Mapoly0075s0053



Description

Multidrug/pheromone exporter, ABC superfamily

Reference DB

Database ID Description
GO GO:0005524 ATP binding
GO GO:0006810 Transport
GO GO:0016021 Integral to membrane
GO GO:0016887 ATPase activity
GO GO:0042626 ATPase activity, coupled to transmembrane movement of substances
GO GO:0055085 Transmembrane transport
KOG KOG0055 Multidrug/pheromone exporter, ABC superfamily
OrthoMCL OG5_126596
PFAM PF00005 ABC transporter
PFAM PF00664 ABC transporter transmembrane region
PANTHER PTHR24221 FAMILY NOT NAMED
PANTHER PTHR24221:SF138

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpABCB1 Auxin transport Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0075s0053.1 scaffold_75:714679..724087  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0075s0053.1  

Gene structure:

mRNA scaffold_75:714679..724087  ( + strand )
five_prime_UTR scaffold_75:714679..715528  ( + strand )
five_prime_UTR scaffold_75:715886..716034  ( + strand )
CDS scaffold_75:716035..716466  ( + strand )
CDS scaffold_75:717337..717391  ( + strand )
CDS scaffold_75:717769..717944  ( + strand )
CDS scaffold_75:718199..718399  ( + strand )
CDS scaffold_75:718734..718993  ( + strand )
CDS scaffold_75:719331..719647  ( + strand )
CDS scaffold_75:719906..720129  ( + strand )
CDS scaffold_75:720318..720733  ( + strand )
CDS scaffold_75:720932..721374  ( + strand )
CDS scaffold_75:721573..721814  ( + strand )
CDS scaffold_75:722227..723444  ( + strand )
three_prime_UTR scaffold_75:723445..724087  ( + strand )

Sequences:

