTTTACCGGAAACTTATGACACCCAGGTTTGTACTTTTTAACAAGTCAAAGGAAATTTCGGGTTCTCACGTCAACGAAATTGATGTTTGTCTCAAGGTTAACACTATTCGAACTAGACTGGTTGAGCTTTTAAATGTTGACGGTCGGTGTGGGCATGCAACCTATGTACTCGTCAATATATATATTCAATCCAGTAATATCCTGTTTGACGCAGGTTGGTGAAAGAGGAGTCCAAATGTCTGGGGGACAAAAGCAGCGTATAGCTATTGCCAGAGCGATGTTGAAGCATCCCTCTATTTTGCTTCTAGATGAAGCAACAAGTGCACTAGATGCAGCATCGGAAGGTGTGGTTCAGGAAGCCTTGGACTCTCTTATGGTCGGCAGAACTACCATCATTGTGGCGCACCGCTTGTCCACCATCCGCAATGCAGACATGATTGCTGTGGTCAGGGAGGGCAAGATTGTTGAAACTGGTACTCACGATGATCTTATAGAGAAGAACGGTGCTTTCGCAATGCTTGTAAAATTGCAGGAGAGAGCGAAGTACCAACCCAATCAGTCGAACAGGCACACCAAGAGTCAAAGTCAGAGTAGTTACGGAGATGGACCTTCTGTGTCTTTCAATTCCAGGTACGTCAGCCAGCGTACTTCCGAGACGATAGGCGAGGAAGTAGGCTTGCTTAACTCCACTTCCTTTTCGATTGACAGTCATTTGTTTGCACTTAGTTATCCGTCCGGTTTCCCTCAAGTAAGGCTTTGAAAGCTCGCACTTGAAAGAGGAGTGTCTAAAGTTTTGTGGATAGGTGCTGATGCCTTCGTCCGGTGGTTTTGCAGACACTCCTCTGGTCGACTCTCGAACCGATGGAGCAATAGGTGGAGCTTTCGGAAAGGACAGAGGAGTGGTAATGACACGGAATCAGATGCCGGCGGTGAGAACGAGTTCGAAGAGCTGACTGCTCCCGAGCACGTTGTGCCAAAGCCATCGTTGTGGCGGCTTTTCAGACTCAACTCCCCAGAGTGGCCATACGCCGTACTTGGGACTCTCGGTGCTATCATGGCTGGTGGAGAAACTCCACTTTTCGCGCTTGCCATCACTCAGATGCTCATCACTTTTTATAATCCTGATCAAGACTTTATCAAGAGTGAAGTACGAAGAATCTGCACAATTTTTAGTGCCGCAACAGTTGTGACGGTTCTTATCTACATTCTGCAGCATTACTACTACGGAATTATGGGAGAGCGCCTAACTATGCGTGTCAGAGAAATGATGTTCAAATGTGAGTCCGCTTGCAGATTTATGTTTATGCTTCTCTTTGGCGGATTATGTACAGTTCACGGCGCACAAAGACGCCAATCGCGAGTGATTCTGGTGGCAAACGAAATTCTGTATTATATTCAAATGTAATATTGGAAGATTCCTAGTTGATGATACTCGTTTGATTCCTGACAAGTGTCTTTGTGTTTATTGTGGCAGCTATCCTTACTTTCGAAATAGGATGGTTCGATTACGATGAAAATAACAGCAGTTTGGTGGCATCTCGACTCGCGTCAGACGCAACCCTGGTCAGAGCTGCAGTCGGTGATCGATTGTCCACGATAGCTCAAAACTTGGCTTTAGTGACCACAGCCTTCGTGATTGCCTTTGTTCTCTGCTGGAAGGTTACGTTTGTCATATTGGCCACATTTCCTTGCCTCATTGGGGCTGCTATTGCAGAGGTGAGTTCGGGACCTGGAGCGGAAGCCTGTCGTCATGTTTGAGTCAGCTATATACTAACAAACTAGCTCAGCTGCAGGATTGAATCTAACTTGGATGTGCATTCCCGCCCCTGAATGATAATTAGAGTTGCTTGTGATAACTCAGAACGGCATTGAGAGTGAGGAGTGGAGTAGTGGCAGTTTTGACAAGCGGAAAGCAGCATGAAGCATCTGCTCACTCTCTTCGTTATCGTTATGTCTTTCATTTGTGAATTTTTTCTAAGAATATGTTGTACTTAGTTAGAGAGTTCTCGATCGAGTTTCAGTCAATAATTCGCTGACAAAACCTCTATTTGTACGCAGCAACTCTTCTTGAAGGGCTTTGGCGCGGATTTGGCCAAGGCCTATGCTCGGGCTAGCATGGTCGCTGGTGAAGCAGTGGGAAACATCCGAACAGTTGCTGCTTTCTGTGCTGAGGAGAAGGTGCTTGAACTCTTCCAATTCGAGTTAGCCCAACCTGCTAAGAAGTCCATTATGCGTGGACAAATCGCTGGATTCGGATATGGATTCTCCCAATTCACCATGTACAGTTCTTACGGTTTAGCCTTCTGGTATGCGTCAAAACTGGTGGCCAGCGGTGAAGCGAAATTCGGGGACATCATGAAAACTTTCATGGTGCTGGTCATTACTGCCTTCGGCGTCGCAGAGACCCTGGCTCTTGCACCGGATATCGTGAAGGGCTCTCACGCCGTTGTCTCAGTATTCCAGGTCCTGGATCGTCAGACTGAAATTGATCCCGAGGATCCGAATGCAGAAGAGGTGGTTCACATTACAGGAGATATAGAGTTGAAGCACGTCGACTTCGCCTATCCTTCCAGACCGGATGTTCAAATTTTTAAGGACTTCCGACTGAAGGTGAAGTCAGGGCAGAGCTTGGCTTTAGTCGGAGCTAGTGGTTCAGGAAAGAGCTCCATAATATCCTTGATAGCCAGATTTTATGACCCTTCAGCAGGAAAGGTGCTTATCGACGGAGTGGACATAAAAAAGCTGCGATTGCGTTCATTACGACGCCACATCGGGCTCGTGCAACAAGAGCCTGCTCTCTTTGCCACTACGATATACGGCAACATACTCTACGGGAAGGATTCGGCAGGCGAAAGCGAGGTGATTGAAGCTTCCAAGTCAGCTAACGCGCACACTTTCATAAGTGGCCTTCCCAGTGGTTACCAAACCGATGTCGGAGAGAGAGGAGTCCAGCTTTCGGGAGGACAAAAACAAAGAGTAGCCATAGCTCGTGCGGTGCTGAAGAACCCGGCTATCTTACTCCTGGACGAGGCTACGAGTGCGTTGGATGCCCAGTCTGAGAAAGTAGTCCAAGATGCTCTGGATAGGCTGATGCGTGGTCGTACGACCGTGATGATTGCTCATAGGTTATCCACCATTAAGAATGCGGACGTGATCGCAGTAGTGGACGGCGGGCACATAGTGGAATTAGGAAACCACGATTACCTGATGAACAAATCTGGCGGTATCTATGCTCAGTTAGTGAATATGCAACAGAATACCGACACCGAGAGGTGACGGAGGTGACTAGGTGGAGAGTCAACAAGAATCTCCAACGGAGCTTTGAAGAATGCTGTCCTTGTGCGGGACGATCGACCACTGAGTATCTCGGGAAGTCACGATGCCCATATCGTTGTTTATCCAGGAAAGTTTGTATCATCTTTTGCAGAGGAGATATGGAAGGAAGCTGCACTCCCCTTTTAAATAACAGATCTAAGACGGACGGACGGGGGTTAGTTAAGGACGCGGAAGACCGGCAATTTTATTGACCAATCATCGAGAAATACGAGGGTCTTCGGAGATGTGGGTTAATGTAGTTCTGTCAAGCTTTCAGCTTTATTGCAGAGAAGTGTGCTTCCATCAAGAGCTCCTCTCTTTGGGTCAGAACTACTTTAACCCACTAGATTTTACACCTCAGTCACATAGCACGTGACCGTTCCAGTGACGAGAAGAAGATGTCGTGTTCCGTCTTTCCTGGATGGTCATTACGAGCTTTACACAGCCAGGCCTGCGGTGATTAGATAGGTTCGATCGAATTGATTGGGCTCCTCGGGCCTGAGTCCTGTACTCGCAAAGAGCTAGAAGCACAGGAATCTTACATTCAAGCCATTGCTATTGTAACAGTCACCACAGTTTGTATATGCCAGTCAACTGGAAATGAATTCTACTCTTAACAACGGGCAGTGTTCTTATGCTGTCATC

