Mapoly0079s0052



Description

SWI/SNF related-matrix-associated actin-dependent regulator of chromatin subfamily C

Reference DB

Database ID Description
GO GO:0003682 Chromatin binding
GO GO:0005515 Protein binding
KEGGORTH K11649 SWI/SNF related-matrix-associated actin-dependent regulator of chromatin subfamily C
KOG KOG1279 Chromatin remodeling factor subunit and related transcription factors
OrthoMCL OG5_127525
PFAM PF00249 Myb-like DNA-binding domain
PFAM PF04433 SWIRM domain
PANTHER PTHR12802 SWI/SNF COMPLEX-RELATED
PANTHER PTHR12802:SF41

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB15 transcription factor, MYB Mapoly0079s0052.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0079s0052.1 scaffold_79:574491..579494  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0079s0052.1  

Gene structure:

mRNA scaffold_79:574491..579494  ( + strand )
five_prime_UTR scaffold_79:574491..574603  ( + strand )
CDS scaffold_79:574604..575171  ( + strand )
CDS scaffold_79:576009..576314  ( + strand )
CDS scaffold_79:576459..577003  ( + strand )
CDS scaffold_79:577321..577812  ( + strand )
CDS scaffold_79:578016..578167  ( + strand )
CDS scaffold_79:578501..578559  ( + strand )
CDS scaffold_79:578774..578925  ( + strand )
CDS scaffold_79:579116..579268  ( + strand )
three_prime_UTR scaffold_79:579269..579494  ( + strand )

Sequences:

Gene

>Mapoly0079s0052.1
TGAAGTTCGAACCACGCTCGCACGCGAGCGCAGGAGGTTCGAAATCGAGGTTAGTGAAATTGAGAACGCAGCGAAGGAAAGATCGATCGATCGACTGGACCGATCGTAAAGCCATGGCGGACGACAATGAGCCTTTGTTGCCGACGACGGGCTCGGCAGCAGCTGCGGGCGTAGGAACTCGACGAATTTCGCAGCAGCACGTGGAATTGAACGAAAACCTAGCGTCTGCAGTGTTTTCGTCCAAGCGCAAGCGCCCGGGAGCAGCGGGCGAGGAGCTCGCAGGAGCCGGGGCGGGAGCAGTGGGAGAGAGCGCTGCGGATGCGAGCTTGGAGAGCAGTCGATTAAAGCGCAGGAATGGAGCTGGAGCGTTGGAAGGAGGCGGGGGAGGCATGGAGAAGGGCACTTGGGGCGGGAAGGTTCTCGCTGGGGGCCCAGGTGTTTCTTCTTCTCCGGTGGAAGGGGCGCAGACGAGGAAGAGGAAAAGCCTCGAGAAGCTGGCTGCTGTCGCCGGTGCGGCTGCGGCGGAAGACGATGGGGGAAGCGTTTCCCCGTCGCGGGAGGTTGTGAAGATCAGCACTAATAGCAGCAGCAGCAAGAAACGAAAGCCTGCCGTTGGGGACGAGGCCGTATGCGGAATGAAGGACGGCCCTGAGCCGAGCGATGAAGGCAGAGTTTCGCAAGGTATGTCGGTCGTTTCGTCTTTCCTCCTTCCCCTGGTCGGTCGGTCAATTCTGGGGTTTACATTCCATTTCTCTTGGTTTTACGTCCCTAAACCCTCTTTTATTTCCAGCGTAATTAGTAGGTGGTCTGTCTCTCAAGGTCGAGTTTGGTAGGTTGGGATGTGTGAGCTCTTTGTTCGTACGGCCACGTCTATGCTGCAACATAATTTTAATGAAGAATATTTTTTCTCATTCGTACCTTCTTGGCTTTTTTATCTCGCTTCCTTTGGGACCGAATCTGGATGTTCGGGGCAATCAGCTTTATCTCCTCGTATAGTTTGATCTGGCAATTGCCCCACGTCCCAGACTCTATTCGATAGCAGTCGAATTGCATTTTGGAGGTGTAATCTTAGCAAGAATCTGGTGCTGAACTGGGACAGGGGCCATTTTGAGAAATCAGCATGTGATATCGTTGTTGGGGTTGGGTTCTTGATGCTGAATGGTGATGTAATTCACGAATTCTAAAATTAGAATTGTGCTCTTCGCACTGCGATCAACGTTTGTTGTCAAATTTGACTCAGACATGTTAGTATGTGGGGGTCTACGAAGACTAGGTTTGTTCAGCTATGTGCAACGTGTAGTTTTGGAAGTCCGCCTTCTTGAGACTACTTTGTGCAAGCTGATCAAGCAGAAGCTCGAACGAACGAGAATGATTTTATAGTACTCCAGAATTGTGTGCTGCCTTTCCTGGTGGGTCTTGAAATTAGCGAGTGAAGGGTTTGGCAAGTTGAGCCTGAAAAGTAGGGACTTGTGTCTGTTTTTTTGTCAGTCCTCCTTATATTCTGAAAGTGCCTATCAGGTCTAAGATTACGATTCACTCGCAGCGGGAATTCTCTTGCCGCTAAAAAAGTTACATGTGAGGAGGACACGCGGACTGGAAGCGCTGGAGAACACACCGAAGGGCCCAACATTAGAAGCAGAGGAAGTTTTGACGTGGCCAATCGAAGCGGCGAAGGGGAGCCGTGGACAATGCCTGCCCAAGTGAGAGATCAGAGTCATCCTTCAGCTGGGGATGGCCATGGCACGCCTGCTAATGCAAGCAATGCTAAAGTTTCTGAGAAATCACCTCTTACTCGTGAACTGTATCGGATACCTAGCCACGCAGGTCAGTGTTTCTATTTACGACCTGAAGAAGGATTGCATCAGGGATTGTCGTAAGGATTTCGATGATTGACATCATAAGTAAAAAAATTGGTTTGAATCCGAATGACCAAGAAAGAATCTTAGTGACTCTTCGTCTGTGATACAGGGTGGTTCTCTTGGAGCAAAATACATAATATCGAAAGGCGATCCTTGGGCGAGTTTTTTGACGGAAAGTCTTTGTCGAAGACTCCTAAGATATACAAGGAGTATAGGGATTTTATCATCAACAAGTACAGAGAGAAAGAACAGCGATTGCTAACTTTTACCGAAGTTCGCCGGATGCTTATCGGAGATGTCAATGCTTTAAGAAGGGTTTTTGACTTCCTGGATCACTGGGGTCTTATCAACCATCAAGTTGGAACTGAATCGAATCAGGAGGCGTCTCCGACACCCATTACTGATGATGGAGTACCCAGTGGTGTGCGAGTGGCCCTGGGTCCCGTAGTTAGCCCTGTTCTCCAATCGGAGTCTTCTCTCGGTGTGTCCAGTCCTTTAACTGGCTTGCAGTTGCATGCTCTTCCGTCATACAGGAATGTGTTTGCTCCGGTAATTCCTGCGGGTGAAGCCGAGAAAATACCTCTTAAGTTTAACTGCTCTTCTTGTGGAGCAGACTGTTCGAAAATCAGATTTCACTGTCAAGACGAGATTCAGGTCGGTGACAAGTTGGATTATTTTAAGTATCATACCGAGGGCGATGAATGTGATGCTGATTGTCTTTTTGTAGACTTCAAAAGTTCCAATGCAGCATGACGCGATGATTTTACGAGGATGCTTGTTTCGTTGTTTTGGCGCTCGATGTCCGGTATATCTTTATTTGAGTAATCATTCTCCTGGTATTACAGCTCAATTATTGCTGACTAGATACGAGGAGATTGTTGTCTCAGCACCCTCTTCTGGGATGGATTAGCAGCTTTTAACTTACAGCAGCTTTCCTTCCCGAAGTGATTGACTTTTTATTCATATTGCAGGCGGGGTTAGATCTGTGTCCTACTTGTTATAAATCTGGAAAGTTTGGACCTATGCGAGTACCGAAAGATTTTGTGCGAATCAATGGGGAGAGCGATTCTACGGGTGATCGATGGACGACTAAGGAGACTTTGAGTTTGCTGGAGGCAATTGGACGTTTCGGTGACAACTGGAATCAAGTAGCAGATTACGTTGGCACGAAGTCGAGGGGGGAGTGTGTGAAGCAGTTCATTCGTCTTCCTTTTGGTGATAGATTTTTAAATGATGCAGGAGCTGACTCACCAGCATTTATGGATGGAGAGAGGATGCTTGTTGATTGTGATGAGGAACCAAGGGTATCGGATGAGGTTCACGAGACAGAAGGAAATATAAAGTCCAATGGTGGGAAGCACTCAGCTGTTAGAGGTTGCCCCGTGTCGGGAAAGTCTGGAAGACGGTCAACGAAACAAGAGTTAACTCCGCTGCAAGATGTGAATAATCCGCTTCTTGGCCAGGTATTGGAATGACATTTTGTCATAGACTTACATTGTCCAAGAATGCAGCGTCCCTAGCCTTGCTCTATGCTCTGTTTGTGTTAACGCCCATTCCTGGAGGACCTTACTTTTGACTGGTGTCACGTCGCATGCTGTTATGGGCTAGTAGGCCTAGGGGACTGTTATCTCCACGACTGACGGACCGGTGAATTATGTCTTGCTAGGTAGCTCTTATGTCTGCTATGGTTGGTTCTCGAGTGGCAGCTGCTGCTGCTCAGGCAGCCATCATCACAATTGCTGAAGACGACCCTGCTTTGGCAAACCATTCAATTATGAATAGGTACTCTACAACTGGAGCTCAGCAGAATTTTGACAGGTAATGTCGGCGAGAACATTGTAATTTCTGACTGGCTGGTACTTGACCTTCTTTTTATAGTACTGGATTTTCCTACTTTCTCGCAATTGATATATACTTAACCTTTGTAGGCCGATGGGTTTCAGGTTGTTACATTCATATGTAACATGCTTCATGTAACTTCAAGAAGAGTTTATACTTTCTCCCAGACTTCCAGTGATATGAACCTACCCTGTTACAGATTTTATATCAAGATATCTACTGGTTGCTTACCACCCGTCGCGAACTTTGTTGTATATCCTCAATCATACAATATCCGATAATATATGTCGTTCAATGGCTTATGTTTTGCAGCCGATCTAAGGAGCCTTCTAGACCGGAGACGCCGGCGCAAGGAGTTTTAGCCCAAGAAGGTATATATGACGGATTTAAAAGGAATTGTATAAACTATAGGATGAGCCCATTTTCATCACGAATGACGAGATATAGGGACGAAGATGGTCTGTTACTTCATGCACACCTGTATCGTGTGCGAGAACGTCTCTACTTTCCTTCAAGGAATATTCTGTACGAAAGTTGACATCTTAGACTTTTGTTTTGTTATCCCTGTGGCTCTTTTTGTTACAGTGGAAAGAGAAGCAGATGGAGGCCCATCAGCGGTGCAGCTTCAAGTAGGCATTGCCACAGGTCTGGCTGCGGCAGCCGTTAATGCAAAACTACTAGCTGACCAGGAAGAACGGGAAATGGAGCTGCTTATGACTGACATTATAGAGAACCAGGTTAGTTCTTCCAATCTTGACTTCAAAGGTTTCCGTATTAAATTTCCAATTATTTCATTTACAACTATCCCTCCATCGAATCAAACTAATGCATGGAAGGTTTTGTGATGCGTTTATATACAAATAAATAGCTGGGTCAAAAGATTGAAATAGGAGTAGAACTGAGCCGGGTCCTTGTTTGTACTGTCAGATGAAAGCACTTTATGCCAAGCTGGAACATTTCGATGAGCTAGAAATGCTTCTAGAGAGAGAGCGCATACAAATTGAGCAAGCTAGACAAACACAATTCTTACAGCAGATCCAATTTACGGAGTCTCGACTTCATTTGACAAGGCATGGCTGAAGTTTAGTGGATTATTTCTTTTTAGTCATTTCTTAGGACTTCTCCTTATGAGAAGATATGCTTACAGGGTGGTAGTCATATGTTGGCTGCCGATACGTAGTTGAAGATAGCTTCTATCCAGTAATACCTCAATATTCAGTGATCTACCTTTCTCCATCTGAGCTTGTCTGTCCGAATCAATTTTAAAGAGAAGAGTGGAAGCAAACCATCCCACAAGGTACTAGTG