Gene

>Mapoly0075s0053.1
GAGCAGCGAGTGGCCAGGGTCAATGGGGTGGATGGGCGGGGCCAGAGTGCGTGTTGGAACACGGGGAGTCTGATGCTACGCATTTGCAGAGCCGAGTGTTGGGAGGGCGAGAAGGTGCGCGAGCCGATATGATGAGTAGTAGTTCCATCGCCTTTACTCTATTCTGTAGTAATGCATGGGCGTTGGCATGGTGGGACAGGTGGAGCGGGGCGTCGCTTTTGGGGCAGCCATGGTTGACGTTGACAGAGCCGAACCCGCTGACATCTTTATTCCCGACCGAATCCGCCGTGCCGCTGCCTGAAATTGCGTCTCGTGTCTTTTTAGGAAAAACACGGACTCATTATCCTCCTGGTGTTGTAGCAGGCATGGGGTTGCCTGCGTGGGGCGAGCGCCAGCGGGAGAGGCGGAGTGACCGAGCCGCAGCCCAGCGCGACGGACACTGGAGTAGCTAGCTAGGGGTCCGGCGAGGCCGCACCGTCCCCAGTCCATTCGGCGTCTACCATCGGGATCTTCATAGAAGCGGGGACCTAAGCAAATCTTCCGAGGTGCTTGATGCGTGACGGCACGTCCTCTGTAGCCTCGTGTCTACTCGTCACCCAAATCTTTGTTCCATGCACATACTGCTGCATTGTGACTTTTAATCCCACCACGGATGCCGGTGCAGATGTCGACCATTCTCGGCCTGTCGATCGCTCTGGAGCTACAACGAAGCCTCCCTCAGCTCATTTGAGAAGTAATGTGTTTTGGCCTGCTGCTCCTAACGTGGACCTCGATTGATTTTCGGAACTCTTGCCCCATGACCAGGCAGAGATTCTGAAGGAGAGCTGCTCTCTGTCTACCGAGACTCACGGTATATTCATCGAGATTCATACGCGCTTTTGCCTCCCCTGTCATTTCACTTGCTGCCATTTTCTTGATGAGTCAATGCGGAGAACGGGACCCCATCTGTCGTGACTTGGCCCAGCACGAGAGGGACCTCTAGTAGCCTGCAATAACCCAGTGACAAACATCACACGAAATAGTCTCATTAACTGAATGCGGCAGTAGCTACTGCATTGTGGAATGCCGGAGTTGTTCTTTAATGCTGATAGTAGATCTCTCATTCATGGAGCTGCCGAAGGCAGTTTGTCTGGTTGAGTGATGCACGTAGTGGTTATGGTTTTGAGACATTGTCACACCGTTGCTGAATACACAGTTTCACTTTCAGGTTGGTGATGCACGGCATATCCATTAAACTGGACCTCTTCCTCTCTCGGTCGTGATTATTCCTGGGGTCTTCAAATTTGTAAACATATCGCTGTACCGAGCTTGTTCACTTCGGCGTGGCAGCTTGAAGCTGACCAGAAGGTGGGAGAAATGAGCAGGTATGGCGATAACCAGGATAGCCGTGGCGAGAGACCTCGAAAAGAACTTAATGATTATGGAGGCTCTTTCCTGGGTATGGGCCAACAAGTGTATCCCGGACATCCGAATTCTAAGCAGTCTCCTAAGTTCGACGATGGTTTAGAGATGGCCAGAACTCAACAGGCGAAAGACGTGGATCACGGTCAGGACAATGCCGACAACGATGAGGCTGAGATGAAGAAGGAGAAGAAGCCGAGTGTGTCGTATTACAAGCTTTACTCTTTCTCAGATCCCTTTGACTGGCTGCTAATTCTCTTGGGAACCGTGGGAGCTTGCGCACATGGAGCCGCTATTCCTGTTTTCTTCATATTCTTCGGTAAACTGATTGATGCGTTTGGAGTTAACTATAATCGCCCAGACCTTATGGCGGAGCAAGTGAGAAAGGTACATTTTCGTAGCTGATGGTCAACCATCCTACATTGCTTGCCCGGTGAACACGTCTTGCTCTTTTATACAGTTCTCGAGCACGTAGCTCGGTACGGGTGCATTTCCGTAGCTAATGACCATCTACCTTAGGCACTTGAGGACTTTCCTCGGACCATTCAAGGAGTAGTATCAAGACTTAAATCTTGCATCTCACTTACATGTCATTTCCAGAGTACGCAGTGAAATAGACCGGTGATAGTGTGAAGATATGCCCGGTGTACTGAAAAACTTCCGCATTTTTCTGTCGTCGTGTAAAGTCTATCGTGCTGATGCTTGTGAAAGTTATATCCTGGAGGCAGTATTTAGCTCTGCTGCGTAGATCCCCTGCTATGTCATCATCAGTAGCCACCATTGTCTCCATCTTTTATGTTGCCACGTGGTTCCGGGTCGCGCTCATCGGCCCTCTTCCCCACGAATAATTCTCGTAGCTCAATGAGCTACGAGAATTATACAGTCTTGAATTTCCTTCCCCTGCCTCGCGCCTCTCTGCCCACGCATTGTTTAAATGCGTGTGCAGAGAGGTGCGAGTCAAATTTCTGCAATTTGATTCGAGGTTACTAGAGTGTCGTAGAATTCCCACCGTCGCCTCTAGTTTTAGTCACGAAGAGCTTACTTTTTCAAAATCAAGGCTGTTTACACAAGGTGCCCCGCTGCTAAGGTTTAAGTTCTCAGATTTTCCGGATTTGAAAAGTTACAGTATATGCTCTCTTGCTCTGATAGAAATGATGGCTCTGACACTATATGCAGGATTTGTATACCCTCGTCGTTTTAAAAAGTTTCCAATTCCATTGATTTCCTACATTTACGATCGTGTCTTCTTTCTTGCAGTATTCTTTGTACTTCGTCATTCTCGGTGGCGTTGTCATGATTGCCGCATGGCTCGGTAAGGACTCCATCTCAGGAACAGATTGCAGTCTTTGGCCCTGTCGACCGTGACCGCATAGTTTGCAATATCTAGTAGAACTGCTGCTTCACCGCGTAATGTAAAGGACTACATGTTTCTCACTGCTGAGATTACTGGAAAGAATTCTTAGTCGTCACAGTTTCGTCTTTCATTATGTCCTCTGGCTAGATGTACACTGTTTCCTTCTTCAAATTATGAGTTTGGACATGGTTTCTTCCCCCCCAGCCAATTGAGATTTCCTTGCCATTTGATTATCGGGAGGACTATCAAACGTCTTGAGGTGCATACAACGCGGCAGTCAAAAGAATCGAAACTTCCTCTTGATTATTGATATCCCGCATTGTACCACCATGCAGAGGTCGCTTGCTGGATGTGGACAGGTGAAAGGCAGTCCGCGAAAATGAGGGCGAAGTATCTGAAAGCGATGCTTAGTCAGGACGTCGGGTTTTTCGACACAGATATTACCACCGGTGAAATTGTTAGCAGAATCTCGAGTGATACCATACTGGTTCAGGATGCTATTAGTGAAAAGGTGTGTCTTCAGTGATATCACGGCGTCGGTGGCTCCTTAATTTTACGTGCCCGTTAGTTGTGCTATGTACAAATTCTGTCGTTCTATTGAATGATCACCCAGATTTCCTAACTCCTTTTTCTGTCTACGTATAGCCGAACGGCCAGATAGACTGGTCAACCGAATTTCTTTCCAATTTCGGTTTTGTGGAAGTCAATGTCTCTGAAACTCTGTAATTTCTAACTTACTTCGGCTTACTAAATTCTGTTTTTCAGGCTGGGAACTACGTACATTATATGGCCAGGTTTGTTGCAGGATTTGCTGTGGGATTCACCTCTGTGTGGCAGCTCACGTTGGTGACACTAGCAGTTGTACCACTCATTGCCGTGGCAGGAGGAGCCTATGCGGTGACAATGATCGGATTAACCAGCAAGAGTCAGAAGGCCTATGCTAAAGCTGGAGAGATAGCTGAACAGGTAAACTGAGTGTCCTAAAATAAAGAATTTGGAACTATTTCAGCCATGCAACGTTGATGAGCGTTGAAGCAGTTGTAAGAAGTGTGTCAGTCGTCCCTACAATTTGCTCTTCATTATCTGAAATTTCCTTTGAAGGTCGAACGAGTTCATAGAATCAGCTTTGGATTCTATTATTTCGCTGTTTGCGCGAAAGCTTTTGAATTCTTTAGCTTGGTAGTTGCTTGAATTCTGCAGTCGGGTTTTTCTGTGAATGACGACAAGGTGAAAGTTTAACACCTCTCTCAGGCCGATCTTGTACATACTGCTGACATACAATTCAATCCTATCGACTCAGGCCATCGCCCAGATACGGACCGTGTACGCATTTGTAGGAGAGGCGAAGTCGGTCAAATCTTATTCAGAAGCACTTGATACCACCATGAGATTGGGGAGAAAGGGAGGAATGGCTAAGGGTCTGGGAGTTGGGTTTACCTATGGGTTGCTATTTGGAGCCTGGGCTCTTCTCCTGTGGTATGCCAGTATACTCGTTATGGATGGGAAAACCAACGGGGGCCAAGCATTTACAACCATTCTCAACGTCATCATCAGTGGGATGTAAGTTGCAATCTCAGCGAATCTACTATGTATCTACTAGAACAAGAAAGCTTACTAATCAGGGCAACCCAATCTTTTGTATGTTGGAATTATAAGTTATTTGTGTTGAACAATTTATTTTGTTTACTTAACAGGAGTTTGACATGAAAGTAGGTCTCGATTTCCTCCGAATTCACCGCTAGTGTGTTAGTGTCTGTCTCCTACCGTTTTCGATATGTGATCCTATCACGTAGCACGAATTAATTCTTCTCGAGTTCCGGAAAGGTAGTGCTCCATGAAAGTCCCGTCATACCTAGAACTGGTTAGCTCCGACTTATAGTGTTTCCGACGTGTACAGTGCACTTGGCCAGGCTGCACCGAATCTTACGACGTTTGGAAAGGGAAAGGCTGCGGGCTACAATATATTGGAGATGATCAAGAGGAAGCCCGCAGTAAATGCCAACTTTTTGGATGGACGAACGTTATCTCATGTCGCGGGACAAATAGAACTGCGGGACGTTACGTTCAGCTATCCTGCACGTCCTGATCAGATGATCTTTCAGAATTTTAATCTCACTATCCCTGCAGGAGCCACTGTAGCGATTGTGGGTAGCAGTGGGTCTGGGAAGAGCACAGTCATAGCTCTAATTGAGAGATTCTACGACCCCATATCTGGTAAGCTCCAATATAATTGCAGTCGGTTTGTTCATTACTCGTTTAATACTACAGCAGGCATTGCGTGTAGAAGGGTTCGCAGATGAGTCGTGTCGTCCAACTGTGTGCTTCTTTGCCCTGCTTCTCACTTTGATACGTGTACGTTCTTACATTTGAGGTTTGTCATCTTTTTTCTCTAGTGAATAAAACTGTTAAAATCTCATCGCGACATCCATCTTCCTTCCAGCGCTGACAGCTCTTGTTTTTAACTTTTGAAAGGTCGCATATTTCTCGACGGCACGGACATCCAGTCCTTGCAATTGAAATGGTTAAGAGATCAGCTTGGACTCGTGAACCAGGAACCCGCGTTATTTGCGACAACCATTCTGAATAACATTTTATACGGCAAAGACGGTGCAACCATGCAAGAGGTCGAAGATGCAGCCAAAGCTGCCAATGCTCACTCTTTCATCATGACTTTACCGGAAGGTTATGAAACCCAGGTTTGTACACTTAACAAGTCGTAGAAAATTTCGGTTCCTCACCTCAAGGAATTTGATGTTTAACTCAAGGCTAACACTCTGTGACTAGACTGGTTGGCCTTTCAAATGTCGACGGTCTGTTCACGCATGCAACCTATATTTTCGTCCCTAGCTTTGTACTTAGAGAAGCAATGTCGTGCTTGACGCAGGTTGGTGAAAGAGGAGTCCAAATGTCTGGGGGACAAAAGCAGCGTATAGCAATTGCCAGGGCGATGTTGAAGCATCCCTCTATTTTGCTTCTAGATGAAGCAACAAGTGCACTCGATGCAGCATCAGAAGGTGTCGTTCAGGAAGCCTTGGACTCTCTTATGGTCGGCAGAACCACCATCATAGTAGCGCACCGCCTGTCCACCATCCGCAATGCAGACATGATTGCTGTGGTCAGGGAGGGCAAGGTTATTGAAACTGGCACTCACGATGATCTTATTCAGAAGAACGGTGCGTTCGCGATGCTCGTAAAATTGCAGGAGAGAGCGAAGTACCAACCCAATCAGTCGAACAGGCACACCAAGAGTCAAAGTCAGAGCAGTTACGGAGATGGACCATCTGTGTCTTTCAATTCCAGGTACGTCAGTCAGCGTATTTCTACGACTACATAGTGAGGAATTAGGCTTGTGCGACTGTGCTTGGTTTTCGTGTGGCAGACTATCTTCTGCTTGTAGTTATCTGACTGCTTTACCTTACGAAATATTTTGAAAGCTCGCACTTGGAGGAGTGTTTACTAATGGATAGGTTCTGTCGCCTTCGTCTGGTGGTTTTGCAGACACTCCTCTGGTCGACTCTCGAACCGATGGAGCAATAGATGGAGCTTTAGGAAAGGACAGAGGAGTGGTAATGATACGGAATCAGAAGTCGGCGTTGAGAACGATTTCGAAGAGCTGACTACTCCCGAGCGCGTCAATCCAAAGCCATCTTTATGGCGGCTTTTTAAACTGAACTCACCAGAGTGGCCTTACGCCGTACTTGGGACGCTTGGTGCTATTATGGCTGGTGGAGAAACTCCACTGTTCGCACTTGCCATCACTCAGATGCTCATCACATTTTACAATCCTGATCAAGAATTCATCAAGAGTGAAGTACGAAGAATCTGCACTATATTCAGTGCCGCAACAGTTGTGACGGTTCTTATCTACATTCTGCAGCATTACTACTACGGAATCATGGGAGAGCGCCTAACTATGCGTGTCAGAGAAATGATGTTCAAATGTGAGTCCGCTTGCAGATTTACGTTTATGCTTCTCTTTGGCGGATTACGTACTGTTCCCGGCGTACAAAGATGCCAATCGCCATTGCTTCTGGTGACAAACGAAATTCTGCATTGTAATATTATCGAATTCATTGGAAGATTCTCTGTCGATATTCCTCGTTCGATTCTTGACATACGTCTTTGTGCTTATGTGGCAGCTATCCTCTCTTTCGAAATTGGATGGTTCGATTACGATGAAAATAACAGCAGTTTGGTTGCATCCCGACTTGCGTCAGACGCGACCTTGGTCAGAGCTGCAGTCGGTGATCGATTATCAACGATAGCACAAAACTTGGCTTTGATGACCACTGCCTTCGTAATTGCTTTTGTTCTCTGCTGGAAGGTTACGTTTGTCATACTGGCCACGTTTCCTTGCCTGATTGGGGCTGCTATTGCGGAGGTGAGTCTGGGACCTGCAGCAGGAACGTATAGGCATGTTTGAGTCAGCAATATTCTAACGATGTAGCTCAGCTGCAGGACTGAATCTCTTTGACGTCTTGCCCCGCCCTTGAATAAAAATTGTTGTTGTTTGTGACATCTCTGAACGTCATTGAGAATGTGGAGCGGAGTAGTGTCAGTGTTGAGATAGGTGGAAAGCCGCATGTAGCATCTGCTCAATCTCTTCGTTAGTGTTTTGTCTCTCATTCGTGAACAATTTCTTAGGAAAAAAACACTTGTTTAGAGAGCACATAGTCTGACTGTAATTTTCACCGAAGGCGATGTTTTTCCCCTAAGATATTGATTAAACTTAAGACACTGTCTGATAGAGTCTCACTCAACACGTCACTAACAATACCTCTATTGGTATGCAGCAACTTTTTTTGAAGGGCTTTGGCGGGGATTTGGCCAAGGCCTATGCTCGGGCTAGCATGGTTGCGGGTGAAGCCGTGGGCAACATCCGAACAGTTGCTGCTTTCTGTGCTGAGGATAAGGTGCTGGAACTCTTCCAGTACGAGTTAGCCCAGCCCGCTAAGAAGTCCGTTCTTCGTGGACAGATTGCTGGATTCGGATACGGATTTTCCCAGTTCACCATGTACAGTTCTTACGGTTTAGCGTTCTGGTATTCGTCAAAACTGGTGGCTAGCCGTGAAGCAAACTTCGGGGACATCATGAAAACTTTCATGGTGCTGGTCATCACTGCCTTCGGCGTCGCAGAGACCCTGGCTCTTGCACCGGATATTGTGAAGGGCTCTCAGGCCGTTGCCTCAGTGTTCGAGATTCTGGATCGTCAGACTGAAATTGATCCCGAGGATCCGAATGCGGAAGAGGTGGTTCACATTTCTGGAGATATAGAGTTGAAGCACGTTGACTTCGCCTATCCTTCCAGACCGGATATTCAGATTTTCAAGGACTTTCGACTGAAGGTGAAGTCAGGGCAGAGCCTGGCTTTAGTCGGAGCCAGTGGTTCAGGAAAGAGCTCCATCATATCGCTGATAGCCAGATTTTATGATCCTTCAGCAGGAAAGGTGCTTATCGACGGAGTGGACATAAAGAAGCTTCGATTGCGTTCATTACGACGGCACATTGGGCTCGTGCAACAAGAGCCTGCTCTTTTTGCCACCACTATATATGGCAACATACTCTACGGGAAGGATTCCGCAGGCGAAAGCGAGGTGATTGAAGCTGCCAAGTCAGCCAACGCGCACACTTTCATCAGCGGCCTTCCCAATGGTTACCAAACCGACGTCGGAGAGAGAGGAGTCCAGCTTTCGGGAGGACAGAAACAAAGAGTAGCGATAGCTCGTGCGGTGCTGAAGAACCCGGCTATCTTACTCCTGGATGAGGCTACGAGTGCGTTGGATGCCCAGTCTGAGAAAGTCGTCCAAGATGCTCTGGATAGGCTGATGCGAGGTCGTACGACCGTGATGATTGCTCATAGGTTATCCACCATTAAGAATGCGGACGTGATCGCAGTAGTGGACGGCGGGCACATAGTGGAATTAGGAAACCACGATTACCTGATGAACAAAGCTGGCAGTATCTATGCTCAGTTAGTGAATATGCAACAGAATACCGACGCCGAGAGGTGACGGAGGTGACTAGGTGGATAGTCAACAAGAATCTTCAACGGAGCTTTACAGAGTCCTGTCCTTGTGCGGGACGATCGACCACTGAGTAGCTCGGGAAGTCAAGATGCCCATATCGTTATTTATCCAGGAAAGTTTGTACCATCTTTTGCAGAGGAGATAGAGAAGGTAGCTGCACTCCCCTTTTAAATAACAGATCTAAGACAGACAGACGGGGGTTAGTTAGGGACGCGCAAGACCGCCAATTTGACTCACCAATCATGGAGAGATACGAGGGTCTTCGGAGATGTGGGTTAATGTAGTTCTGTCAAACTTTCCGCATTACAGCAGTGAAGTCTTCTTCCATCAAGAGCTCCTCTCTTTGGGCCAGAACTACATTAACCCACTAGATGTCTATACTTCAGTCGCTTAGCACGTGACCGTTCCAGGAGGGAATCGCAGTGACGAGAAGAGGATGTCGAGACCCGTCTTTCCTGGATGGTCTTTAGGAGCTTACCACAGCCAGGCCTGCGATGATTAGATAGGTTCGATCGAATTGATTGGGCCTCTCGGGCCTGAGTCCTGTACTCGCAAAGAGCTAGAAGCACAGGAATCTTACATTCAAACCATTGCTATTGTAACAGTCACCACAGTTTGTATATGCCAG