mRNA

>Mapoly0075s0052.1
CCAGTGTGAGAGGGCTAGAAGGTGGCGGAACTGATCTGATGAGCAGTAGCGTCCTTGCCTTTATTCTGGAGGTATGCATGGGCATTGGCATGGTGAGACAGGTGGAGAGAAGGTCTGCTTTTCGCAGAGCCATGGTGCGCGTTTTCAGAGCCGAGCTTGCTGACATCTTCGTTCTCGACCGCTTTCTCCGTGCCGCTGCCTGAAATTGCGTGTCATGTCTTTTCAGCATACTGTAGTTGCTTCAGGGCAAAGCGCGGTGTGCGGAGAGCCGGAGTGAGAGGCGGGAGCCAATCAGAGAACACAGGCTCTGTGTTGAGAACTTGAGCTGCACTGCGTGAACGAGAAGAGAGTAGCGGTAATATCGTCTGCATGCAGTCCTGCGTCTGCCTCTTTCCAGGATCGTCATAGATCCAGGGAGCGAAGTCCTTCGAGCTGACTGCTCCGTCCCTGTGTCCGCACGTATTCTGTGCCCCTTGTTGTGTCTCTGAACCCCTAGTGTACTTTGGCTTGACACCCGACATTCCATTTCAGACACATTTTGCTTCATTGTATTCGAGAACCTCGTCAACGATGCCGGTGCACACGTCTCCCTCTTCGTCCTGTTGATCGTTCTGGTCATGTGACACCAGCTCATTTGACGAATATGTGTCTTGCACCGCCCTTACATTCCTGAACCTTTCCAGATTGCTGGAGAGTTTCTTGTCTTGTGTCCATGAACGTGAGCTTTTCTTCGTAGACTTACTCTCGTGGTATACTGTCAAAGGAGTTGGCCGCCACTTTGCATACCTCTCATTGCATTTGCTCCTTTCAATCTTCGGGTGTCAATCTGCAAGATGGAGACCTTTCTAGCGCTTGTCGGTTAAGCTTCAGCACTGCAAGCCTCCAACAGCTCCTTGACAGTATGACAAACTGCAAGCAAACAGAGATTCTGATTTAAAATACGGCATTCTGCGTGCCTTCCTGTAAACGTTCCATGTGTTTTTCTCCTCATAGTAAACCTGTGTCACAGAAATGGCCGAGATAATTTGTTTGTCTCAGTGATGCTCTTTACGAAGAAATCTTCAGGCAATTTTGCTCTCTTGCTGAGCATACAGGTTCTGCTTCCATTGGTAATGCACTGCATTCCAATGAAGCTGGGCCTCTTTCTCTTTCGCTGCTGAGCACTTCTGGGTTCTTCAAATATTCAGTCCAGCCGCCAAAATTTTTCTAAGTCGGGAATGCAATTTGGAGCTGGCCTGAAGGACGGACAAATGAGCAGGTACAGCGAAAACCATGATAGCCGTGGCGAGAGGCCTCGAAAAGAGCCCTCTGACAATGGAGGCTCTTTCCTTGGTATGGGACAACAGGTATATCCAGGGCATCCGAATTCCCAACAGCCTCCTAAGTTCGACGAGGCGATAGAGATGGTCAGATCGCAGCAGGAAAAAGACGTGGATCGCGGTGTTGACAGTGCCGAGAACAATGAAGCTGAGAAGAAGAAGAAAGAAAAGAAGCCGAGCGTGTCGTACTACAAGCTTTATTCTTTCTCTGATCCTTTTGACTGGCTGCTAATTTTTTTGGGTACGGGCGGAGCCTGCGCGCATGGAGCCGCAATTCCCGTTTTCTTCATATTTTTCGGTAAACTTATCGATGCATTTGGAGTTAACTACAATCGCCCAGACCTCATGGCAGAGGAAGTGAGAAAGTATTCCCTGTACTTCGTCATACTTGGAGGCGTTGTCATGATTGCCGCTTGGCTCGAGGTCGCCTGCTGGATGTGGACAGGTGAAAGACAGTCCGCTAAAATGAGGGCAAAGTATCTGAAGGCAATGCTTAGTCAGGACGTGGGTTTTTTCGATACAGATATCACCACCGGTGAAATTGTTAGCAGAATCTCGAGTGATACCATTCTGGTTCAGGAAGCCATCAGTGAAAAGGCTGGAAACTACGTACACTACATGGCTAGGTTTGTCGCAGGATTTGCAGTGGGATTCACCTCTGTGTGGCAGCTCACACTGGTCACACTAGCAGTTGTACCTCTCATTGCCGTGGCAGGAGGAGCCTATGCTGTGACAATGATCGGACTAACCAGCAAAAGTCAAAAGGCCTACGCTAAAGCTGGAGAAATAGCAGAGCAGGCCATCGCCCAGATTCGGACCGTGTACGCATTTGTAGGAGAGGCGAGGTCGGTCGAATCTTACTCAGAAGCACTTAAAACCACCTTGAAACTTGGGAGAAAGGGAGGGATGGCTAAGGGTCTGGGAGTTGGGTTCACCTATGGATTACTATTTGGAGCCTGGGCTCTTCTCCTGTGGTATGCAAGTTTACTCGTTATGGATGGGAAAACCAACGGGGGCCAAGCATTTACAACCATTCTCAACGTCATTATCAGCGGGATTGCACTTGGCCAGGCTGCGCCTAATCTTACGACGTTTGGAAAGGGAAAGGCTGCGGGCTACAATATTTTGGAGATGATCAAGAGGAAGCCCGCAGTAAATGCCAACTTTTTGGACGGACGAACGTTACCACATGTCGAAGGACAAATAGAACTGCGGGATATTACGTTCAGCTATCCTTCACGTCCTGATCAGATGATCTTTCAGAATTTTAATCTCACTATCCCTGCAGGAGCCACTGTAGCGATTGTGGGTAGCAGTGGGTCTGGGAAGAGCACAGTCATAGCTCTAATTGAGAGGTTCTACGACCCCATATCTGGTAGTATATTTCTCGACGGTGCCGACATCCAGTCCTTACAACTGAAATGGTTAAGAGATCAGCTTGGACTCGTGAACCAAGAACCCGCGTTATTTGCGACAACCATTCTAAATAACATTTTATATGGGAAAGACGGTGCAACCATGCAAGAGGTCGAAGATGCGGCCAAAGCTGCCAATGCTCACTCTTTCATCATGACTTTACCGGAAACTTATGACACCCAGGTTGGTGAAAGAGGAGTCCAAATGTCTGGGGGACAAAAGCAGCGTATAGCTATTGCCAGAGCGATGTTGAAGCATCCCTCTATTTTGCTTCTAGATGAAGCAACAAGTGCACTAGATGCAGCATCGGAAGGTGTGGTTCAGGAAGCCTTGGACTCTCTTATGGTCGGCAGAACTACCATCATTGTGGCGCACCGCTTGTCCACCATCCGCAATGCAGACATGATTGCTGTGGTCAGGGAGGGCAAGATTGTTGAAACTGGTACTCACGATGATCTTATAGAGAAGAACGGTGCTTTCGCAATGCTTGTAAAATTGCAGGAGAGAGCGAAGTACCAACCCAATCAGTCGAACAGGCACACCAAGAGTCAAAGTCAGAGTAGTTACGGAGATGGACCTTCTGTGTCTTTCAATTCCAGACACTCCTCTGGTCGACTCTCGAACCGATGGAGCAATAGGTGGAGCTTTCGGAAAGGACAGAGGAGTGGTAATGACACGGAATCAGATGCCGGCGGTGAGAACGAGTTCGAAGAGCTGACTGCTCCCGAGCACGTTGTGCCAAAGCCATCGTTGTGGCGGCTTTTCAGACTCAACTCCCCAGAGTGGCCATACGCCGTACTTGGGACTCTCGGTGCTATCATGGCTGGTGGAGAAACTCCACTTTTCGCGCTTGCCATCACTCAGATGCTCATCACTTTTTATAATCCTGATCAAGACTTTATCAAGAGTGAAGTACGAAGAATCTGCACAATTTTTAGTGCCGCAACAGTTGTGACGGTTCTTATCTACATTCTGCAGCATTACTACTACGGAATTATGGGAGAGCGCCTAACTATGCGTGTCAGAGAAATGATGTTCAAATCTATCCTTACTTTCGAAATAGGATGGTTCGATTACGATGAAAATAACAGCAGTTTGGTGGCATCTCGACTCGCGTCAGACGCAACCCTGGTCAGAGCTGCAGTCGGTGATCGATTGTCCACGATAGCTCAAAACTTGGCTTTAGTGACCACAGCCTTCGTGATTGCCTTTGTTCTCTGCTGGAAGGTTACGTTTGTCATATTGGCCACATTTCCTTGCCTCATTGGGGCTGCTATTGCAGAGCAACTCTTCTTGAAGGGCTTTGGCGCGGATTTGGCCAAGGCCTATGCTCGGGCTAGCATGGTCGCTGGTGAAGCAGTGGGAAACATCCGAACAGTTGCTGCTTTCTGTGCTGAGGAGAAGGTGCTTGAACTCTTCCAATTCGAGTTAGCCCAACCTGCTAAGAAGTCCATTATGCGTGGACAAATCGCTGGATTCGGATATGGATTCTCCCAATTCACCATGTACAGTTCTTACGGTTTAGCCTTCTGGTATGCGTCAAAACTGGTGGCCAGCGGTGAAGCGAAATTCGGGGACATCATGAAAACTTTCATGGTGCTGGTCATTACTGCCTTCGGCGTCGCAGAGACCCTGGCTCTTGCACCGGATATCGTGAAGGGCTCTCACGCCGTTGTCTCAGTATTCCAGGTCCTGGATCGTCAGACTGAAATTGATCCCGAGGATCCGAATGCAGAAGAGGTGGTTCACATTACAGGAGATATAGAGTTGAAGCACGTCGACTTCGCCTATCCTTCCAGACCGGATGTTCAAATTTTTAAGGACTTCCGACTGAAGGTGAAGTCAGGGCAGAGCTTGGCTTTAGTCGGAGCTAGTGGTTCAGGAAAGAGCTCCATAATATCCTTGATAGCCAGATTTTATGACCCTTCAGCAGGAAAGGTGCTTATCGACGGAGTGGACATAAAAAAGCTGCGATTGCGTTCATTACGACGCCACATCGGGCTCGTGCAACAAGAGCCTGCTCTCTTTGCCACTACGATATACGGCAACATACTCTACGGGAAGGATTCGGCAGGCGAAAGCGAGGTGATTGAAGCTTCCAAGTCAGCTAACGCGCACACTTTCATAAGTGGCCTTCCCAGTGGTTACCAAACCGATGTCGGAGAGAGAGGAGTCCAGCTTTCGGGAGGACAAAAACAAAGAGTAGCCATAGCTCGTGCGGTGCTGAAGAACCCGGCTATCTTACTCCTGGACGAGGCTACGAGTGCGTTGGATGCCCAGTCTGAGAAAGTAGTCCAAGATGCTCTGGATAGGCTGATGCGTGGTCGTACGACCGTGATGATTGCTCATAGGTTATCCACCATTAAGAATGCGGACGTGATCGCAGTAGTGGACGGCGGGCACATAGTGGAATTAGGAAACCACGATTACCTGATGAACAAATCTGGCGGTATCTATGCTCAGTTAGTGAATATGCAACAGAATACCGACACCGAGAGGTGACGGAGGTGACTAGGTGGAGAGTCAACAAGAATCTCCAACGGAGCTTTGAAGAATGCTGTCCTTGTGCGGGACGATCGACCACTGAGTATCTCGGGAAGTCACGATGCCCATATCGTTGTTTATCCAGGAAAGTTTGTATCATCTTTTGCAGAGGAGATATGGAAGGAAGCTGCACTCCCCTTTTAAATAACAGATCTAAGACGGACGGACGGGGGTTAGTTAAGGACGCGGAAGACCGGCAATTTTATTGACCAATCATCGAGAAATACGAGGGTCTTCGGAGATGTGGGTTAATGTAGTTCTGTCAAGCTTTCAGCTTTATTGCAGAGAAGTGTGCTTCCATCAAGAGCTCCTCTCTTTGGGTCAGAACTACTTTAACCCACTAGATTTTACACCTCAGTCACATAGCACGTGACCGTTCCAGTGACGAGAAGAAGATGTCGTGTTCCGTCTTTCCTGGATGGTCATTACGAGCTTTACACAGCCAGGCCTGCGGTGATTAGATAGGTTCGATCGAATTGATTGGGCTCCTCGGGCCTGAGTCCTGTACTCGCAAAGAGCTAGAAGCACAGGAATCTTACATTCAAGCCATTGCTATTGTAACAGTCACCACAGTTTGTATATGCCAGTCAACTGGAAATGAATTCTACTCTTAACAACGGGCAGTGTTCTTATGCTGTCATC

CDS

>Mapoly0075s0052.1
ATGCAATTTGGAGCTGGCCTGAAGGACGGACAAATGAGCAGGTACAGCGAAAACCATGATAGCCGTGGCGAGAGGCCTCGAAAAGAGCCCTCTGACAATGGAGGCTCTTTCCTTGGTATGGGACAACAGGTATATCCAGGGCATCCGAATTCCCAACAGCCTCCTAAGTTCGACGAGGCGATAGAGATGGTCAGATCGCAGCAGGAAAAAGACGTGGATCGCGGTGTTGACAGTGCCGAGAACAATGAAGCTGAGAAGAAGAAGAAAGAAAAGAAGCCGAGCGTGTCGTACTACAAGCTTTATTCTTTCTCTGATCCTTTTGACTGGCTGCTAATTTTTTTGGGTACGGGCGGAGCCTGCGCGCATGGAGCCGCAATTCCCGTTTTCTTCATATTTTTCGGTAAACTTATCGATGCATTTGGAGTTAACTACAATCGCCCAGACCTCATGGCAGAGGAAGTGAGAAAGTATTCCCTGTACTTCGTCATACTTGGAGGCGTTGTCATGATTGCCGCTTGGCTCGAGGTCGCCTGCTGGATGTGGACAGGTGAAAGACAGTCCGCTAAAATGAGGGCAAAGTATCTGAAGGCAATGCTTAGTCAGGACGTGGGTTTTTTCGATACAGATATCACCACCGGTGAAATTGTTAGCAGAATCTCGAGTGATACCATTCTGGTTCAGGAAGCCATCAGTGAAAAGGCTGGAAACTACGTACACTACATGGCTAGGTTTGTCGCAGGATTTGCAGTGGGATTCACCTCTGTGTGGCAGCTCACACTGGTCACACTAGCAGTTGTACCTCTCATTGCCGTGGCAGGAGGAGCCTATGCTGTGACAATGATCGGACTAACCAGCAAAAGTCAAAAGGCCTACGCTAAAGCTGGAGAAATAGCAGAGCAGGCCATCGCCCAGATTCGGACCGTGTACGCATTTGTAGGAGAGGCGAGGTCGGTCGAATCTTACTCAGAAGCACTTAAAACCACCTTGAAACTTGGGAGAAAGGGAGGGATGGCTAAGGGTCTGGGAGTTGGGTTCACCTATGGATTACTATTTGGAGCCTGGGCTCTTCTCCTGTGGTATGCAAGTTTACTCGTTATGGATGGGAAAACCAACGGGGGCCAAGCATTTACAACCATTCTCAACGTCATTATCAGCGGGATTGCACTTGGCCAGGCTGCGCCTAATCTTACGACGTTTGGAAAGGGAAAGGCTGCGGGCTACAATATTTTGGAGATGATCAAGAGGAAGCCCGCAGTAAATGCCAACTTTTTGGACGGACGAACGTTACCACATGTCGAAGGACAAATAGAACTGCGGGATATTACGTTCAGCTATCCTTCACGTCCTGATCAGATGATCTTTCAGAATTTTAATCTCACTATCCCTGCAGGAGCCACTGTAGCGATTGTGGGTAGCAGTGGGTCTGGGAAGAGCACAGTCATAGCTCTAATTGAGAGGTTCTACGACCCCATATCTGGTAGTATATTTCTCGACGGTGCCGACATCCAGTCCTTACAACTGAAATGGTTAAGAGATCAGCTTGGACTCGTGAACCAAGAACCCGCGTTATTTGCGACAACCATTCTAAATAACATTTTATATGGGAAAGACGGTGCAACCATGCAAGAGGTCGAAGATGCGGCCAAAGCTGCCAATGCTCACTCTTTCATCATGACTTTACCGGAAACTTATGACACCCAGGTTGGTGAAAGAGGAGTCCAAATGTCTGGGGGACAAAAGCAGCGTATAGCTATTGCCAGAGCGATGTTGAAGCATCCCTCTATTTTGCTTCTAGATGAAGCAACAAGTGCACTAGATGCAGCATCGGAAGGTGTGGTTCAGGAAGCCTTGGACTCTCTTATGGTCGGCAGAACTACCATCATTGTGGCGCACCGCTTGTCCACCATCCGCAATGCAGACATGATTGCTGTGGTCAGGGAGGGCAAGATTGTTGAAACTGGTACTCACGATGATCTTATAGAGAAGAACGGTGCTTTCGCAATGCTTGTAAAATTGCAGGAGAGAGCGAAGTACCAACCCAATCAGTCGAACAGGCACACCAAGAGTCAAAGTCAGAGTAGTTACGGAGATGGACCTTCTGTGTCTTTCAATTCCAGACACTCCTCTGGTCGACTCTCGAACCGATGGAGCAATAGGTGGAGCTTTCGGAAAGGACAGAGGAGTGGTAATGACACGGAATCAGATGCCGGCGGTGAGAACGAGTTCGAAGAGCTGACTGCTCCCGAGCACGTTGTGCCAAAGCCATCGTTGTGGCGGCTTTTCAGACTCAACTCCCCAGAGTGGCCATACGCCGTACTTGGGACTCTCGGTGCTATCATGGCTGGTGGAGAAACTCCACTTTTCGCGCTTGCCATCACTCAGATGCTCATCACTTTTTATAATCCTGATCAAGACTTTATCAAGAGTGAAGTACGAAGAATCTGCACAATTTTTAGTGCCGCAACAGTTGTGACGGTTCTTATCTACATTCTGCAGCATTACTACTACGGAATTATGGGAGAGCGCCTAACTATGCGTGTCAGAGAAATGATGTTCAAATCTATCCTTACTTTCGAAATAGGATGGTTCGATTACGATGAAAATAACAGCAGTTTGGTGGCATCTCGACTCGCGTCAGACGCAACCCTGGTCAGAGCTGCAGTCGGTGATCGATTGTCCACGATAGCTCAAAACTTGGCTTTAGTGACCACAGCCTTCGTGATTGCCTTTGTTCTCTGCTGGAAGGTTACGTTTGTCATATTGGCCACATTTCCTTGCCTCATTGGGGCTGCTATTGCAGAGCAACTCTTCTTGAAGGGCTTTGGCGCGGATTTGGCCAAGGCCTATGCTCGGGCTAGCATGGTCGCTGGTGAAGCAGTGGGAAACATCCGAACAGTTGCTGCTTTCTGTGCTGAGGAGAAGGTGCTTGAACTCTTCCAATTCGAGTTAGCCCAACCTGCTAAGAAGTCCATTATGCGTGGACAAATCGCTGGATTCGGATATGGATTCTCCCAATTCACCATGTACAGTTCTTACGGTTTAGCCTTCTGGTATGCGTCAAAACTGGTGGCCAGCGGTGAAGCGAAATTCGGGGACATCATGAAAACTTTCATGGTGCTGGTCATTACTGCCTTCGGCGTCGCAGAGACCCTGGCTCTTGCACCGGATATCGTGAAGGGCTCTCACGCCGTTGTCTCAGTATTCCAGGTCCTGGATCGTCAGACTGAAATTGATCCCGAGGATCCGAATGCAGAAGAGGTGGTTCACATTACAGGAGATATAGAGTTGAAGCACGTCGACTTCGCCTATCCTTCCAGACCGGATGTTCAAATTTTTAAGGACTTCCGACTGAAGGTGAAGTCAGGGCAGAGCTTGGCTTTAGTCGGAGCTAGTGGTTCAGGAAAGAGCTCCATAATATCCTTGATAGCCAGATTTTATGACCCTTCAGCAGGAAAGGTGCTTATCGACGGAGTGGACATAAAAAAGCTGCGATTGCGTTCATTACGACGCCACATCGGGCTCGTGCAACAAGAGCCTGCTCTCTTTGCCACTACGATATACGGCAACATACTCTACGGGAAGGATTCGGCAGGCGAAAGCGAGGTGATTGAAGCTTCCAAGTCAGCTAACGCGCACACTTTCATAAGTGGCCTTCCCAGTGGTTACCAAACCGATGTCGGAGAGAGAGGAGTCCAGCTTTCGGGAGGACAAAAACAAAGAGTAGCCATAGCTCGTGCGGTGCTGAAGAACCCGGCTATCTTACTCCTGGACGAGGCTACGAGTGCGTTGGATGCCCAGTCTGAGAAAGTAGTCCAAGATGCTCTGGATAGGCTGATGCGTGGTCGTACGACCGTGATGATTGCTCATAGGTTATCCACCATTAAGAATGCGGACGTGATCGCAGTAGTGGACGGCGGGCACATAGTGGAATTAGGAAACCACGATTACCTGATGAACAAATCTGGCGGTATCTATGCTCAGTTAGTGAATATGCAACAGAATACCGACACCGAGAGGTGA

Protein

>Mapoly0075s0052.1
MQFGAGLKDGQMSRYSENHDSRGERPRKEPSDNGGSFLGMGQQVYPGHPNSQQPPKFDEAIEMVRSQQEKDVDRGVDSAENNEAEKKKKEKKPSVSYYKLYSFSDPFDWLLIFLGTGGACAHGAAIPVFFIFFGKLIDAFGVNYNRPDLMAEEVRKYSLYFVILGGVVMIAAWLEVACWMWTGERQSAKMRAKYLKAMLSQDVGFFDTDITTGEIVSRISSDTILVQEAISEKAGNYVHYMARFVAGFAVGFTSVWQLTLVTLAVVPLIAVAGGAYAVTMIGLTSKSQKAYAKAGEIAEQAIAQIRTVYAFVGEARSVESYSEALKTTLKLGRKGGMAKGLGVGFTYGLLFGAWALLLWYASLLVMDGKTNGGQAFTTILNVIISGIALGQAAPNLTTFGKGKAAGYNILEMIKRKPAVNANFLDGRTLPHVEGQIELRDITFSYPSRPDQMIFQNFNLTIPAGATVAIVGSSGSGKSTVIALIERFYDPISGSIFLDGADIQSLQLKWLRDQLGLVNQEPALFATTILNNILYGKDGATMQEVEDAAKAANAHSFIMTLPETYDTQVGERGVQMSGGQKQRIAIARAMLKHPSILLLDEATSALDAASEGVVQEALDSLMVGRTTIIVAHRLSTIRNADMIAVVREGKIVETGTHDDLIEKNGAFAMLVKLQERAKYQPNQSNRHTKSQSQSSYGDGPSVSFNSRHSSGRLSNRWSNRWSFRKGQRSGNDTESDAGGENEFEELTAPEHVVPKPSLWRLFRLNSPEWPYAVLGTLGAIMAGGETPLFALAITQMLITFYNPDQDFIKSEVRRICTIFSAATVVTVLIYILQHYYYGIMGERLTMRVREMMFKSILTFEIGWFDYDENNSSLVASRLASDATLVRAAVGDRLSTIAQNLALVTTAFVIAFVLCWKVTFVILATFPCLIGAAIAEQLFLKGFGADLAKAYARASMVAGEAVGNIRTVAAFCAEEKVLELFQFELAQPAKKSIMRGQIAGFGYGFSQFTMYSSYGLAFWYASKLVASGEAKFGDIMKTFMVLVITAFGVAETLALAPDIVKGSHAVVSVFQVLDRQTEIDPEDPNAEEVVHITGDIELKHVDFAYPSRPDVQIFKDFRLKVKSGQSLALVGASGSGKSSIISLIARFYDPSAGKVLIDGVDIKKLRLRSLRRHIGLVQQEPALFATTIYGNILYGKDSAGESEVIEASKSANAHTFISGLPSGYQTDVGERGVQLSGGQKQRVAIARAVLKNPAILLLDEATSALDAQSEKVVQDALDRLMRGRTTVMIAHRLSTIKNADVIAVVDGGHIVELGNHDYLMNKSGGIYAQLVNMQQNTDTER

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>