mRNA

>Mapoly0079s0052.1
TGAAGTTCGAACCACGCTCGCACGCGAGCGCAGGAGGTTCGAAATCGAGGTTAGTGAAATTGAGAACGCAGCGAAGGAAAGATCGATCGATCGACTGGACCGATCGTAAAGCCATGGCGGACGACAATGAGCCTTTGTTGCCGACGACGGGCTCGGCAGCAGCTGCGGGCGTAGGAACTCGACGAATTTCGCAGCAGCACGTGGAATTGAACGAAAACCTAGCGTCTGCAGTGTTTTCGTCCAAGCGCAAGCGCCCGGGAGCAGCGGGCGAGGAGCTCGCAGGAGCCGGGGCGGGAGCAGTGGGAGAGAGCGCTGCGGATGCGAGCTTGGAGAGCAGTCGATTAAAGCGCAGGAATGGAGCTGGAGCGTTGGAAGGAGGCGGGGGAGGCATGGAGAAGGGCACTTGGGGCGGGAAGGTTCTCGCTGGGGGCCCAGGTGTTTCTTCTTCTCCGGTGGAAGGGGCGCAGACGAGGAAGAGGAAAAGCCTCGAGAAGCTGGCTGCTGTCGCCGGTGCGGCTGCGGCGGAAGACGATGGGGGAAGCGTTTCCCCGTCGCGGGAGGTTGTGAAGATCAGCACTAATAGCAGCAGCAGCAAGAAACGAAAGCCTGCCGTTGGGGACGAGGCCGTATGCGGAATGAAGGACGGCCCTGAGCCGAGCGATGAAGGCAGAGTTTCGCAAGGTCTAAGATTACGATTCACTCGCAGCGGGAATTCTCTTGCCGCTAAAAAAGTTACATGTGAGGAGGACACGCGGACTGGAAGCGCTGGAGAACACACCGAAGGGCCCAACATTAGAAGCAGAGGAAGTTTTGACGTGGCCAATCGAAGCGGCGAAGGGGAGCCGTGGACAATGCCTGCCCAAGTGAGAGATCAGAGTCATCCTTCAGCTGGGGATGGCCATGGCACGCCTGCTAATGCAAGCAATGCTAAAGTTTCTGAGAAATCACCTCTTACTCGTGAACTGTATCGGATACCTAGCCACGCAGGGTGGTTCTCTTGGAGCAAAATACATAATATCGAAAGGCGATCCTTGGGCGAGTTTTTTGACGGAAAGTCTTTGTCGAAGACTCCTAAGATATACAAGGAGTATAGGGATTTTATCATCAACAAGTACAGAGAGAAAGAACAGCGATTGCTAACTTTTACCGAAGTTCGCCGGATGCTTATCGGAGATGTCAATGCTTTAAGAAGGGTTTTTGACTTCCTGGATCACTGGGGTCTTATCAACCATCAAGTTGGAACTGAATCGAATCAGGAGGCGTCTCCGACACCCATTACTGATGATGGAGTACCCAGTGGTGTGCGAGTGGCCCTGGGTCCCGTAGTTAGCCCTGTTCTCCAATCGGAGTCTTCTCTCGGTGTGTCCAGTCCTTTAACTGGCTTGCAGTTGCATGCTCTTCCGTCATACAGGAATGTGTTTGCTCCGGTAATTCCTGCGGGTGAAGCCGAGAAAATACCTCTTAAGTTTAACTGCTCTTCTTGTGGAGCAGACTGTTCGAAAATCAGATTTCACTGTCAAGACGAGATTCAGGCGGGGTTAGATCTGTGTCCTACTTGTTATAAATCTGGAAAGTTTGGACCTATGCGAGTACCGAAAGATTTTGTGCGAATCAATGGGGAGAGCGATTCTACGGGTGATCGATGGACGACTAAGGAGACTTTGAGTTTGCTGGAGGCAATTGGACGTTTCGGTGACAACTGGAATCAAGTAGCAGATTACGTTGGCACGAAGTCGAGGGGGGAGTGTGTGAAGCAGTTCATTCGTCTTCCTTTTGGTGATAGATTTTTAAATGATGCAGGAGCTGACTCACCAGCATTTATGGATGGAGAGAGGATGCTTGTTGATTGTGATGAGGAACCAAGGGTATCGGATGAGGTTCACGAGACAGAAGGAAATATAAAGTCCAATGGTGGGAAGCACTCAGCTGTTAGAGGTTGCCCCGTGTCGGGAAAGTCTGGAAGACGGTCAACGAAACAAGAGTTAACTCCGCTGCAAGATGTGAATAATCCGCTTCTTGGCCAGGTAGCTCTTATGTCTGCTATGGTTGGTTCTCGAGTGGCAGCTGCTGCTGCTCAGGCAGCCATCATCACAATTGCTGAAGACGACCCTGCTTTGGCAAACCATTCAATTATGAATAGGTACTCTACAACTGGAGCTCAGCAGAATTTTGACAGCCGATCTAAGGAGCCTTCTAGACCGGAGACGCCGGCGCAAGGAGTTTTAGCCCAAGAAGTGGAAAGAGAAGCAGATGGAGGCCCATCAGCGGTGCAGCTTCAAGTAGGCATTGCCACAGGTCTGGCTGCGGCAGCCGTTAATGCAAAACTACTAGCTGACCAGGAAGAACGGGAAATGGAGCTGCTTATGACTGACATTATAGAGAACCAGATGAAAGCACTTTATGCCAAGCTGGAACATTTCGATGAGCTAGAAATGCTTCTAGAGAGAGAGCGCATACAAATTGAGCAAGCTAGACAAACACAATTCTTACAGCAGATCCAATTTACGGAGTCTCGACTTCATTTGACAAGGCATGGCTGAAGTTTAGTGGATTATTTCTTTTTAGTCATTTCTTAGGACTTCTCCTTATGAGAAGATATGCTTACAGGGTGGTAGTCATATGTTGGCTGCCGATACGTAGTTGAAGATAGCTTCTATCCAGTAATACCTCAATATTCAGTGATCTACCTTTCTCCATCTGAGCTTGTCTGTCCGAATCAATTTTAAAGAGAAGAGTGGAAGCAAACCATCCCACAAGGTACTAGTG