mRNA

>Mapoly0075s0053.1
GAGCAGCGAGTGGCCAGGGTCAATGGGGTGGATGGGCGGGGCCAGAGTGCGTGTTGGAACACGGGGAGTCTGATGCTACGCATTTGCAGAGCCGAGTGTTGGGAGGGCGAGAAGGTGCGCGAGCCGATATGATGAGTAGTAGTTCCATCGCCTTTACTCTATTCTGTAGTAATGCATGGGCGTTGGCATGGTGGGACAGGTGGAGCGGGGCGTCGCTTTTGGGGCAGCCATGGTTGACGTTGACAGAGCCGAACCCGCTGACATCTTTATTCCCGACCGAATCCGCCGTGCCGCTGCCTGAAATTGCGTCTCGTGTCTTTTTAGGAAAAACACGGACTCATTATCCTCCTGGTGTTGTAGCAGGCATGGGGTTGCCTGCGTGGGGCGAGCGCCAGCGGGAGAGGCGGAGTGACCGAGCCGCAGCCCAGCGCGACGGACACTGGAGTAGCTAGCTAGGGGTCCGGCGAGGCCGCACCGTCCCCAGTCCATTCGGCGTCTACCATCGGGATCTTCATAGAAGCGGGGACCTAAGCAAATCTTCCGAGGTGCTTGATGCGTGACGGCACGTCCTCTGTAGCCTCGTGTCTACTCGTCACCCAAATCTTTGTTCCATGCACATACTGCTGCATTGTGACTTTTAATCCCACCACGGATGCCGGTGCAGATGTCGACCATTCTCGGCCTGTCGATCGCTCTGGAGCTACAACGAAGCCTCCCTCAGCTCATTTGAGAAGTAATGTGTTTTGGCCTGCTGCTCCTAACGTGGACCTCGATTGATTTTCGGAACTCTTGCCCCATGACCAGGCAGAGATTCTGAAGGAGAGCTGCTCTCTGTCTACCGAGACTCACGGTTGGTGATGCACGGCATATCCATTAAACTGGACCTCTTCCTCTCTCGGTCGTGATTATTCCTGGGGTCTTCAAATTTGTAAACATATCGCTGTACCGAGCTTGTTCACTTCGGCGTGGCAGCTTGAAGCTGACCAGAAGGTGGGAGAAATGAGCAGGTATGGCGATAACCAGGATAGCCGTGGCGAGAGACCTCGAAAAGAACTTAATGATTATGGAGGCTCTTTCCTGGGTATGGGCCAACAAGTGTATCCCGGACATCCGAATTCTAAGCAGTCTCCTAAGTTCGACGATGGTTTAGAGATGGCCAGAACTCAACAGGCGAAAGACGTGGATCACGGTCAGGACAATGCCGACAACGATGAGGCTGAGATGAAGAAGGAGAAGAAGCCGAGTGTGTCGTATTACAAGCTTTACTCTTTCTCAGATCCCTTTGACTGGCTGCTAATTCTCTTGGGAACCGTGGGAGCTTGCGCACATGGAGCCGCTATTCCTGTTTTCTTCATATTCTTCGGTAAACTGATTGATGCGTTTGGAGTTAACTATAATCGCCCAGACCTTATGGCGGAGCAAGTGAGAAAGTATTCTTTGTACTTCGTCATTCTCGGTGGCGTTGTCATGATTGCCGCATGGCTCGAGGTCGCTTGCTGGATGTGGACAGGTGAAAGGCAGTCCGCGAAAATGAGGGCGAAGTATCTGAAAGCGATGCTTAGTCAGGACGTCGGGTTTTTCGACACAGATATTACCACCGGTGAAATTGTTAGCAGAATCTCGAGTGATACCATACTGGTTCAGGATGCTATTAGTGAAAAGGCTGGGAACTACGTACATTATATGGCCAGGTTTGTTGCAGGATTTGCTGTGGGATTCACCTCTGTGTGGCAGCTCACGTTGGTGACACTAGCAGTTGTACCACTCATTGCCGTGGCAGGAGGAGCCTATGCGGTGACAATGATCGGATTAACCAGCAAGAGTCAGAAGGCCTATGCTAAAGCTGGAGAGATAGCTGAACAGGCCATCGCCCAGATACGGACCGTGTACGCATTTGTAGGAGAGGCGAAGTCGGTCAAATCTTATTCAGAAGCACTTGATACCACCATGAGATTGGGGAGAAAGGGAGGAATGGCTAAGGGTCTGGGAGTTGGGTTTACCTATGGGTTGCTATTTGGAGCCTGGGCTCTTCTCCTGTGGTATGCCAGTATACTCGTTATGGATGGGAAAACCAACGGGGGCCAAGCATTTACAACCATTCTCAACGTCATCATCAGTGGGATTGCACTTGGCCAGGCTGCACCGAATCTTACGACGTTTGGAAAGGGAAAGGCTGCGGGCTACAATATATTGGAGATGATCAAGAGGAAGCCCGCAGTAAATGCCAACTTTTTGGATGGACGAACGTTATCTCATGTCGCGGGACAAATAGAACTGCGGGACGTTACGTTCAGCTATCCTGCACGTCCTGATCAGATGATCTTTCAGAATTTTAATCTCACTATCCCTGCAGGAGCCACTGTAGCGATTGTGGGTAGCAGTGGGTCTGGGAAGAGCACAGTCATAGCTCTAATTGAGAGATTCTACGACCCCATATCTGGTCGCATATTTCTCGACGGCACGGACATCCAGTCCTTGCAATTGAAATGGTTAAGAGATCAGCTTGGACTCGTGAACCAGGAACCCGCGTTATTTGCGACAACCATTCTGAATAACATTTTATACGGCAAAGACGGTGCAACCATGCAAGAGGTCGAAGATGCAGCCAAAGCTGCCAATGCTCACTCTTTCATCATGACTTTACCGGAAGGTTATGAAACCCAGGTTGGTGAAAGAGGAGTCCAAATGTCTGGGGGACAAAAGCAGCGTATAGCAATTGCCAGGGCGATGTTGAAGCATCCCTCTATTTTGCTTCTAGATGAAGCAACAAGTGCACTCGATGCAGCATCAGAAGGTGTCGTTCAGGAAGCCTTGGACTCTCTTATGGTCGGCAGAACCACCATCATAGTAGCGCACCGCCTGTCCACCATCCGCAATGCAGACATGATTGCTGTGGTCAGGGAGGGCAAGGTTATTGAAACTGGCACTCACGATGATCTTATTCAGAAGAACGGTGCGTTCGCGATGCTCGTAAAATTGCAGGAGAGAGCGAAGTACCAACCCAATCAGTCGAACAGGCACACCAAGAGTCAAAGTCAGAGCAGTTACGGAGATGGACCATCTGTGTCTTTCAATTCCAGACACTCCTCTGGTCGACTCTCGAACCGATGGAGCAATAGATGGAGCTTTAGGAAAGGACAGAGGAGTGGTAATGATACGGAATCAGAAGTCGGCGTTGAGAACGATTTCGAAGAGCTGACTACTCCCGAGCGCGTCAATCCAAAGCCATCTTTATGGCGGCTTTTTAAACTGAACTCACCAGAGTGGCCTTACGCCGTACTTGGGACGCTTGGTGCTATTATGGCTGGTGGAGAAACTCCACTGTTCGCACTTGCCATCACTCAGATGCTCATCACATTTTACAATCCTGATCAAGAATTCATCAAGAGTGAAGTACGAAGAATCTGCACTATATTCAGTGCCGCAACAGTTGTGACGGTTCTTATCTACATTCTGCAGCATTACTACTACGGAATCATGGGAGAGCGCCTAACTATGCGTGTCAGAGAAATGATGTTCAAATCTATCCTCTCTTTCGAAATTGGATGGTTCGATTACGATGAAAATAACAGCAGTTTGGTTGCATCCCGACTTGCGTCAGACGCGACCTTGGTCAGAGCTGCAGTCGGTGATCGATTATCAACGATAGCACAAAACTTGGCTTTGATGACCACTGCCTTCGTAATTGCTTTTGTTCTCTGCTGGAAGGTTACGTTTGTCATACTGGCCACGTTTCCTTGCCTGATTGGGGCTGCTATTGCGGAGCAACTTTTTTTGAAGGGCTTTGGCGGGGATTTGGCCAAGGCCTATGCTCGGGCTAGCATGGTTGCGGGTGAAGCCGTGGGCAACATCCGAACAGTTGCTGCTTTCTGTGCTGAGGATAAGGTGCTGGAACTCTTCCAGTACGAGTTAGCCCAGCCCGCTAAGAAGTCCGTTCTTCGTGGACAGATTGCTGGATTCGGATACGGATTTTCCCAGTTCACCATGTACAGTTCTTACGGTTTAGCGTTCTGGTATTCGTCAAAACTGGTGGCTAGCCGTGAAGCAAACTTCGGGGACATCATGAAAACTTTCATGGTGCTGGTCATCACTGCCTTCGGCGTCGCAGAGACCCTGGCTCTTGCACCGGATATTGTGAAGGGCTCTCAGGCCGTTGCCTCAGTGTTCGAGATTCTGGATCGTCAGACTGAAATTGATCCCGAGGATCCGAATGCGGAAGAGGTGGTTCACATTTCTGGAGATATAGAGTTGAAGCACGTTGACTTCGCCTATCCTTCCAGACCGGATATTCAGATTTTCAAGGACTTTCGACTGAAGGTGAAGTCAGGGCAGAGCCTGGCTTTAGTCGGAGCCAGTGGTTCAGGAAAGAGCTCCATCATATCGCTGATAGCCAGATTTTATGATCCTTCAGCAGGAAAGGTGCTTATCGACGGAGTGGACATAAAGAAGCTTCGATTGCGTTCATTACGACGGCACATTGGGCTCGTGCAACAAGAGCCTGCTCTTTTTGCCACCACTATATATGGCAACATACTCTACGGGAAGGATTCCGCAGGCGAAAGCGAGGTGATTGAAGCTGCCAAGTCAGCCAACGCGCACACTTTCATCAGCGGCCTTCCCAATGGTTACCAAACCGACGTCGGAGAGAGAGGAGTCCAGCTTTCGGGAGGACAGAAACAAAGAGTAGCGATAGCTCGTGCGGTGCTGAAGAACCCGGCTATCTTACTCCTGGATGAGGCTACGAGTGCGTTGGATGCCCAGTCTGAGAAAGTCGTCCAAGATGCTCTGGATAGGCTGATGCGAGGTCGTACGACCGTGATGATTGCTCATAGGTTATCCACCATTAAGAATGCGGACGTGATCGCAGTAGTGGACGGCGGGCACATAGTGGAATTAGGAAACCACGATTACCTGATGAACAAAGCTGGCAGTATCTATGCTCAGTTAGTGAATATGCAACAGAATACCGACGCCGAGAGGTGACGGAGGTGACTAGGTGGATAGTCAACAAGAATCTTCAACGGAGCTTTACAGAGTCCTGTCCTTGTGCGGGACGATCGACCACTGAGTAGCTCGGGAAGTCAAGATGCCCATATCGTTATTTATCCAGGAAAGTTTGTACCATCTTTTGCAGAGGAGATAGAGAAGGTAGCTGCACTCCCCTTTTAAATAACAGATCTAAGACAGACAGACGGGGGTTAGTTAGGGACGCGCAAGACCGCCAATTTGACTCACCAATCATGGAGAGATACGAGGGTCTTCGGAGATGTGGGTTAATGTAGTTCTGTCAAACTTTCCGCATTACAGCAGTGAAGTCTTCTTCCATCAAGAGCTCCTCTCTTTGGGCCAGAACTACATTAACCCACTAGATGTCTATACTTCAGTCGCTTAGCACGTGACCGTTCCAGGAGGGAATCGCAGTGACGAGAAGAGGATGTCGAGACCCGTCTTTCCTGGATGGTCTTTAGGAGCTTACCACAGCCAGGCCTGCGATGATTAGATAGGTTCGATCGAATTGATTGGGCCTCTCGGGCCTGAGTCCTGTACTCGCAAAGAGCTAGAAGCACAGGAATCTTACATTCAAACCATTGCTATTGTAACAGTCACCACAGTTTGTATATGCCAG

CDS

>Mapoly0075s0053.1
ATGAGCAGGTATGGCGATAACCAGGATAGCCGTGGCGAGAGACCTCGAAAAGAACTTAATGATTATGGAGGCTCTTTCCTGGGTATGGGCCAACAAGTGTATCCCGGACATCCGAATTCTAAGCAGTCTCCTAAGTTCGACGATGGTTTAGAGATGGCCAGAACTCAACAGGCGAAAGACGTGGATCACGGTCAGGACAATGCCGACAACGATGAGGCTGAGATGAAGAAGGAGAAGAAGCCGAGTGTGTCGTATTACAAGCTTTACTCTTTCTCAGATCCCTTTGACTGGCTGCTAATTCTCTTGGGAACCGTGGGAGCTTGCGCACATGGAGCCGCTATTCCTGTTTTCTTCATATTCTTCGGTAAACTGATTGATGCGTTTGGAGTTAACTATAATCGCCCAGACCTTATGGCGGAGCAAGTGAGAAAGTATTCTTTGTACTTCGTCATTCTCGGTGGCGTTGTCATGATTGCCGCATGGCTCGAGGTCGCTTGCTGGATGTGGACAGGTGAAAGGCAGTCCGCGAAAATGAGGGCGAAGTATCTGAAAGCGATGCTTAGTCAGGACGTCGGGTTTTTCGACACAGATATTACCACCGGTGAAATTGTTAGCAGAATCTCGAGTGATACCATACTGGTTCAGGATGCTATTAGTGAAAAGGCTGGGAACTACGTACATTATATGGCCAGGTTTGTTGCAGGATTTGCTGTGGGATTCACCTCTGTGTGGCAGCTCACGTTGGTGACACTAGCAGTTGTACCACTCATTGCCGTGGCAGGAGGAGCCTATGCGGTGACAATGATCGGATTAACCAGCAAGAGTCAGAAGGCCTATGCTAAAGCTGGAGAGATAGCTGAACAGGCCATCGCCCAGATACGGACCGTGTACGCATTTGTAGGAGAGGCGAAGTCGGTCAAATCTTATTCAGAAGCACTTGATACCACCATGAGATTGGGGAGAAAGGGAGGAATGGCTAAGGGTCTGGGAGTTGGGTTTACCTATGGGTTGCTATTTGGAGCCTGGGCTCTTCTCCTGTGGTATGCCAGTATACTCGTTATGGATGGGAAAACCAACGGGGGCCAAGCATTTACAACCATTCTCAACGTCATCATCAGTGGGATTGCACTTGGCCAGGCTGCACCGAATCTTACGACGTTTGGAAAGGGAAAGGCTGCGGGCTACAATATATTGGAGATGATCAAGAGGAAGCCCGCAGTAAATGCCAACTTTTTGGATGGACGAACGTTATCTCATGTCGCGGGACAAATAGAACTGCGGGACGTTACGTTCAGCTATCCTGCACGTCCTGATCAGATGATCTTTCAGAATTTTAATCTCACTATCCCTGCAGGAGCCACTGTAGCGATTGTGGGTAGCAGTGGGTCTGGGAAGAGCACAGTCATAGCTCTAATTGAGAGATTCTACGACCCCATATCTGGTCGCATATTTCTCGACGGCACGGACATCCAGTCCTTGCAATTGAAATGGTTAAGAGATCAGCTTGGACTCGTGAACCAGGAACCCGCGTTATTTGCGACAACCATTCTGAATAACATTTTATACGGCAAAGACGGTGCAACCATGCAAGAGGTCGAAGATGCAGCCAAAGCTGCCAATGCTCACTCTTTCATCATGACTTTACCGGAAGGTTATGAAACCCAGGTTGGTGAAAGAGGAGTCCAAATGTCTGGGGGACAAAAGCAGCGTATAGCAATTGCCAGGGCGATGTTGAAGCATCCCTCTATTTTGCTTCTAGATGAAGCAACAAGTGCACTCGATGCAGCATCAGAAGGTGTCGTTCAGGAAGCCTTGGACTCTCTTATGGTCGGCAGAACCACCATCATAGTAGCGCACCGCCTGTCCACCATCCGCAATGCAGACATGATTGCTGTGGTCAGGGAGGGCAAGGTTATTGAAACTGGCACTCACGATGATCTTATTCAGAAGAACGGTGCGTTCGCGATGCTCGTAAAATTGCAGGAGAGAGCGAAGTACCAACCCAATCAGTCGAACAGGCACACCAAGAGTCAAAGTCAGAGCAGTTACGGAGATGGACCATCTGTGTCTTTCAATTCCAGACACTCCTCTGGTCGACTCTCGAACCGATGGAGCAATAGATGGAGCTTTAGGAAAGGACAGAGGAGTGGTAATGATACGGAATCAGAAGTCGGCGTTGAGAACGATTTCGAAGAGCTGACTACTCCCGAGCGCGTCAATCCAAAGCCATCTTTATGGCGGCTTTTTAAACTGAACTCACCAGAGTGGCCTTACGCCGTACTTGGGACGCTTGGTGCTATTATGGCTGGTGGAGAAACTCCACTGTTCGCACTTGCCATCACTCAGATGCTCATCACATTTTACAATCCTGATCAAGAATTCATCAAGAGTGAAGTACGAAGAATCTGCACTATATTCAGTGCCGCAACAGTTGTGACGGTTCTTATCTACATTCTGCAGCATTACTACTACGGAATCATGGGAGAGCGCCTAACTATGCGTGTCAGAGAAATGATGTTCAAATCTATCCTCTCTTTCGAAATTGGATGGTTCGATTACGATGAAAATAACAGCAGTTTGGTTGCATCCCGACTTGCGTCAGACGCGACCTTGGTCAGAGCTGCAGTCGGTGATCGATTATCAACGATAGCACAAAACTTGGCTTTGATGACCACTGCCTTCGTAATTGCTTTTGTTCTCTGCTGGAAGGTTACGTTTGTCATACTGGCCACGTTTCCTTGCCTGATTGGGGCTGCTATTGCGGAGCAACTTTTTTTGAAGGGCTTTGGCGGGGATTTGGCCAAGGCCTATGCTCGGGCTAGCATGGTTGCGGGTGAAGCCGTGGGCAACATCCGAACAGTTGCTGCTTTCTGTGCTGAGGATAAGGTGCTGGAACTCTTCCAGTACGAGTTAGCCCAGCCCGCTAAGAAGTCCGTTCTTCGTGGACAGATTGCTGGATTCGGATACGGATTTTCCCAGTTCACCATGTACAGTTCTTACGGTTTAGCGTTCTGGTATTCGTCAAAACTGGTGGCTAGCCGTGAAGCAAACTTCGGGGACATCATGAAAACTTTCATGGTGCTGGTCATCACTGCCTTCGGCGTCGCAGAGACCCTGGCTCTTGCACCGGATATTGTGAAGGGCTCTCAGGCCGTTGCCTCAGTGTTCGAGATTCTGGATCGTCAGACTGAAATTGATCCCGAGGATCCGAATGCGGAAGAGGTGGTTCACATTTCTGGAGATATAGAGTTGAAGCACGTTGACTTCGCCTATCCTTCCAGACCGGATATTCAGATTTTCAAGGACTTTCGACTGAAGGTGAAGTCAGGGCAGAGCCTGGCTTTAGTCGGAGCCAGTGGTTCAGGAAAGAGCTCCATCATATCGCTGATAGCCAGATTTTATGATCCTTCAGCAGGAAAGGTGCTTATCGACGGAGTGGACATAAAGAAGCTTCGATTGCGTTCATTACGACGGCACATTGGGCTCGTGCAACAAGAGCCTGCTCTTTTTGCCACCACTATATATGGCAACATACTCTACGGGAAGGATTCCGCAGGCGAAAGCGAGGTGATTGAAGCTGCCAAGTCAGCCAACGCGCACACTTTCATCAGCGGCCTTCCCAATGGTTACCAAACCGACGTCGGAGAGAGAGGAGTCCAGCTTTCGGGAGGACAGAAACAAAGAGTAGCGATAGCTCGTGCGGTGCTGAAGAACCCGGCTATCTTACTCCTGGATGAGGCTACGAGTGCGTTGGATGCCCAGTCTGAGAAAGTCGTCCAAGATGCTCTGGATAGGCTGATGCGAGGTCGTACGACCGTGATGATTGCTCATAGGTTATCCACCATTAAGAATGCGGACGTGATCGCAGTAGTGGACGGCGGGCACATAGTGGAATTAGGAAACCACGATTACCTGATGAACAAAGCTGGCAGTATCTATGCTCAGTTAGTGAATATGCAACAGAATACCGACGCCGAGAGGTGA