CDS

>Mapoly0079s0052.1
ATGGCGGACGACAATGAGCCTTTGTTGCCGACGACGGGCTCGGCAGCAGCTGCGGGCGTAGGAACTCGACGAATTTCGCAGCAGCACGTGGAATTGAACGAAAACCTAGCGTCTGCAGTGTTTTCGTCCAAGCGCAAGCGCCCGGGAGCAGCGGGCGAGGAGCTCGCAGGAGCCGGGGCGGGAGCAGTGGGAGAGAGCGCTGCGGATGCGAGCTTGGAGAGCAGTCGATTAAAGCGCAGGAATGGAGCTGGAGCGTTGGAAGGAGGCGGGGGAGGCATGGAGAAGGGCACTTGGGGCGGGAAGGTTCTCGCTGGGGGCCCAGGTGTTTCTTCTTCTCCGGTGGAAGGGGCGCAGACGAGGAAGAGGAAAAGCCTCGAGAAGCTGGCTGCTGTCGCCGGTGCGGCTGCGGCGGAAGACGATGGGGGAAGCGTTTCCCCGTCGCGGGAGGTTGTGAAGATCAGCACTAATAGCAGCAGCAGCAAGAAACGAAAGCCTGCCGTTGGGGACGAGGCCGTATGCGGAATGAAGGACGGCCCTGAGCCGAGCGATGAAGGCAGAGTTTCGCAAGGTCTAAGATTACGATTCACTCGCAGCGGGAATTCTCTTGCCGCTAAAAAAGTTACATGTGAGGAGGACACGCGGACTGGAAGCGCTGGAGAACACACCGAAGGGCCCAACATTAGAAGCAGAGGAAGTTTTGACGTGGCCAATCGAAGCGGCGAAGGGGAGCCGTGGACAATGCCTGCCCAAGTGAGAGATCAGAGTCATCCTTCAGCTGGGGATGGCCATGGCACGCCTGCTAATGCAAGCAATGCTAAAGTTTCTGAGAAATCACCTCTTACTCGTGAACTGTATCGGATACCTAGCCACGCAGGGTGGTTCTCTTGGAGCAAAATACATAATATCGAAAGGCGATCCTTGGGCGAGTTTTTTGACGGAAAGTCTTTGTCGAAGACTCCTAAGATATACAAGGAGTATAGGGATTTTATCATCAACAAGTACAGAGAGAAAGAACAGCGATTGCTAACTTTTACCGAAGTTCGCCGGATGCTTATCGGAGATGTCAATGCTTTAAGAAGGGTTTTTGACTTCCTGGATCACTGGGGTCTTATCAACCATCAAGTTGGAACTGAATCGAATCAGGAGGCGTCTCCGACACCCATTACTGATGATGGAGTACCCAGTGGTGTGCGAGTGGCCCTGGGTCCCGTAGTTAGCCCTGTTCTCCAATCGGAGTCTTCTCTCGGTGTGTCCAGTCCTTTAACTGGCTTGCAGTTGCATGCTCTTCCGTCATACAGGAATGTGTTTGCTCCGGTAATTCCTGCGGGTGAAGCCGAGAAAATACCTCTTAAGTTTAACTGCTCTTCTTGTGGAGCAGACTGTTCGAAAATCAGATTTCACTGTCAAGACGAGATTCAGGCGGGGTTAGATCTGTGTCCTACTTGTTATAAATCTGGAAAGTTTGGACCTATGCGAGTACCGAAAGATTTTGTGCGAATCAATGGGGAGAGCGATTCTACGGGTGATCGATGGACGACTAAGGAGACTTTGAGTTTGCTGGAGGCAATTGGACGTTTCGGTGACAACTGGAATCAAGTAGCAGATTACGTTGGCACGAAGTCGAGGGGGGAGTGTGTGAAGCAGTTCATTCGTCTTCCTTTTGGTGATAGATTTTTAAATGATGCAGGAGCTGACTCACCAGCATTTATGGATGGAGAGAGGATGCTTGTTGATTGTGATGAGGAACCAAGGGTATCGGATGAGGTTCACGAGACAGAAGGAAATATAAAGTCCAATGGTGGGAAGCACTCAGCTGTTAGAGGTTGCCCCGTGTCGGGAAAGTCTGGAAGACGGTCAACGAAACAAGAGTTAACTCCGCTGCAAGATGTGAATAATCCGCTTCTTGGCCAGGTAGCTCTTATGTCTGCTATGGTTGGTTCTCGAGTGGCAGCTGCTGCTGCTCAGGCAGCCATCATCACAATTGCTGAAGACGACCCTGCTTTGGCAAACCATTCAATTATGAATAGGTACTCTACAACTGGAGCTCAGCAGAATTTTGACAGCCGATCTAAGGAGCCTTCTAGACCGGAGACGCCGGCGCAAGGAGTTTTAGCCCAAGAAGTGGAAAGAGAAGCAGATGGAGGCCCATCAGCGGTGCAGCTTCAAGTAGGCATTGCCACAGGTCTGGCTGCGGCAGCCGTTAATGCAAAACTACTAGCTGACCAGGAAGAACGGGAAATGGAGCTGCTTATGACTGACATTATAGAGAACCAGATGAAAGCACTTTATGCCAAGCTGGAACATTTCGATGAGCTAGAAATGCTTCTAGAGAGAGAGCGCATACAAATTGAGCAAGCTAGACAAACACAATTCTTACAGCAGATCCAATTTACGGAGTCTCGACTTCATTTGACAAGGCATGGCTGA

Protein

>Mapoly0079s0052.1
MADDNEPLLPTTGSAAAAGVGTRRISQQHVELNENLASAVFSSKRKRPGAAGEELAGAGAGAVGESAADASLESSRLKRRNGAGALEGGGGGMEKGTWGGKVLAGGPGVSSSPVEGAQTRKRKSLEKLAAVAGAAAAEDDGGSVSPSREVVKISTNSSSSKKRKPAVGDEAVCGMKDGPEPSDEGRVSQGLRLRFTRSGNSLAAKKVTCEEDTRTGSAGEHTEGPNIRSRGSFDVANRSGEGEPWTMPAQVRDQSHPSAGDGHGTPANASNAKVSEKSPLTRELYRIPSHAGWFSWSKIHNIERRSLGEFFDGKSLSKTPKIYKEYRDFIINKYREKEQRLLTFTEVRRMLIGDVNALRRVFDFLDHWGLINHQVGTESNQEASPTPITDDGVPSGVRVALGPVVSPVLQSESSLGVSSPLTGLQLHALPSYRNVFAPVIPAGEAEKIPLKFNCSSCGADCSKIRFHCQDEIQAGLDLCPTCYKSGKFGPMRVPKDFVRINGESDSTGDRWTTKETLSLLEAIGRFGDNWNQVADYVGTKSRGECVKQFIRLPFGDRFLNDAGADSPAFMDGERMLVDCDEEPRVSDEVHETEGNIKSNGGKHSAVRGCPVSGKSGRRSTKQELTPLQDVNNPLLGQVALMSAMVGSRVAAAAAQAAIITIAEDDPALANHSIMNRYSTTGAQQNFDSRSKEPSRPETPAQGVLAQEVEREADGGPSAVQLQVGIATGLAAAAVNAKLLADQEEREMELLMTDIIENQMKALYAKLEHFDELEMLLERERIQIEQARQTQFLQQIQFTESRLHLTRHG

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>