Protein

>Mapoly0075s0053.1
MSRYGDNQDSRGERPRKELNDYGGSFLGMGQQVYPGHPNSKQSPKFDDGLEMARTQQAKDVDHGQDNADNDEAEMKKEKKPSVSYYKLYSFSDPFDWLLILLGTVGACAHGAAIPVFFIFFGKLIDAFGVNYNRPDLMAEQVRKYSLYFVILGGVVMIAAWLEVACWMWTGERQSAKMRAKYLKAMLSQDVGFFDTDITTGEIVSRISSDTILVQDAISEKAGNYVHYMARFVAGFAVGFTSVWQLTLVTLAVVPLIAVAGGAYAVTMIGLTSKSQKAYAKAGEIAEQAIAQIRTVYAFVGEAKSVKSYSEALDTTMRLGRKGGMAKGLGVGFTYGLLFGAWALLLWYASILVMDGKTNGGQAFTTILNVIISGIALGQAAPNLTTFGKGKAAGYNILEMIKRKPAVNANFLDGRTLSHVAGQIELRDVTFSYPARPDQMIFQNFNLTIPAGATVAIVGSSGSGKSTVIALIERFYDPISGRIFLDGTDIQSLQLKWLRDQLGLVNQEPALFATTILNNILYGKDGATMQEVEDAAKAANAHSFIMTLPEGYETQVGERGVQMSGGQKQRIAIARAMLKHPSILLLDEATSALDAASEGVVQEALDSLMVGRTTIIVAHRLSTIRNADMIAVVREGKVIETGTHDDLIQKNGAFAMLVKLQERAKYQPNQSNRHTKSQSQSSYGDGPSVSFNSRHSSGRLSNRWSNRWSFRKGQRSGNDTESEVGVENDFEELTTPERVNPKPSLWRLFKLNSPEWPYAVLGTLGAIMAGGETPLFALAITQMLITFYNPDQEFIKSEVRRICTIFSAATVVTVLIYILQHYYYGIMGERLTMRVREMMFKSILSFEIGWFDYDENNSSLVASRLASDATLVRAAVGDRLSTIAQNLALMTTAFVIAFVLCWKVTFVILATFPCLIGAAIAEQLFLKGFGGDLAKAYARASMVAGEAVGNIRTVAAFCAEDKVLELFQYELAQPAKKSVLRGQIAGFGYGFSQFTMYSSYGLAFWYSSKLVASREANFGDIMKTFMVLVITAFGVAETLALAPDIVKGSQAVASVFEILDRQTEIDPEDPNAEEVVHISGDIELKHVDFAYPSRPDIQIFKDFRLKVKSGQSLALVGASGSGKSSIISLIARFYDPSAGKVLIDGVDIKKLRLRSLRRHIGLVQQEPALFATTIYGNILYGKDSAGESEVIEAAKSANAHTFISGLPNGYQTDVGERGVQLSGGQKQRVAIARAVLKNPAILLLDEATSALDAQSEKVVQDALDRLMRGRTTVMIAHRLSTIKNADVIAVVDGGHIVELGNHDYLMNKAGSIYAQLVNMQQNTDAER

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>